Cathryn Kurkjian, PhD Postdoctoral Trainee University of North Carolina, Chapel Hill.

Size: px
Start display at page:

Download "Cathryn Kurkjian, PhD Postdoctoral Trainee University of North Carolina, Chapel Hill."

Transcription

1 [Type here] [Type here] [Type here], PhD Postdoctoral Trainee University of North Carolina, Chapel Hill Image from:

2 Contents Grade Levels... 2 Subject Area... 2 Objectives... 2 Method... 2 Materials... 2 Duration... 2 Group Size... 2 Key Words... 3 Background... 3 Procedure... 4 Flip the classroom!... 4 Engage... 4 Explore... 4 Explain... 5 Elaborate... 6 Evaluate... 6 Resources... 7 Standards... 7 NC essential Standards... 7 Common Core (grades 9-10)... 7 Common Core (grades 11-12)... 7 Next Generation Science Standards... 8 Amino Acids sheet (cut-outs for activity)... 9 DNA sequence sheet (cut-out for activity Student Handout

3 Grade levels: High school (9-12) Subject areas: Biology Objective: Practice note taking skills and engage in active learning Describe various molecules found within cells (i.e. DNA, RNA, genes, proteins, amino acids) Explain DNA transcription and translation through constructing a protein sequence from a given DNA sequence Interpret results and use this knowledge to hypothesize how defects in transcription and translation can result in disease Method: Teachers should flip the classroom, having students complete a homework assignment prior to the classroom activity. Students will complete an activity that demonstrates how DNA transcription and translation occurs within mammalian cells. Following the engaged learning activity, the instructor will present a lecture that gives in depth information on transcription and translation to build on the concepts students learned during the activity. By the end of the lesson, students should be able to discuss DNA transcription and translation, construct a protein from a given DNA sequence, and apply this knowledge to understanding how there may be disease states related in transcription and translation misregulation. Materials: Handout Informational sheet for activity (1) plastic Easter egg or (1) small Tupperware container to serve as the cell nucleus Construction paper cut into a long strip, labeled with a DNA sequence and folded to place inside the nucleus Construction paper cut-outs with amino acid 1-letter abbreviations Ziploc bags (sandwich or snack size) to store amino acids (1 bag per group) Glue sticks or Scotch tape Optional: The Biology Coloring Book by Robert D. Griffin Optional: YouTube video (https://www.youtube.com/watch?v=6yqplgnjr4q) and appropriate technology for watching the video Duration: Approximately two 50 minute class periods Group Size: This lesson plan is appropriate for all class sizes. For the activity, students should work in groups of

4 Key Words: Deoxyribonucleic acid (DNA) Encodes your genetic information Genome An organisms complete set of DNA Genes Made of DNA, genes act as instructions for making proteins; the human genome contains about 30,000 genes Nucleotide bases (nucleobases) Forms basic structural unit of DNA and RNA Purines: Adenine and Guanine Pyrimidines: Thymine, Cytosine, and Uracil (note: in RNA, Uracil replaces Thymine) Nucleotide pairing Also known as base pairing, is the joining of purine to a pyrimidine through a hydrogen bond link (A T, C G, or A U in RNA) Ribonucleic acid (RNA) Messenger to carry instructions from DNA for controlling protein synthesis messenger RNA (mrna) Synthesized from DNA during transcription, mediates transfer of genetic information from the nucleus to the cytoplasm transfer RNA (trna) RNA molecules that carry amino acids to ribosome to form polypeptides ribosomal RNA (rrna) Assembles amino acids into polypeptides that make up proteins Amino Acids An organic compound composed of a carboxyl group and an amino group; the building blocks of proteins Polypeptides Polymer consisting of a number of amino acids Protein Molecule made of one or more long chains of amino acids Ribosome A large complex of proteins that acts as the machinery involved in translation; complex containing RNA and proteins Sequence hypothesis Initially proposed by Francis Crick in 1958, this hypothesis states that the DNA sequence codes for the amino acid sequence Transcription The process of making an mrna sequence from a gene sequence (DNA) template Translation The process of translating mrna into a strand of amino acids (protein) Background: Deoxyribonucleic acid, or DNA, encodes for our entire genetic information. Nucleotide bases, or nucleobases, are the building blocks of DNA. While there are only 4 distinct nucleobases used to construct DNA, the human DNA is made up of a total of about 3 billion bases! The organization of these bases is what determines how things are made in the human body. The sequence of DNA within an individual is like a very large book, and every single person has a unique sequence that sets them apart. Our genome, or our complete set of DNA, is located within the nucleus of all the cells within our body. Important properties of DNA include its ability to replicate during cell division and its ability to drive protein synthesis. However, DNA must perform these functions while never leaving the nucleus. The nucleus is like a vault in a high security bank. While there are certain molecules that are able to enter and exit, DNA must remain within the nucleus at all times under strict guard. DNA, therefore, must utilize various mechanisms to complete its work from within the confines of the nucleus. Proteins are the building blocks of all the tissues in our body; additionally, protein aids in tissue repair and makes up the various chemicals within our bodies (i.e. hormones and enzymes). Genes are regions of DNA that act as templates making proteins through a process known as protein synthesis. DNA must therefore have a mechanism to get the genetic information copied and made into proteins. These processes are what we refer to as transcription and translation. Transcription is the process in which RNA copies the genetic sequence. This copied sequence, or mrna, is able to leave the nucleus where it can then direct protein synthesis. Translation is the process in which the mrna sequence is decoded into a sequence of amino acids. The ribosome, which is located within the cytoplasm, is the machinery that can read the mrna sequence and stitch amino acids together to generate a protein that has a specific function. 3

