Staphylococcus aureus Protein A (spa) Typing



Similar documents
A Fast, Accurate, and Automated Workflow for Multi Locus Sequence Typing of Bacterial Isolates

ANNUAL REPORT ON STAPHYLOCOCCUS AUREUS BACTERAEMIA CASES IN DENMARK 2008 (part I)

Molecular typing of VTEC: from PFGE to NGS-based phylogeny

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

ANNUAL REPORT ON STAPHYLOCOCCUS AUREUS BACTERAEMIA CASES IN DENMARK 2009 (part I)

Gene mutation and molecular medicine Chapter 15

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

escience and Post-Genome Biomedical Research

June 09, 2009 Random Mutagenesis

Name Class Date. Figure Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Data Analysis for Ion Torrent Sequencing

Commonly Used STR Markers

How many of you have checked out the web site on protein-dna interactions?

Workshop on Methods for Isolation and Identification of Campylobacter spp. June 13-17, 2005

AP BIOLOGY 2010 SCORING GUIDELINES (Form B)

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

MUTATION, DNA REPAIR AND CANCER

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure enzymes control cell chemistry ( metabolism )

Gene and Chromosome Mutation Worksheet (reference pgs in Modern Biology textbook)

Innovations in Molecular Epidemiology

Genetics Module B, Anchor 3

Genetic diagnostics the gateway to personalized medicine

Recombinant DNA Unit Exam

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

Biological Sciences Initiative. Human Genome

CCR Biology - Chapter 9 Practice Test - Summer 2012

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA

Bob Jesberg. Boston, MA April 3, 2014

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Next Generation Sequencing: Technology, Mapping, and Analysis

Module 10: Bioinformatics

Molecular Cloning, Product Brochure

Forensic DNA Testing Terminology

Vector NTI Advance 11 Quick Start Guide

Protein Synthesis How Genes Become Constituent Molecules

Umm AL Qura University MUTATIONS. Dr Neda M Bogari

DNA and Forensic Science

Structure and Function of DNA

DNA Replication in Prokaryotes

Typing in the NGS era: The way forward!

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources

Institutional Partnership Program

Genetics Lecture Notes Lectures 1 2

Lecture 3: Mutations

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)

Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.

PrimeSTAR HS DNA Polymerase

1 Mutation and Genetic Change

Y Chromosome Markers

Bacterial Next Generation Sequencing - nur mehr Daten oder auch mehr Wissen? Dag Harmsen Univ. Münster, Germany dharmsen@uni-muenster.

Single Nucleotide Polymorphisms (SNPs)

Gene Mapping Techniques

Mitochondrial DNA Analysis

Recombinant DNA Technology

Human Leukocyte Antigens - HLA

DNA Insertions and Deletions in the Human Genome. Philipp W. Messer

MRC-Holland MLPA. Description version 12;

Translation Study Guide

Introduction to Bioinformatics 3. DNA editing and contig assembly

Crime Scenes and Genes

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

PRACTICE TEST QUESTIONS

Description: Molecular Biology Services and DNA Sequencing

Bio 102 Practice Problems Genetic Code and Mutation

Becker Muscular Dystrophy

Focusing on results not data comprehensive data analysis for targeted next generation sequencing

Linear Sequence Analysis. 3-D Structure Analysis

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary

restriction enzymes 350 Home R. Ward: Spring 2001

Problem Set 3 KEY

Localised Sex, Contingency and Mutator Genes. Bacterial Genetics as a Metaphor for Computing Systems

Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation

Genetics Test Biology I

Chapter 6 DNA Replication

Biology Final Exam Study Guide: Semester 2

Transcription and Translation of DNA

On Covert Data Communication Channels Employing DNA Steganography with Application in Massive Data Storage

MRC-Holland MLPA. Related SALSA MLPA probemix P091 CFTR: contains probes for the CFTR gene, related to chronic pancreatitis.

IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR)

Replication Study Guide

Antibody Function & Structure

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

Bioinformatics Grid - Enabled Tools For Biologists.

