Workshop on Methods for Isolation and Identification of Campylobacter spp. June 13-17, 2005
|
|
|
- Jerome Thomas
- 10 years ago
- Views:
Transcription
1 Workshop on Methods for Isolation and Identification of Campylobacter spp June 13-17, 2005 Goal: build capacity within the state public health laboratories to effectively identify Campylobacter species and detect outbreaks by: Providing hands-on experience with laboratory procedures for the isolation and characterization of the Campylobacter species commonly isolated from clinical specimens
2 Pre / Post assessment results Participant Pre-Test Post-test % increase in score 1 57% 82% 25% 2 43% 57% 14% 3 51% 80% 29% 4 44% 69% 25% 5 38% 75% 37% 6 35% 65% 30% 7 37% 59% 22% 8 48% 78% 30% 9 47% 72% 25% 10 53% 87% 34% 11 47% 68% 21% 12 25% 52% 27% 13 44% 67% 23% 14 49% 84% 35% 15 40% 53% 13% 16 32% 81% 49%
3 PFGE and Beyond: PulseNet in the Next Decade Bala Swaminathan, PhD Centers for Disease Control and Prevention
4 Why Next Generation Subtyping Methods? PFGE (and other RFLP-based methods) are difficult to standardize Comparability of patterns within and between laboratories requires strict adherence to a standard protocol Normalization of patterns is complex PFGE is labor-intensive and requires high concentrations of a pure culture In some instances or for some pathogen groups, discrimination may not be adequate
5 Requirements for the next generation subtyping method for PulseNet Broad applicability Rapid results (<( 24 h) Inexpensive Better discrimination than PFGE Quantitative relatedness between strains Accurate snapshot of the genome diversity Backward compatibility with PFGE data Easy to perform on a routine basis Amenable to automation Results should be readily comparable within and between laboratories
6 Perna et al, Nature 409: , 2001
7 Methodologic Approaches Multi-locus locus sequence typing (MLST) Inadequate discrimination for most enteric pathogens for outbreak investigations Useful for Campylobacter jejuni Multi-locus locus Variable-Number Tandem Repeat Analysis (MLVA) Most promising for near-term subtyping High throughput SNP analysis Method of choice for the long term
8 Multilocus VNTR Analysis (MLVA) MLVA (Multi( Locus VNTR Analysis) Variable Number Tandem Repeats (VNTRs) Conserved repeat motif found in the genome Example: TAACCG Variable numbers of repeat units among isolates of the same species MLVA examines the number of repeats at multiple loci to determine genetic relationships Isolate A Isolate B Isolate C Isolate D TAACCG TAACCGTAACCG TAACCGTAACCGTAACCGTAACCG TAACCGTAACCGTAACCGTAACCGTAACCG
9 Variable Number Tandem Repeats VNTRs Insertion Deletion
10 Multiple Locus VNTR Analysis can be developed from low-pass sequence data
11 Development of E coli O157 MLVA protocol Contract awarded to the Massachusetts Department of Public Health / State Laboratory Institute in fall 2001 Collaboration with Dr Paul Keim (The Northern Arizona University)
12 E coli O157 strains used in the initial validation at CDC 152 isolates analyzed by both MLVA and PFGE using XbaI Geographically diverse sporadic isolates with unique XbaI PFGE patterns (UPP collection) Outbreak isolates from eight well characterized outbreaks Epidemiologically unrelated isolates clustered by PFGE A subset of 54 isolates were further characterized with BlnI