5 Procedure: Flip the classroom! 1. A homework assignment that describes the process of DNA transcription and translation should be provided prior to this lesson plan. This will allow students to have a brief understanding of the lesson prior to coming to class. a. Example: The Biology Coloring Book by Robert D. Griffin i. This book contains information and coloring exercises for various cell biology topics, including DNA transcription and translation. In addition to giving a brief introduction to the topic, it also requires that students color in the various components of the processes as a mechanism for learning the new material. Engage 2. Start the class off by asking students what they know about proteins based on their previous knowledge of cells, DNA and the human body. a. Think-Pair-Share: Ask students to take about 30 seconds to come up with ideas, and then take another minute to discuss these ideas with their neighbor. b. List and Record: Call on individuals to share their responses. Compile a list on the board of these responses and engage students in a discussion. i. What do they already know about proteins? What questions do they have? 3. Background information a. If using an introductory homework assignment prior to class, discuss the highlights from the assignment at this time. i. What are some key differences between DNA and RNA ii. What are nucleotides? How does nucleotide pairing work? iii. How do you get from DNA RNA proteins? Explore 4. Transcription and Translation Activity a. Illustrate how transcription and translation work through an example. i. A good example to introduce these concepts is the Rosetta Stone The Rosetta Stone is a very important part of Egyptian history. It is a large black granite stone bearing three inscriptions: (1) ancient Egyptian hieroglyphs, (2) Egyptian demonic script and (3) Ancient Greek. It is considered the key to modern understanding of Egyptian hieroglyphs since it contained the same passage in these three different languages. Issued at Memphis, Egypt in 196BC on behalf of King Ptolemy V. It is believed to have been created following the coronation of King Ptolemy V, and the decree established the divine cult of the king. It is believed to be housed at various locations, but is now located at the British Museum (1802) where it is on display to the public. But what does this have to do with transcription and translation?! 1. We want to know what the script says. We cannot take the stone away from the British museum because it is too big (over 1,000lb!) and because it is against the law! So how do we go about trying to figure out what is written on the stone? 2. First, we must go to the British Museum and Transcribe, or copy, the text onto a piece of paper that we can carry with us. 4

6 3. However, we cannot read any of these ancient texts! So what do we do next? 4. We must take the paper containing the transcribed text and bring it to translators outside of the museum who are able to read the language and translate it to English. ii. The process of turning DNA into protein is very similar to this. DNA is found within the nucleus of a cell. It must stay within the nucleus, so we must go there to transcribe it. The transcribed material (mrna) is then able to leave the nucleus and be translated into amino acids which make up a protein. Let s see if we can understand the process through doing this activity. iii. Knowing that information, you can go back and ask the questions: 1. What does the museum represent? Nucleus 2. What does the individual transcribing the text represent? Transcription 3. What does the translator represent? Translation; the Ribosome b. Have students form groups of 2-4 students. c. All students will receive a handout containing a chart showing how to transcribe DNA to RNA and how to translate RNA to protein. This handout will also bare the question, Who s hungry?. The results from this activity will give the answer, PACMAN AND HIS WIFE! d. At the front of the room, the students can find the nucleus (a plastic Easter egg or a small Tupperware container) that contains the genomic information (a DNA sequence written on a piece of construction paper) that we want to use to make protein. e. Students must go to the front of the room and, using their worksheet as a guide, transcribe the DNA into RNA. Once it is transcribed, they can return to their seats to translate the sequence. f. The students will have various pieces of construction paper containing the one letter abbreviations of various amino acids. They will use their handout to determine the amino acid sequence that correlates with their RNA sequence. The amino acids can be glued or taped to their handouts. They have now translated the RNA sequence into a polypeptide. g. If they have correctly gone through the steps of transcription and translation, then the resulting string of 1 letter amino acids while bare the answer to the question. Explain 5. Discuss the results from the activity as a class. Were students about to get the correct answer? If not, determine where the mistakes occurred. a. Was it a transcription error? b. Was it a translation error? 6. Incorporate lecture that gives in depth explanation of how DNA transcription and translation occurs. OR (optional) watch the YouTube video provided above to allow students to get an in depth description of transcription and translation. This video gives detailed explanations of the process beyond the concepts of DNA RNA Protein. After the video, students should have an understanding of the following: a. What are DNA and RNA, and how are they different? b. What are nucleotides? What are the nucleotide pairs for DNA and RNA? c. Where in the cell do transcription and translation occur? d. What are the different types of RNA (mrna, trna and rrna) and what do they do? e. What is an amino acid? How are amino acids processed into a protein (or polypeptide)? 5

7 Elaborate 7. During the explanation following the activity, students should determine if errors occurred at the level of transcription or translation. This can lead to a second class period that focuses on diseases related to defects in transcription and translation. a. The following scientific articles discuss transcription and translation and highlight the various diseases known to be associated with misregulation of these processes. Lee, T.I. and R.A. Young. (2013) Transcriptional Regulation and Its Misregulation in Disease. Cell 152, o Cancer (i.e. breast cancer, prostate cancer, lung cancer) o Autoimmunity and Inflammation o Diabetes mellitus o Cardiovascular disease (congenital birth defects) Scheper, G.C., M.S. van der Knaap, and C.G. Proud. (2007) Translation matters: protein synthesis defects in inherited disease. Nat Rev Gen 8, o Neurodegenerative disease (childhood ataxia with central hypomyelination, CACH) o Wolcott-Rallison syndrome (WRS) o Bone-marrow failure syndrome (i.e. Shwachman-Diamond disease) b. Various lesson plans can be found online demonstrating how point mutations during DNA transcription and translation can result in genetic mutations and disease The Mating Games: Saving Wildlife with Forensic Genetics, the National Math and Science Institute Genetic Mutation worksheet, Lesson Plans inc. (http://www.lessonplansinc.com/lessonplans/gene_mutations_ws.pdf) Genetic Mutations for High School Biology Lesson Plans, Study.com (http://study.com/academy/topic/genetic-mutations-for-high-school-biologylesson-plans.html#overview) c. A potential follow-up assignment could involve students being assigned a disease and doing a report. This report could be a written assignment or a poster that could be presented to the class. Making a poster could be a great group assignment which could allow the instructor to evaluate not only learned material but the ability of students to work in a group environment. Evaluate 8. The initial homework assignment should be graded for completeness. Because it was provided prior to the lesson, it is up to the discretion of the instructor if the assignment should be graded for correct answers. 9. Students should be evaluated for their participation throughout this lesson plan. Participation includes class discussion and working in the groups during the transcription and translation activity. 10. For completion of the activity, students must write down the mrna sequence, construct the amino acid sequence, and determine the answer to the question posed. This handout can be evaluated for completion and correctness. 6