Whole genome sequencing of foodborne pathogens: experiences from the Reference Laboratory. Kathie Grant Gastrointestinal Bacteria Reference Unit

Genetomic Promototypes

Annex 6: Nucleotide Sequence Information System BEETLE. Biological and Ecological Evaluation towards Long-Term Effects

BCOR101 Midterm II Wednesday, October 26, 2005

European Medicines Agency

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.

HCS Exercise 1 Dr. Jones Spring Recombinant DNA (Molecular Cloning) exercise:

Troubleshooting Sequencing Data

MRSA surveillance 2012: Bovines

Bioinformatics Resources at a Glance

Transcription:

Staphylococcus aureus Protein A (spa) Typing Senior scientist Henrik Hasman, National Food Institute-DTU Henrik Hasman hhas@food.dtu.dk +45 35 88 63 47

Typing method for S. aureus Gold standard - Phage typing and PFGE Phage and Band based Labourious: 2-6 days Analysis is subjective and can give non-typable results Communication of data is problematic DNA sequence-based methods Standardized protocol: 1-2 days Analysis is unambiguous Sequence data can easily be transferred Eg. MLST, coa, spa successfully used for S. aureus MLST is not suitable for routine surveillance of MRSA High cost and access to a high-throughput DNA sequencing facility The discriminative power of PFGE is generally higher than most DNAD NA-based methods

Protein A (spa) in S. aureus 2150bp Surface protein Virulence factor Binds to IgG via Fc-binding domain Reduce phagocytosis X-region-variable number of repeats Highly polymorphic» Deletion and duplication of repeats, and point mutations

What is a repeat? Multiple copies of the same nucleotide sequence Tandem vs. interspersed Tandem: -------------------- HENRIKHeNRIKHEnRIKHeNRIK--------------- Interspersed

Region X spontaneous point mutations, loss and/or gain of repeats Variations in the number of repeats DNA polymerase slippage and various recombination events Variations in individual repeats are a result of mutagenesis 298 repeats known today (April 19. 2009) 21-30nt (encode triplet codon) Repeats are assigned an numerical code (in Ridom/Bionummerics) spa type is deduced from the sequence and order of specific repeats

RCAMCAAAA SL Spa-typing of S. aureus r04 PCR and sequencing r20 r17 r20 r34 SR TAYATGTCGT 24 nt repeats (21 to 30 nt) GAGGAAGACAATAACAAGCCTGGT r04 AAAGAAGACAACAACAAACCTGGC r20 r04r20r17r20r34 = t2906

The SPA principle

How to translate sequence into SPA type? Manually (NOT recomended) Identify SL and SR Identify repeats Compare to list of all known repeat sequences Computer-based assignment At least two software solutions exists (Ridom and Bionumerics) Both are quiet expensive (3000+ Euros), but you might already have Bionumerics installed. Then the spa module is a free add-on. Or you might find a collaborating institute or hospital who has one of these programs installed. Otherwise contact your CRL (me) for help.

Bionumerics v4.61

Examples of related SPA types t034 r08r16r02r25r02r25r34 r24r25 t571 r08r16r02r25r02r25r34 r25 t011 r08r16r02r25 r34 r24r25 t108 r08r16r02r25 r24r25 t1255 r08r16 r34 r24r25 t1793 r08r16r02r25r02r25r34r24r24r25 t2876 r08r16r02r25r02r25r 24r25 Genetic events 1 2 1 2 1 1 M L S t1333 r15r12r16r34 r02r25r17r24 >8 t899 r07r16 r23r02r34 >5 T

Examples of pittfalls in relating SPA types t528 r04 t524 r04r17 t529 r04r34 6,72,12,43,49,67,59 ST151 CC151 18,1,1,1,1,5,3 ST71 CC97 6,72,12,43,49,67,59 ST151 CC151

SPA typing vs MLST typing SPA typing has in general higher discriminative power than MLST and lower discriminative power than PFGE! - This means that many SPA types can belong to the same MLST type (also called Sequence Type ST). - Furthermore, closely related Sequence Types can be organized into so-called Clonal Complexes (CC s). t011 t034 t108 t571 t1255 t1793 t2876 ST398 ST804 ST1067 ST752 ST1232 ST621 CC398

SPA typing vs MLST typing In far the most cases, a SPA type will always belong to a certain Sequence Type. However, a few deviations from this rule exists! The SPA type t899 has been shown to belong to both ST9 and ST398. QUESTIONS??? AFTER THE BREAK The magical world of MLST typing.