13 Nine VNTR loci included in the optimized MLVA protocol for E coli O157 VNTR Alternative name 1 Repeat size (bp) No of repeats No of alleles Inside ORF Minimum Maximum VNTR-3 Vhec3, TR Yes VNTR-9 Vhec4, TR No VNTR-10 Vhec1, TR Yes VNTR-17 TR Yes VNTR-19 TR Yes VNTR-25 TR No VNTR-34 Vhec2, TR Yes VNTR-36 Vhec No VNTR Yes 1 Vhec loci are form Lindstedt et al (2003); TR loci are from Noller et al (2003)
14 Discriminatory power of MLVA 152 isolates compared to PFGE 133 unique MLVA patterns 126 unique XbaI I PFGE patterns A subset of 54 isolates were characterized by PFGE using two enzymes 35 unique MLVA patterns 39 unique XbaI-Bln BlnI I PFGE patterns
15 VNTR_vals MLVA_composite Clustering of outbreak isolates and some selected sporadic isolates by MLVA 100 F5733 H6436 G5308 F6141 H F7382 F8751 F8768 F7383 F7384 C9523 C9581 C9815 G5244 A7793 F7349 F7350 F7351 F7353 F7354 F6749 F6750 A8184 EDL933 EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA GA / Stool GA / Stool ME / Environmental GA / Meat CT / Stool VA / Stool NJ / Stool CO / Stool CO / Ground beef NJ / Hamburger NJ / Fatal case WA / Sporadic CA / Outbreak AZ / Sporadic WA / Sporadic OR / Stool WI / Stool WI / Stool WI / Taco meat WI / Stool WI / Stool NY / Fatal case NY / Sibling MI / Stool MI / Hamburger GA water park outbreak CT apple cider outbreak CO outbreak NJ outbreak Western States outbreak WI restaurant outbreak NY County Fair MI outbreak
16 Conclusions from the on-going validation of the E coli O157 MLVA protocol Overall, MLVA slightly less discriminating than PFGE with two enzymes MLVA can further discriminate some of the most common PFGE patterns Epidemiological congruence of the MLVA data appears to be equal to or better than PFGE Development of interpretation guidelines may pose a challenge
17 2005: Future plans July: : Complete the CDC internal validation of the E coli O157 MLVA protocol August-September September: : Begin collaborative validation of the E coli O157 MLVA protocol by transferring the protocol to PulseNet participating laboratories
18 PFGE vs MLVA in Outbreak Isolates (Data from Minnesota Dept of Health) Outbreak OB1 (n=6) OB2 (n=32) OB3 (n=6) OB4 (n=8) OB5 (n=6) OB6 (n=10) PFGE TM 14 (4) TM 215 (1) TM 352 (1) TM 127 TM 5b TM 2d TM 1a TM 43 Outbreak Type MLVA MST 48 MST 62 (1) MST 81 (1) MST 60 (1) MST 61 (29) MST 10 (2) MST 8 (2) MST 105 (2) MST 70 MST 27 (5) MST 30 (1) MST 54 (1) MST 85 (9) Frequency of Outbreak type in Sporadic Isolates PFGE 3 (27%) 0 (0%) 0 (0%) 2 (18%) 1 (09%) 3 (27%) 1 (09%) 0 (0%) MLVA 0 (0%) 0 (0%) 2 (18%) 0 (0%) 0 (0%) 0 (0%) 0 (0%) 0 (0%) 4 (36%) 0 (0%) 0 (0%)
19 Discrimination of Phage Typing and MLVA Within Common SE PFGE Types Most Common No MLVA Types No Phage Types No PFGE Types PFGE Types SE11B6 12 7* NA SE1B NA Phage Types 4 14 NA NA 3 13a 17 NA 11 MLVA Types MSE11 NA 4 5 MSE9 NA 5 4 *Includes RDNC Data from Minnesota Department of Health
20 SNP-based Typing of E coli O157
21 AAGGTTA ATGGTTA
22 SNPs as genotyping markers Unambiguous data Easy to exchange/compare in database Good potential for automation Amenable to high-throughput platforms Useful for long-term epidemiology/population genetics Alternative for typing highly clonal species, serotypes
23 In silico genome comparison Anchor Sakai query EDL933 Most genes are 100% identical ~100 loci bearing SNPs (phageborne, sequencing errors, or paralogous ) Need a better strategy to identify novel SNPs
24 NimbleGen CGR microarray Mutation Mapping Resequencing Singh-Gasson et al 1999 Nat Biotechnol 17: Nuwaysir et al 2002 Genome Res 12:
25 Selection of genes for CGR Conserved among different E coli O157 isolates Single-copy in the genome Re-sequencing capacity per slide ~12Mb (~1,200 genes) 376 O157-specific genes in 95 size-conserved S-loops (including many virulence factors) ~69 housekeeping genes with putative SNPs 754 additional backbone genes randomly-selected throughout the entire genome Large virulence plasmid (po157) Ohnishi et al 2002 PNAS 99:
26 O157 strains for resequencing Strain Origin Year Characteristics PFGE pattern Sakai Japan 1996 stx1+, stx F5733 Georgia 1998 stx1+, stx G5289 Washington 1994 stx2+, Phage type Virginia 2001 stx2+, PFGE type N0436 Colorado 2002 stx N0303 New York 2001 stx1+, stx N0587 North Carolina 2001 stx F6141 Georgia 1998 stx1+, stx F8768 Colorado 2002 stx G5101 Washington 1993 stx1+, stx2+, Mug+, Urea /89 Germany 1989 stx2+, Sorbitol+, O157:H- 2528
27 SNP (376: G-A) G in gene ECs3157 (12Kb, putative sulfatase)
28 Deletions in gene ECs4864 (41Kb, RhsH core protein)
29 Gene absence in ECs2974 (950-bp, Shiga toxin I subunit A)
30 Summary 1,199 complete chromosomal genes (1,167,510-bp) + po157 (92,721-bp) 823 backbone genes (22% of 3,729) 376 S-loop genes (23% of 1,632) 836 SNPs in 511 genes (42% of 1,199) 309 in 9 typical O157:H7 isolates On average, 34 SNPs/1,199 genes between two isolates Estimated ~152 SNPs/5,361 genes between two isolates Non-synonymous : Synonymous = 499 : 337 SNP location: (Backbone vs S-loop) = 552 (350 loci) : 284 (161 loci) Polymorphism (%): (Backbone vs S-loop) = 0125% : 0143%
31 836 SNPs in 511 Conserved Chromosomal Genes
32 Conclusions PFGE will continue to be an essential subtyping method for PulseNet in the near future MLVA may provide additional discrimination for E coli O157:[H7] and some Salmonella serotypes Will start transferring MLVA protocol for E coli O157 :[H7]to state and local public health laboratories in 2005 SNP is the subtyping method of the future; SNP may be used in combination with MLVA Much work remains to be done on new subtyping methods for PulseNet; we hope to continue active participation with public health laboratories
33 Bioterrorism Preparedness and Response Funds for PulseNet Activities ELC and BT are separate funding streams with different (some overlap) goals and objectives ELC funds have not increased maintenance of successful projects; some new projects BT funds for PulseNet Enhance preparedness accelerated or more informative subtyping Increase surge capacity Foodborne pathogen priorities: E coli O157:[H7], Listeria
Molecular typing of VTEC: from PFGE to NGS-based phylogeny
Molecular typing of VTEC: from PFGE to NGS-based phylogeny Valeria Michelacci 10th Annual Workshop of the National Reference Laboratories for E. coli in the EU Rome, November 5 th 2015 Molecular typing
Identification and Characterization of Foodborne Pathogens by Whole Genome Sequencing: A Shift in Paradigm
Identification and Characterization of Foodborne Pathogens by Whole Genome Sequencing: A Shift in Paradigm Peter Gerner-Smidt, MD, ScD Enteric Diseases Laboratory Branch EFSA Scientific Colloquium N o
EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità
EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità Inventory of the expertise on molecular typing of Verocytotoxin-producing
Whole genome sequencing of foodborne pathogens: experiences from the Reference Laboratory. Kathie Grant Gastrointestinal Bacteria Reference Unit
Whole genome sequencing of foodborne pathogens: experiences from the Reference Laboratory Kathie Grant Gastrointestinal Bacteria Reference Unit 16 th June 2014 Planning for Implementation of WGS 2011-2014
Typing in the NGS era: The way forward!