8 Resources: 1. Wikipedia, Rosetta Stone (https://en.wikipedia.org/wiki/rosetta_stone) 2. YouTube (https://www.youtube.com/watch?v=6yqplgnjr4q) 3. The Biology Coloring Book by Robert D. Griffin (1 st edition) 4. Lee, T.I. and R.A. Young. (2013) Transcriptional Regulation and Its Misregulation in Disease. Cell 152, Scheper, G.C., M.S. van der Knaap, and C.G. Proud. (2007) Translation matters: protein synthesis defects in inherited disease. Nat Rev Gen 8, The Mating Games: Saving Wildlife with Forensic Genetics, the National Math and Science Institute 7. Genetic Mutation worksheet, Lesson Plans inc. (http://www.lessonplansinc.com/lessonplans/gene_mutations_ws.pdf) 8. Genetic Mutations for High School Biology Lesson Plans, Study.com (http://study.com/academy/topic/genetic-mutations-for-high-school-biology-lessonplans.html#overview) State and National Standards: North Carolina Essential Standards: Bio.3.1 Explain how traits are determined by the structure and function of DNA. Bio Explain how DNA and RNA code for proteins and determine traits Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations in existing genes lead to changes in function and phenotype. Bio.4.1 Understand how biological molecules are essential to the survival of living organisms Bio Summarize the relationship among DNA, proteins, and amino acids in carrying out the work of cells and how this is similar in all organisms B.CX.1 Understand the global, historical, societal and cultural contexts of the visual arts B.CX.1.3 Understand how art is used to document human experience.* * Note: This standard is applicable only if using historical text, such as the Rosetta Stone described herein, to introduce the concept of transcription and translation. Common Core (Grades 9-10) CCSS.ELA-LITERACY.RST Follow precisely a complex multistep-procedure when carrying out experiments, taking measurements, or performing technical tasks, attending to special cases or exceptions defined in the text. CCSS.ELA-LITERACY.RST Determine the meaning of symbols, key terms and other domainspecific words and phrases as they are used in a specific scientific or technical context relevant to grades 9-10 texts and topics. CCSS.ELA-LITERACY.RST Compare and contrast findings presented in a text to those from other sources (including their own experiments), nothing when the findings support or contradict previous explanations or accounts. 7

9 Common Core (Grades 11-12) CCSS.ELA-LITERACY.RST Follow precisely a complex multistep procedure when carrying out experiments, taking measurements, or performing technical tasks; analyze the specific results based on explanations in the text. CCSS.ELA-LITERACY.RST Determine the meaning of symbols, key terms and other domainspecific words and phrases as they are used in a specific scientific or technical context relevant to grades texts and topics. CCSS.ELA-LIERACY.RST Synthesize information from a range of sources (e.g. texts, experiments, simulations) into a coherent understanding of a process, phenomenon, or concept, resolving conflicting information when possible. Next Generation Science Standards HS-LS1-1 Construct an explanation based on evidence for how the structure of DNA determines the structure of proteins which carry out he essential functions of life through systems of specialized cells HS-LS3-1 Ask questions to clarify relationships about the role of DNA and chromosomes in coding the instructions for characteristic traits passed from parents to offspring 8

10 Print out Amino Acid Blocks on construction paper. Cut blocks out and place into ziplock bag. Each group will get 1 bag containing amino acid blocks from 1 sheet (5 replicates of each AA, 105 blocks total). 9

11 Print out DNA sequence onto Construction paper. Cut out and fold. Insert into a plastic Easter egg or a small Tupperware container. The container will represent the nucleus that the DNA is stored within. 10

12 DNA Transcription and Translation Activity Name Date DNA is made up of nucleotides o Adenine (A) and Guanine (G) are purines o Cytosine (C) and thymine (T) are pyrimidines DNA must form base pairs (or nucleotide pairs) o Purine-Pyrimidine base pairings (A T and C G) result in a proper duplex structure RNA is also made up of nucleotides o Instead of thymine (T), RNA uses uracil (U) o Therefore, A U base pairs occur instead of A T base pairs During Transcription, an RNA sequence is made from DNA o A DNA sequence is: 3 ATG CGC ATG 5 5 TAC GCG TAC 3 You would use the top strand (starting with the 3 ) to make your mrna, so your final result would be: 5 UAC GCG UAC 3 Nucleotides in groups of 3 are translated into amino acids o Using the chart provided, you would determine that the correct amino acid sequence for the above RNA sequence is as follows: Tyr Ala Tyr Amino Acid 3 letter code 1 letter code RNA codons Isoleucine Ile I AUU, AUC, AUA Leucine Leu L CUU, CUC, CUA, CUG, UUA, UUG Valine Val V GUU, GUC, GUA, GUG Phenyalanine Phe F UUU, UUC Methionine Met (start) M AUG Cysteine Cys C UGU, UGC Alanine Ala A GCU, GCC, GCA, GCG Glycine Gly G GGU, GGC, GGA, GGG Proline Pro P CCU, CCC, CCA, CCG Threonine Thr T ACU, ACC, ACA, ACG Serine Ser S UCU, UCG, UCA, UCG, AGU, AGC Tyrosine Tyr Y UAU, UAC Tryptophan Trp W UGG Glutamine Gln Q CAA, CAG Asparagine Asn N AAU, AAC Histidine His H CAU, CAC Glutamic acid Glu E GAA, GAG Aspartic acid Asp D GAU, GAC Lysine Lys K AAA, AAG Arginine Arg R CGU, CGC, CGA, CGG, AGA, AGG Stop codons Stop Stop UAA, UAG, UGA 11