Multi Locus Sequence Typing (MLST) Senior scientist Henrik Hasman, National Food Institute-DTU Henrik Hasman hhas@food.dtu.dk +45 35 88 63 47

CC398 S. aureus isolates can in most cases be allocated into Clonal Complexes based on their Sequence type (at least human isolates ).

MLST.S(equence) T(ype).C(lonal) C(omplex)???? MLST is performed to obtain the Sequence Type (ST) The ST can often be associated with certain CC s If not, they are called Singletons S. aureus has 10-15 major (human) CC s Each CC has a ST as founder and many ST s as members MLST is performed by sequencing 7 household genes These are selected based on their molecular clock MLST can not substitute PFGE as they have different molecular clocks.

Genes which are sequenced in the MLST arc (Carbamate kinase) aro (Shikimate dehydrogenase) glp (Glycerol kinase) gmk (Guanylate kinase) pta (Phosphate acetyltransferase) tpi (Triosephosphate isomerase) yqi (Acetyle coenzyme A acetyltransferase)

arcc The MLST principle Primer 1797 (100.0%) Primer 1798 (100.0%) Primer 1809 (100.0%) Primer 1810 (100.0%) yqil S. aureus MRSA252 BX571856 2902619 bp Primer 1805 (100.0%) Primer 1806 (100.0%) pta Primer 1807 (95.7%) Primer 1808 (100.0%) tpi aroe Primer 1799 (100.0%) Primer 1800 (95.7%) Primer 1803 (95.0%) Primer 1804 (100.0%) Primer 1801 (100.0%) Primer 1802 (95.7%) glpf gmk

Primers and PCR conditions http://saureus.mlst.net/misc/info.asp

The MLST principle MLST allele sizes: Gene arcc: aroe: glpf: gmk: pta: tpi: yqil: Size 456 bp 456 bp 465 bp 429 bp 474 bp 402 bp 516 bp

How many different alleles? Gene Number of Alleles arcc: 109 aroe: 151 glpf: 118 gmk: 84 pta: 112 tpi: 117 yqil: 108

The MLST principle A A T C A A T C G C A T T T T A A C T G A A A T G A A T A G T G A T A G A A C T G T A G G C A C A A T C G T T A C A C G T G T 3833 Fragment MRSA- 9B- 1797_179 8-1797 0 A A T C A A T C G C A T T T T A A C T G A A A T G A A T A G T G A T A G A A C T G T A G G C A C A A T C G T T A C A C G T G T 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189

The MLST principle

The MLST principle Fragment with required length! Delete/trim

MLST Databases http://saureus.mlst.net saureus.mlst.net/

MLST Databases

MLST Databases

MLST Databases

MLST Databases

MLST Databases

MLST profile: Gene Allelle arcc: 108 aroe: 13 glpf: 1 gmk: 1 pta: 12 tpi: 11 yqil: 13

Finding the Sequence Type (ST):

Finding the Sequence Type (ST):

Finding the Sequence Type (ST):

MLST the fast version. CLCbio DNA workbench + MLST module

3000 Euros Costs: 1500-3000 Euros Results Drag n Drop sequences Costs: 1500Results

http://eburst.mlst.net eburst.mlst.net/

Requires Java running on the computer

arcc aroe

CC398 CC8 CC5

Known members of Clonal Complex 398 ST398 (founder) ST804 ST1067 ST752 ST1232 ST621 ST753 ST291 ST813 ST1066 ST1277 ST1112

Thank you for your attention Questions and remarks?