Typing in the NGS era: The way forward! Valeria Michelacci NGS course, June 2015 Typing from sequence data NGS-derived conventional Multi Locus Sequence Typing (University of Warwick, 7 housekeeping genes)
Multi-locus sequence typing (MLST) of C. jejuni infections in the United States Patrick Kwan, PhD
Multi-locus sequence typing (MLST) of C. jejuni infections in the United States Patrick Kwan, PhD National Campylobacter and Helicobacter Reference Laboratory Enteric Diseases Laboratory Branch Centers
The National Antimicrobial Resistance Monitoring System (NARMS)
The National Antimicrobial Resistance Monitoring System (NARMS) Strategic Plan 2012-2016 Table of Contents Background... 2 Mission... 3 Overview of Accomplishments, 1996-2011... 4 Strategic Goals and Objectives...
Innovations in Molecular Epidemiology
Innovations in Molecular Epidemiology Molecular Epidemiology Measure current rates of active transmission Determine whether recurrent tuberculosis is attributable to exogenous reinfection Determine whether
Use of Whole Genome Sequencing (WGS) of food-borne pathogens for public health protection
EFSA Scientific Colloquium n 20 Use of Whole Genome Sequencing (WGS) of food-borne pathogens for public health protection Parma, Italy, 16-17 June 2014 Why WGS based approach Infectious diseases are responsible
Heather Hanson, MPH Bureau of Communicable Disease NYC Department of Health and Mental Hygiene
Heather Hanson, MPH Bureau of Communicable Disease NYC Department of Health and Mental Hygiene Initial Cluster Detection July 6, 2011-NJDOH Epi contacted NYSDOH and NYCDOHMH about an increase in S. Heidelberg
Does Big Data offer Better Solutions for Microbial Food Safety and Quality?
Does Big Data offer Better Solutions for Microbial Food Safety and Quality? Martin Wiedmann Department of Food Science Cornell University, Ithaca, NY E-mail: [email protected] Acknowledgments Helpful discussions
Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
The PCA Peanut Butter Outbreak - Minnesota s Involvement and Perspective
The PCA Peanut Butter Outbreak - Minnesota s Involvement and Perspective Dave Boxrud, MS Laboratory Supervisor Minnesota Department of Health Stephanie Meyer, MPH Epidemiologist Minnesota Department of
General Services Administration Federal Supply Service Authorized Federal Supply Schedule Price List
General Services Administration Federal Supply Service Authorized Federal Supply Schedule Price List GSA Schedule 66 Scientific Equipment and Services SIN 66-1000 Professional Scientific Services IHRC,
Bacterial Next Generation Sequencing - nur mehr Daten oder auch mehr Wissen? Dag Harmsen Univ. Münster, Germany dharmsen@uni-muenster.
Bacterial Next Generation Sequencing - nur mehr Daten oder auch mehr Wissen? Dag Harmsen Univ. Münster, Germany [email protected] Commercial Disclosure Dag Harmsen is co-founder and partial owner
QUICK QUIZ ANSWERS. 3. Some foodborne pathogens can also be spread by water, from person-to-person, and from animal-to-person. A. True B.