13 Using the information you have previously read and the information provided in this handout, find the answer to the following question: Who s Hungry?! 1. Transcription: Transcribe the DNA found within the nucleus into mrna. 2. Translation: Using the amino acids (1 letter abbreviation) provided, construct the polypeptide (protein). Use scotch tape or a glue stick to adhere the sequence to this handout and determine the answer to the question! 12

In this activity, students investigate the gene that codes for CFTR and explore the transcription and translation of DNA.

In this activity, students investigate the gene that codes for CFTR and explore the transcription and translation of DNA. In this activity, students investigate the gene that codes for CFTR and explore the transcription and translation of DNA. For each student: Science notebook Reproducible Master 6, Cooking Up a Protein

More information

Transcription and Translation. Chapter Ten

Transcription and Translation. Chapter Ten Transcription and Translation Chapter Ten Central Dogma DNA Transcription RNA Translation Protein Definitions Transcription To copy down, within the same language Language = Nucleic Acids DNA to RNA Translation

More information

The Structure and Function of DNA

The Structure and Function of DNA Chapter 0 The Structure and Function of PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey,

More information

Just One Nucleotide! Exploring the Effects of Random Single Nucleotide Mutations

Just One Nucleotide! Exploring the Effects of Random Single Nucleotide Mutations Just One Nucleotide! Exploring the Effects of Random Single Nucleotide Mutations By Beatriz Gonzalez beatriz.gonzalez@sfcollege.edu Associate Professor, Santa Fe College, Gainesville, Florida In this exercise,

More information

Hands on Simulation of Mutation

Hands on Simulation of Mutation Hands on Simulation of Mutation Charlotte K. Omoto P.O. Box 644236 Washington State University Pullman, WA 99164-4236 omoto@wsu.edu ABSTRACT This exercise is a hands-on simulation of mutations and their

More information

Molecular Facts and Figures

Molecular Facts and Figures Nucleic Acids Molecular Facts and Figures DNA/RNA bases: DNA and RNA are composed of four bases each. In DNA the four are Adenine (A), Thymidine (T), Cytosine (C), and Guanine (G). In RNA the four are

More information

2. Describe (draw) the structure of a chromosome. Identify: DNA, proteins + a gene.

2. Describe (draw) the structure of a chromosome. Identify: DNA, proteins + a gene. Biology 12 DNA Functions Practice Exam - KEY A. DNA Structure 1. DNA is often called the "code of life". Actually it contains the code for a) the sequence of amino acids in a protein b) the sequence of

More information

Section 1 Workbook (unit 2) ANSWERS

Section 1 Workbook (unit 2) ANSWERS Section 1 Workbook (unit 2) ANSWERS Complete the following table: nucleotide DNA RN Name: B5. Describe DNA replication 1) Label each base given in the diagram below and describe the 4 primary characteristics

More information

Solution Key Problem Set 3

Solution Key Problem Set 3 Solution Key- 7.016 Problem Set 3 Question 1 The following human pedigree shows the inheritance pattern of a specific disease within a family. Assume that the individuals marrying into the family for all

More information

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects Mutation Mutation provides raw material to evolution Different kinds of mutations have different effects Mutational Processes Point mutation single nucleotide changes coding changes (missense mutations)

More information

RNA and Protein Synthesis

RNA and Protein Synthesis RNA and Protein Synthesis Answer Key Vocabulary: amino acid, anticodon, codon, gene, messenger RNA, nucleotide, ribosome, RNA, RNA polymerase, transcription, transfer RNA, translation Prior Knowledge Questions

More information

Aipotu Part III: Molecular Biology

Aipotu Part III: Molecular Biology Aipotu Part III: Molecular Biology Introduction: The Biological Phenomenon Under Study In this lab, you will continue to explore the biological mechanisms behind the expression of flower color in a hypothetical

More information

Gene Finding CMSC 423

Gene Finding CMSC 423 Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would you decipher

More information

Chapter 1: Bio Primer

Chapter 1: Bio Primer Chapter 1: Bio Primer 1.1 Cell Structure; DNA; RNA; transcription; translation; proteins Prof. Yechiam Yemini (YY) Computer Science Department Columbia University COMS 4761 --2007 Overview Cell structure

More information

Beloit College BIOL Emerging Infectious Diseases

Beloit College BIOL Emerging Infectious Diseases Virus classification and life cycle activity For reference Transcription: Krasner p 131 Translation: Krasner p 132-135 Genetic code: Krasner p 135 A virus is an obligate intracellular parasite, meaning

More information

trna and Protein Building Lab Date Period

trna and Protein Building Lab Date Period trna and Protein Building Lab Name Date Period Purpose: RNA produced in the nucleus of a cell moves out of the nucleus to the cell s ribosomes. This RNA is a specific sequence of bases copied from the

More information

Gene Translation:RNA -> Protein

Gene Translation:RNA -> Protein Gene Translation:RN -> Protein How does a particular sequence of nucleotides specify a particular sequence of amino acids? The answer: by means of transfer RN molecules, each specific for one amino acid

More information

Unit 6 Study Guide Protein Name pg I can tell the difference between mrna, trna, and rrna.

Unit 6 Study Guide Protein Name pg I can tell the difference between mrna, trna, and rrna. Unit 6 Study Guide Protein Name pg. 1 1. I can tell the difference between mrna, trna, and rrna. Messenger RNA (mrna) acts as a copy of the instructions for making a protein. mrna carries these instructions

More information

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets by Louise Brown Jasko John Anthony Campbell Jack Dennis Cassidy Michael Nickelsburg Stephen Prentis Rohm Objectives: 1) Using plastic beads, construct

More information

This activity will help you to learn how a gene provides the instructions for making a protein.

This activity will help you to learn how a gene provides the instructions for making a protein. From Gene to Protein Transcription and Translation By Dr. Ingrid Waldron and Jennifer Doherty, Department of Biology, University of Pennsylvania, Copyright, 2009 1 This activity will help you to learn

More information

DNA Lecture II Protein Synthesis Notes. Using the Code of Life DNA & RNA. Page #1 (Stratton 2010) Name: 2. : production of proteins

DNA Lecture II Protein Synthesis Notes. Using the Code of Life DNA & RNA. Page #1 (Stratton 2010) Name: 2. : production of proteins Page #1 Using the Code of Life DNA & RNA Slide #2 Two process involve DNA : making an copy of DNA a. purpose: b. occurs: c. uses: DNA : production of proteins a. purpose: & b. occurs: between nucleus &

More information

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of

More information

Ruth Sundeen. Lesson 9 Part 1. Help Your Students Learn. Greetings and felicitations from Mrs. Ruth!

Ruth Sundeen. Lesson 9 Part 1. Help Your Students Learn. Greetings and felicitations from Mrs. Ruth! Ruth Sundeen Lesson 9 Part 1 Help Your Students Learn Ages: Eighth grade to high school senior Topics: Protein Synthesis Enzymes Experiment to demonstrate fragility of enzymes Greetings and felicitations

More information

REVISING DNA AND PROTEIN SYNTHESIS (LIVE) 01 JULY 2015 Exam Questions

REVISING DNA AND PROTEIN SYNTHESIS (LIVE) 01 JULY 2015 Exam Questions REVISING DNA AND PROTEIN SYNTHESIS (LIVE) 01 JULY 2015 Exam Questions Question 1 (Adapted from Feb/March 2015 Paper 2 DBE, Question 1.4) The diagram below represents DNA replication. 1.1 Identify the following:

More information

(http://genomes.urv.es/caical) TUTORIAL. (July 2006)

(http://genomes.urv.es/caical) TUTORIAL. (July 2006) (http://genomes.urv.es/caical) TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA

More information

Molecular Biology Basic Concepts

Molecular Biology Basic Concepts Molecular Biology Basic Concepts Prof. Dr. Antônio Augusto Fröhlich Charles Ivan Wust LISHA - UFSC {guto charles}@lisha.ufsc.br http://www.lisha.ufsc.br/~{guto charles} September 2003 September 2003 http://www.lisha.ufsc.br/~guto

More information

2. The instructions for making a protein are provided by a gene, which is a specific segment of a molecule.

2. The instructions for making a protein are provided by a gene, which is a specific segment of a molecule. From Gene to Protein Transcription and Translation By Dr. Ingrid Waldron and Dr. Jennifer Doherty, Department of Biology, University of Pennsylvania, Copyright, 2010 1 In this activity you will learn how

More information

This activity will help you to learn how a gene provides the instructions for making a protein.

This activity will help you to learn how a gene provides the instructions for making a protein. NAME: PERIOD: From Gene to Protein Transcription and Translation By Dr. Ingrid Waldron and Jennifer Doherty, Department of Biology, University of Pennsylvania, Copyright, 2009 i This activity will help

More information

DNA and Protein Synthesis Grade 10

DNA and Protein Synthesis Grade 10 Ohio Standards Connection: Life Sciences Benchmark C Explain the genetic mechanisms and molecular basis of inheritance. Indicator 5 Illustrate the relationship of the structure and function of DNA to protein

More information

From Gene to Protein Transcription and Translation i

From Gene to Protein Transcription and Translation i From Gene to Protein Transcription and Translation i How do the genes in our DNA influence our characteristics? For example, how can a gene determine whether a person is an albino with very pale skin and

More information

Grundlagen der Bioinformatik, SS 08, D. Huson, April 21,

Grundlagen der Bioinformatik, SS 08, D. Huson, April 21, Grundlagen der Bioinformatik, SS 08, D. Huson, April 21, 2008 7 2 Introduction to Molecular Biology We will start with a very short repetition of the basics of molecular biology, including a summary of

More information

Answers and Solutions to Text Problems

Answers and Solutions to Text Problems 22 Answers and Solutions to Text roblems 22.1 DA contains two purines, adenine (A) and guanine (G) and two pyrimidines, cytosine (C) and thymine (T). RA contains the same bases, except thymine (T) is replaced

More information

Transcription, Translation & Protein Synthesis

Transcription, Translation & Protein Synthesis Transcription, Translation & Protein Synthesis Do you remember what proteins are made of? Hundreds of Amino Acids link together to make one Protein There are 20 types of amino acids, some we can make,

More information

B5 B8 ANWERS DNA & ) DNA

B5 B8 ANWERS DNA & ) DNA Review sheet for test B5 B8 ANWERS DNA review 1. What bonds hold complementary bases between 2 strands of DNA together? Hydrogen bonds 2. What bonds exist between sugars and phosphates? Covalent bonds

More information

Students complete all index cards. 10 min. Completion of the anticipation guide.

Students complete all index cards. 10 min. Completion of the anticipation guide. 1 Tuesday, June 9 Objective Domain: Cells and Heredity Students explain the process of inheritance of genetic traits. Students differentiate between DNA and RNA, recognizing the role of each in heredity.