QUICK QUIZ ANSWERS MODULE 1 1. An outbreak is an increase in the number of cases of a particular disease greater than is expected for a given time and place. ANSWER:. An outbreak is two or more cases of
A Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
Milk protein genetic variation in Butana cattle
Milk protein genetic variation in Butana cattle Ammar Said Ahmed Züchtungsbiologie und molekulare Genetik, Humboldt Universität zu Berlin, Invalidenstraβe 42, 10115 Berlin, Deutschland 1 Outline Background
CALL FOR DATA ON VEROTOXIGENIC ESCHERICHIA COLI (VTEC) / SHIGATOXIGENIC E. COLI (STEC)
Joint FAO/WHO Expert Meetings on Microbiological Risk Assessment (JEMRA) CALL FOR DATA ON VEROTOXIGENIC ESCHERICHIA COLI (VTEC) / SHIGATOXIGENIC E. COLI (STEC) Background Deadline: 17 June 2016 Verotoxigenic
Legislative Summary Sheet: Bills Related to Military Families Recently Introduced into State Legislatures
Legislative Summary Sheet: Bills Related to Military Families Recently Introduced into State Legislatures This legislative summary sheet was developed to give an overview of the policy and legislation
Introduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 [email protected]
Standard Op PulseNet QA/QC Manual. Standards
PulseNet Quality Assurance/Quality Control (QA/QC) Manual Standard Op PulseNet QA/QC Manual Standards PNG01 PNG02 PNG03 PNG04 PNG05 PNG06 PNG07 PNG08 PNG09 PNL01 PNL02 PNL03 PNL04 PNL05 PNL06 PNL07 PNL08
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
Use of Whole Genome. of food-borne pathogens for public health protection. Efsa Scientific Colloquium Summary Report. 16-17 June 2014, Parma, Italy
20 Efsa Scientific Colloquium Summary Report ISSN 2363-2240 Use of Whole Genome Sequencing (WGS) of food-borne pathogens for public health protection 16-17 June 2014, Parma, Italy EFSA Scientific Colloquium
The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics
The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long
2016 Individual Exchange Premiums updated November 4, 2015
2016 Individual Exchange Premiums updated November 4, 2015 Within the document, you'll find insights across 50 states and DC with available findings (i.e., carrier participation, price leadership, gross
LexisNexis Law Firm Billable Hours Survey Top Line Report. June 11, 2012
LexisNexis Law Firm Billable Hours Survey Top Line Report June 11, 2012 Executive Summary by Law Firm Size According to the survey, we found that attorneys were not billing all the time they worked. There
Next Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University [email protected] http://tandem.bu.edu/ The Human Genome Project took
Hail-related claims under comprehensive coverage
Bulletin Vol. 29, No. 3 : April 2012 Hail-related claims under comprehensive coverage Claims for hail damage more than doubled in 2011 compared with the previous three years. Hail claims are primarily
SNPbrowser Software v3.5
Product Bulletin SNP Genotyping SNPbrowser Software v3.5 A Free Software Tool for the Knowledge-Driven Selection of SNP Genotyping Assays Easily visualize SNPs integrated with a physical map, linkage disequilibrium
Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation
PN 100-9879 A1 TECHNICAL NOTE Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation Introduction Cancer is a dynamic evolutionary process of which intratumor genetic and phenotypic
Commonly Used STR Markers
Commonly Used STR Markers Repeats Satellites 100 to 1000 bases repeated Minisatellites VNTR variable number tandem repeat 10 to 100 bases repeated Microsatellites STR short tandem repeat 2 to 6 bases repeated
Staphylococcus aureus Protein A (spa) Typing
Staphylococcus aureus Protein A (spa) Typing Senior scientist Henrik Hasman, National Food Institute-DTU Henrik Hasman [email protected] +45 35 88 63 47 Typing method for S. aureus Gold standard - Phage
SeattleSNPs Interactive Tutorial: Web Tools for Site Selection, Linkage Disequilibrium and Haplotype Analysis