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

Woods Biol Hmwk DNA & Genetic Engineering (key) Pg. 1

Woods Biol Hmwk DNA & Genetic Engineering (key) Pg. 1 Woods Biol Hmwk-6 10-1 DNA & Genetic Engineering (key) Pg. 1 NOTE: Unless otherwise indicated in the problem, DNA will be from the Template strand. Figure 1: Look carefully at Fig s 1 & 2 to determine

More information

PRACTICE TEST QUESTIONS

PRACTICE TEST QUESTIONS PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.

More information

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme. Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.

More information

7.012 Practice Quiz

7.012 Practice Quiz MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel 7.012 Practice Quiz 2 2004 Actual Quiz 2 (closed book)

More information

DNA pol RNA pol ARS trna Ribosome DNA mrna Protein Transcription Translation Replication A B Acceptor stem D-loop T C loop Anticodon loop Variable loop Relative trna gene copy number 0.0 0.2 0.4

More information

1) The first codon translated by all eukaryotes is a. 2) The corresponding amino acid is.

1) The first codon translated by all eukaryotes is a. 2) The corresponding amino acid is. 1) The first codon translated by all eukaryotes is a. 2) The corresponding amino acid is. 3) Translation is terminated when the ribosome encounters. 4) Nucleic acid chains are synthesized in the to direction.

More information

Exercise 7: DNA and Protein Synthesis

Exercise 7: DNA and Protein Synthesis Exercise 7: DNA and Protein Synthesis Introduction DNA is the code of life, and it is the blueprint for all living things. DNA is contained in all cells, and it is replicated every time a cell divides.

More information

Gene Finding. Slides by Carl Kingsford

Gene Finding. Slides by Carl Kingsford Gene Finding Slides by Carl Kingsford Genome of the Cow a sequence of 2.86 billion letters enough letters to fill a million pages of a typical book. TATGGAGCCAGGTGCCTGGGGCAACAAGACTGTGGTCACTGAATTCATCCTTCTTGGTCTAACAGAGAACATAG

More information

Translation Activity Guide

Translation Activity Guide Translation Activity Guide Teacher Key β-globin Translation Translation occurs in the cytoplasm of the cell and is defined as the synthesis of a protein (polypeptide) using information encoded in an mrna

More information

Protein Synthesis Simulation

Protein Synthesis Simulation Protein Synthesis Simulation Name(s) Date Period Benchmark: SC.912.L.16.5 as AA: Explain the basic processes of transcription and translation, and how they result in the expression of genes. (Assessed

More information

What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations

What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations http://members.cox.net/amgough/mutation_chromosome_translocation.gif Introduction: In biology, mutations are changes to the base

More information

From DNA to Protein. Chapter 14

From DNA to Protein. Chapter 14 From DNA to Protein Chapter 14 Impacts, Issues: Ricin and your Ribosomes Ricin is toxic because it inactivates ribosomes, the organelles which assemble amino acids into proteins, critical to life processes

More information

Unit 8 DNA Structure, Replication, and Protein Synthesis

Unit 8 DNA Structure, Replication, and Protein Synthesis Unit 8 DNA Structure, Replication, and Protein Synthesis Objective 3.01 Analyze the molecular basis of heredity including DNA replication, protein synthesis, and gene regulation 1. Which series is arranged

More information

Review of Central Dogma; Simple Mendelian Inheritance

Review of Central Dogma; Simple Mendelian Inheritance . Genome 371 Spring, 2005 Review of Central Dogma; Simple Mendelian Inheritance Problem Set #1 (not for credit): Problems 1-18 test your knowledge of the central dogma. The remaining problems are related

More information

www.lessonplansinc.com Topic: Gene Mutations WS Summary: Students will learn about frame shift mutations and base substitution mutations. Goals & Objectives: Students will be able to demonstrate how mutations

More information

UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS

UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS UIT (12) MLECULE F LIFE: UCLEIC ACID ucleic acids are extremely large molecules that were first isolated from the nuclei of cells. Two kinds of nucleic acids are found in cells: RA (ribonucleic acid) is

More information

Cambridge International Examinations Cambridge International Advanced Level

Cambridge International Examinations Cambridge International Advanced Level Cambridge International Examinations Cambridge International Advanced Level CHEMISTRY 9701/42 Paper 4 Structured Questions May/June 2014 2 hours Candidates answer on the Question Paper. Additional Materials:

More information

Concept 5.4: Proteins include a diversity of structures, resulting in a wide range of functions

Concept 5.4: Proteins include a diversity of structures, resulting in a wide range of functions Concept 5.4: Proteins include a diversity of structures, resulting in a wide range of functions Proteins account for more than 50% of the dry mass of most cells Some proteins speed up chemical reactions

More information

Lesson Overview. Fermentation. Lesson Overview 13.1 RNA

Lesson Overview. Fermentation. Lesson Overview 13.1 RNA Lesson Overview 13.1 RNA Similarities between DNA & RNA They are both nucleic acids They both have: a 5-carbon sugar, a phosphate group, a nitrogenous base. Comparing RNA and DNA There are three important

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:

More information

CHAPTER 16: ANSWERS TO SELECTED PROBLEMS

CHAPTER 16: ANSWERS TO SELECTED PROBLEMS CATER 16: ASWERS T SELECTED RBLEMS SAMLE RBLEMS ( Try it yourself ) 16.1 Connecting the base guanine (shown in Table 16.1) with ribose and phosphate gives the structure of GM. C 2 2 16.2 The complementary

More information

DNA Proccesses. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.