SeattleSNPs Interactive Tutorial: Web Tools for Site Selection, Linkage Disequilibrium and Haplotype Analysis Goal: This tutorial introduces several websites and tools useful for determining linkage disequilibrium
QUALITY AND SAFETY TESTING
QUALITY AND SAFETY TESTING Large scale of solutions for the identification and rapid detection of micro-organisms. Easier investment in molecular techniques Frédéric BAR, Key Account Manager b2 b3b4 Quality
ENS Governmental Format Status (As of 06/16/2008)
Alaska AK Production (G) Region D Tan - Development Required Alabama AL Production (G) Region C Arkansas AR Production (G) Region C D Yellow - Pended for required Beta Site Green - In Production - Direct
Provisioning robust automated analytical pipelines for whole genome-based public health microbiological typing
Provisioning robust automated analytical pipelines for whole genome-based public health microbiological typing Anthony Underwood Bioinformatics Unit, Infectious Disease Informatics, Microbiological Services,
Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)
Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur
STATE INCOME TAX WITHHOLDING INFORMATION DOCUMENT
STATE INCOME TAX WITHHOLDING INFORMATION DOCUMENT Zurich American Life Insurance Company (ZALICO) Administrative Offices: PO BOX 19097 Greenville, SC 29602-9097 800/449-0523 This document is intended to
How To Get A National Rac (And Mac)
7 th National RAC (and MAC) Summit December 5 6, 2012 Washington, DC Jane Snecinski P.O. Box 12078 Atlanta, GA 30355 www.postacuteadvisors.com National client base (both public and private sector) based
How many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
Cost and Benefits of Individual and Family Health Insurance. December 2013
Cost and Benefits of Individual and Family Health Insurance December 2013 ehealth 12.2013 Table of Contents Introduction and Background... 3 Methodology Summary... 3 Report Highlights - Policies active
A Fast, Accurate, and Automated Workflow for Multi Locus Sequence Typing of Bacterial Isolates
Application Note MLST A Fast, Accurate, and Automated Workflow for Multi Locus Sequence Typing of Bacterial Isolates Using Applied Biosystems 3130 and 3730 Series Capillary Electrophoresis Systems and
Appendix B: Provincial Case Definitions for Reportable Diseases
Infectious Diseases Protocol Appendix B: Provincial Case Definitions for Reportable Diseases Disease: Verotoxin-producing E. coli infection indicator conditions, including Hemolytic Uremic Syndrome (HUS)
Quality Assurance and Validation of Next Generation Sequencing
Quality Assurance and Validation of Next Generation Sequencing Amy Gargis, Ph.D. IHRC Inc. BioDefense Research and Development Laboratory Laboratory Preparedness and Response Branch Next Generation Sequencing:
Food Safety Issues Arising at Food Production in a Global Market
Journal of Agribusiness 18(1), Special Issue (March 2000):129S133 2000 Agricultural Economics Association of Georgia Food Safety Issues Arising at Food Production in a Global Market Michael P. Doyle Foodborne
Health Insurance Price Index Report for Open Enrollment and Q1 2014. May 2014
Health Insurance Price Index Report for Open Enrollment and May 2014 ehealth 5.2014 Table of Contents Introduction... 3 Executive Summary and Highlights... 4 Nationwide Health Insurance Costs National
INTRODUCTION. Figure 1. Contributions by Source and Year: 2012 2014 (Billions of dollars)
Annual Survey of Public Pensions: State- and Locally- Administered Defined Benefit Data Summary Report: Economy-Wide Statistics Division Briefs: Public Sector By Phillip Vidal Released July 2015 G14-ASPP-SL
COMMERCIAL FINANCE ASSOCIATION. Annual Asset-Based Lending and Factoring Surveys, 2008
COMMERCIAL FINANCE ASSOCIATION Annual Asset-Based Lending and Factoring Surveys, 2008 Non-Member Edition May 6, 2009 R.S. Carmichael & Co., Inc. Commercial Finance Association 70 West Red Oak Lane (4 th
Replacing TaqMan SNP Genotyping Assays that Fail Applied Biosystems Manufacturing Quality Control. Begin