DNA Proccesses. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question. Name: Class: Date: DNA Proccesses Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Mutations within a DNA sequence are a. natural processes that produce

More information

Genetics. Instructor: Dr. Jihad Abdallah Topic 5: Translation of RNA (Protein synthesis)

Genetics. Instructor: Dr. Jihad Abdallah Topic 5: Translation of RNA (Protein synthesis) Genetics Instructor: Dr. Jihad Abdallah Topic 5: Translation of RNA (Protein synthesis) 1 Central dogma of genetics DNA In the nucleus Transcription mrna Translation In the cytoplasm Protein 2 3 The primary

More information

Unit 6 ~ Learning Guide

Unit 6 ~ Learning Guide Unit 6 ~ Learning Guide Name: INSTRUCTIONS Complete the following notes and questions as you work through the related lessons. You are required to have this package completed BEFORE you write your unit

More information

DNA TM Review And EXAM Review. Ms. Martinez

DNA TM Review And EXAM Review. Ms. Martinez DNA TM Review And EXAM Review Ms. Martinez 1. Write out the full name for DNA molecule. Deoxyribonucleic acid 2. What are chromosomes? threadlike strands made of DNA and PROTEIN 3. What does DNA control

More information

13.2 Ribosomes & Protein Synthesis

13.2 Ribosomes & Protein Synthesis 13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).

More information

I. DNA, Chromosomes, Chromatin, and Genes. II. DNA Deoxyribonucleic Acid Located in the of the cell Codes for your - discovered DNA in 1928

I. DNA, Chromosomes, Chromatin, and Genes. II. DNA Deoxyribonucleic Acid Located in the of the cell Codes for your - discovered DNA in 1928 Name: Period: Date: = passing on of characteristics from parents to offspring How?...! I. DNA, Chromosomes, Chromatin, and Genes = blueprint of life (has the instructions for making an organism) = uncoiled

More information

Hiding Data in DNA. 1 Introduction

Hiding Data in DNA. 1 Introduction Hiding Data in DNA Boris Shimanovsky *, Jessica Feng +, and Miodrag Potkonjak + * XAP Corporation + Dept. Computer Science, Univ. of California, Los Angeles Abstract. Just like disk or RAM, DNA and RNA

More information

Genetics Notes C. Molecular Genetics

Genetics Notes C. Molecular Genetics Genetics Notes C Molecular Genetics Vocabulary central dogma of molecular biology Chargaff's rules messenger RNA (mrna) ribosomal RNA (rrna) transfer RNA (trna) Your DNA, or deoxyribonucleic acid, contains

More information

Chapter 10: Protein Synthesis. Biology

Chapter 10: Protein Synthesis. Biology Chapter 10: Protein Synthesis Biology Let s Review What are proteins? Chains of amino acids Some are enzymes Some are structural components of cells and tissues More Review What are ribosomes? Cell structures

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes

II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes HEREDITY = passing on of characteristics from parents to offspring How?...DNA! I. DNA, Chromosomes, Chromatin, and Genes DNA = blueprint of life (has the instructions for making an organism) Chromatin=

More information

Solution Key Problem Set

Solution Key Problem Set Solution Key- 7.013 Problem Set 3-2013 Question 1 You are analyzing the following human pedigree for a disease. Please note: The filled squares or circles represent the abnormal phenotype. The disease

More information

Lab #5: DNA, RNA & Protein Synthesis. Heredity & Human Affairs (Biology 1605) Spring 2012

Lab #5: DNA, RNA & Protein Synthesis. Heredity & Human Affairs (Biology 1605) Spring 2012 Lab #5: DNA, RNA & Protein Synthesis Heredity & Human Affairs (Biology 1605) Spring 2012 DNA Stands for : Deoxyribonucleic Acid Double-stranded helix Made up of nucleotides Each nucleotide= 1. 5-carbon

More information

Pipe Cleaner Proteins. Essential question: How does the structure of proteins relate to their function in the cell?

Pipe Cleaner Proteins. Essential question: How does the structure of proteins relate to their function in the cell? Pipe Cleaner Proteins GPS: SB1 Students will analyze the nature of the relationships between structures and functions in living cells. Essential question: How does the structure of proteins relate to their

More information

DNA: Molecule of Life

DNA: Molecule of Life DNA: Molecule of Life History DNA Structure Protein Synthesis Gene Regulation History of DNA H I S T O By the 1940 s, scientists knew that chromosomes consisted of both DNA and protein but did not know

More information

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Molecular Genetics. RNA, Transcription, & Protein Synthesis Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and

More information

Prep Time: 1 hour. Class Time: 45 minutes

Prep Time: 1 hour. Class Time: 45 minutes ACTIVITY OVERVIEW Abstract: Students use edible models of the DNA molecule to transcribe an mrna sequence, then translate it into a protein. Module: The Basics and Beyond Prior Knowledge Needed: A basic

More information

(DNA) 2 = = RNA - DNA

(DNA) 2 = = RNA - DNA Genetics and Cellular Function Genes and nucleic acids Protein synthesis and secretion DNA replication and the cell cycle Chromosomes and heredity Organization of the Chromatin Threadlike chromatin = chromosomes

More information

Insulin mrna to Protein Kit

Insulin mrna to Protein Kit Insulin mrna to Protein Kit A 3DMD Paper BioInformatics and Mini-Toober Folding Activity Teacher Key and Teacher Notes www. Insulin mrna to Protein Kit Contents Becoming Familiar with the Data... 3 Identifying

More information

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown 1 DNA Coloring - Transcription & Translation Transcription RNA, Ribonucleic Acid is very similar to DNA. RNA normally exists as a single strand (and not the double stranded double helix of DNA). It contains

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

DNA, RNA AND PROTEIN SYNTHESIS

DNA, RNA AND PROTEIN SYNTHESIS DNA, RNA AND PROTEIN SYNTHESIS Evolution of Eukaryotic Cells Eukaryotes are larger, more complex cells that contain a nucleus and membrane bound organelles. Oldest eukarytotic fossil is 1800 million years

More information

Introduction to Molecular Genetics

Introduction to Molecular Genetics Introduction to Molecular Genetics I. Introduction: A. ave you thought much about why you are like your parents, and your kids are (will be) like you? 1. Inherited traits result from the transfer of specific

More information

Biology Genes

Biology Genes Slide 1 / 111 Slide 2 / 111 Biology Genes www.njctl.org Slide 3 / 111 Vocabulary Click on each word below to go to the definition. P site 3' end polymerase chain reaction 5' end parent strand A site promoter

More information

OUTCOMES. PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation OVERVIEW ANIMATION CONTEXT RIBONUCLEIC ACID (RNA)

OUTCOMES. PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation OVERVIEW ANIMATION CONTEXT RIBONUCLEIC ACID (RNA) OUTCOMES PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation 3.5.1 Compare the structure of RNA and DNA. 3.5.2 Outline DNA transcription in terms of the formation of an RNA strand

More information

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication Ch. 12: DNA and RNA 12.1 DNA A. To understand genetics, biologists had to learn the chemical makeup of the gene Genes are made of DNA DNA stores and transmits the genetic information from one generation

More information

Translation. The process of converting the mrna base sequence into amino acid chains or proteins; occurs in the cytoplasm of the cell on ribosomes

Translation. The process of converting the mrna base sequence into amino acid chains or proteins; occurs in the cytoplasm of the cell on ribosomes The process of converting the mrna base sequence into amino acid chains or proteins; occurs in the cytoplasm of the cell on ribosomes The process of converting the mrna base sequence into amino acid chains

More information

Biology 3 Transcription, Translation, and Mutations

Biology 3 Transcription, Translation, and Mutations Biology 3 Transcription, Translation, and Mutations Dr. Terence Lee Overview 1. DNA and RNA structure 2. DNA replication 3. Transcription makes RNA 4. Translation makes protein James Watson, Francis Crick,

More information

RNA Transcription and Translation

RNA Transcription and Translation RNA Transcription and Translation How is information in DNA used to make protein? RNA acts as DNA and protein synthesis machinery Transcription - copying of Translation - production of Whole process =

More information

Genes DNA Replication

Genes DNA Replication Genes DNA Replication Classwork 1. Explain why it is necessary to be able to replicate DNA in order to sustain life. 2. What is the appropriate scientific term used to describe a series of bases that code

More information

Figure During transcription, RNA nucleotides base-pair one by one with DNA

Figure During transcription, RNA nucleotides base-pair one by one with DNA Objectives Describe the process of DNA transcription. Explain how an RNA message is edited. Describe how RNA is translated to a protein. Summarize protein synthesis. Key Terms messenger RNA (mrna) RNA

More information

Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus

Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus Cao, H.W. and Zhang, H.* College of Biological Science and Technology, HeiLongJiang BaYi Agricultural University, DaQing 163319, China. *

More information

RNA and Protein Synthesis Biology Mr. Hines

RNA and Protein Synthesis Biology Mr. Hines RNA and Protein Synthesis 12.3 Biology Mr. Hines Now we know how DNA (genes) are copied. But how is it used to make a living organism? Most of the structures inside of a cell are made of protein - so we

More information

Tuesday 11/13. Agenda 1.Warm Up (Stamp HW) 2.Protein Synthesis Notes 3.HW Time (Transcription/ Translation Worksheet)

Tuesday 11/13. Agenda 1.Warm Up (Stamp HW) 2.Protein Synthesis Notes 3.HW Time (Transcription/ Translation Worksheet) Tuesday 11/13 Warm Up 1.What are the three parts of a nucleotide? How do two nucleotides link together 2.What binds the two strands of DNA together? Be Specific 3.What are the three main enzymes of DNA

More information

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination

More information

Supplemental Material CBE Life Sciences Education. et al.

Supplemental Material CBE Life Sciences Education. et al. Supplemental Material CBE Life Sciences Education SSS Couch SSSSS et al. Supplemental Material 1. The Molecular Biology Capstone Assessment (MBCA) The number to the left of each T/F statement represents

More information

Transcription Activity Guide

Transcription Activity Guide Transcription Activity Guide Teacher Key Ribonucleic Acid (RNA) Introduction Central Dogma: DNA to RNA to Protein Almost all dynamic functions in a living organism depend on proteins. Proteins are molecular

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:.

More information

Academic Nucleic Acids and Protein Synthesis Test

Academic Nucleic Acids and Protein Synthesis Test Academic Nucleic Acids and Protein Synthesis Test Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. Each organism has a unique combination

More information

Biology DNA Protein Synthesis and Fingerprinting. Spring 2009

Biology DNA Protein Synthesis and Fingerprinting. Spring 2009 Biology DNA Protein Synthesis and Fingerprinting Spring 2009 Chains of amino acids 20 named types Create/build structure within organisms Function as important biochemicals Ex: hair, skin, tissues in organs,

More information

The amino acids differ in the properties of their side chains. Hydrophobic, non acidic (the H+ ion won t associate with water)

The amino acids differ in the properties of their side chains. Hydrophobic, non acidic (the H+ ion won t associate with water) Amino Acids 101 What is an amino acid? Amino acids, or alpha- amino acids, are the building blocks of peptides and proteins They are composed of amine and carboxylic acid groups, separated by the alpha-carbon

More information

16 Protein Synthesis: Transcription and Translation

16 Protein Synthesis: Transcription and Translation 16 Protein Synthesis: Transcription and Translation Ge n e s c a r r y t h e information that, along with environmental factors, determines an organism s traits. How does this work? Although the complete

More information

SAM Teacher s Guide DNA to Proteins

SAM Teacher s Guide DNA to Proteins SAM Teacher s Guide DNA to Proteins Overview Students examine the structure of DNA and the processes of translation and transcription, and then explore the impact of various kinds of mutations. Learning

More information