User Bulletin TaqMan SNP Genotyping Assays May 2008 SUBJECT: Replacing TaqMan SNP Genotyping Assays that Fail Applied Biosystems Manufacturing Quality Control In This Bulletin Overview This user bulletin
Challenges and Progress: Implementing HIV Screening in Health-Care Settings
Challenges and Progress: Implementing HIV Screening in Health-Care Settings Bernard M. Branson, M.D. Associate Director for Laboratory Diagnostics Divisions of HIV/AIDS Prevention National Center for HIV/AIDS,
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
ANTHONY P. CARNEVALE NICOLE SMITH JEFF STROHL
State-Level Analysis HELP WANTED PROJECTIONS of JOBS and EDUCATION REQUIREMENTS Through 2018 JUNE 2010 ANTHONY P. CARNEVALE NICOLE SMITH JEFF STROHL Contents 1 Introduction 3 U.S. Maps: Educational concentrations
Alaska (AK) Arizona (AZ) Arkansas (AR) California-RN (CA-RN) Colorado (CO)
Beth Radtke 50 Included in the report: 7/22/2015 11:15:28 AM Alaska (AK) Arizona (AZ) Arkansas (AR) California-RN (CA-RN) Colorado (CO) Connecticut (CT) Delaware (DE) District Columbia (DC) Florida (FL)
Focusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
The high school's nurse reported no notable illnesses among the students.
GASTROENTERITIS OUTBREAK ATTRIBUTED TO CLOSTRIDIUM PERFRINGENS TYPE A ENTEROTOXIN MIAMI COUNTY, KANSAS FEBRUARY 2006 FINAL REPORT DATE April 10, 2006 OUTBREAK INVESTIGATORS Christine Godfrey, Public Health
SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications
Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each
TURIN. Historical capital of Italy. City of Art, Nature, Food and Sport. Turin is crossed by the Po river, the Italy s longest river
TURIN Historical capital of Italy City of Art, Nature, Food and Sport Turin is crossed by the Po river, the Italy s longest river The Mole Antonelliana (1863-1889), 167.5 Meters tall is the symbol of the
Transmission of genetic variation: conjugation. Transmission of genetic variation: conjugation
Transmission of genetic variation: conjugation Transmission of genetic variation: conjugation Bacterial Conjugation is genetic recombination in which there is a transfer of DNA from a living donor bacterium
Marijuana and driving in the United States: prevalence, risks, and laws
Marijuana and driving in the United States: prevalence, risks, and laws Casualty Actuarial Society Spring Meeting Colorado Springs, Colorado May 19, 2015 Anne T. McCartt iihs.org IIHS is an independent,
The Human Genome Project
The Human Genome Project Brief History of the Human Genome Project Physical Chromosome Maps Genetic (or Linkage) Maps DNA Markers Sequencing and Annotating Genomic DNA What Have We learned from the HGP?
WHO Regional Office for Europe update on avian influenza A (H7N9) virus
WHO Regional Office for Europe update on avian influenza A (H7N9) virus Situation update 2: 30 April 2013 Address requests about publications of the WHO Regional Office for Europe to: Publications WHO
Becker Muscular Dystrophy
Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency
Next Generation Sequencing in Public Health Laboratories. 2014 Survey Results
Next Generation Sequencing in Public Health Laboratories 2014 Survey Results MAY 2015 This project was 100% funded with federal funds from a federal program of $215,972. This publication was supported
Community College/Technical Institute Mission Convergence Study
Center for Community College Policy Education Commission of the States Community College/Technical Institute Mission Convergence Study Phase 1: Survey of the States Prepared by Donald E. Puyear, Ph.D.
Originally published as:
Originally published as: Weiss, B., Rabsch, W., Prager, R., Tietze, E., Koch, J., Mutschmann, F., Roggentin, P., Frank, C. Babies and bearded dragons: Sudden increase in reptile-associated Salmonella enterica
Globally, about 9.7% of cancers in men are prostate cancers, and the risk of developing the
Chapter 5 Analysis of Prostate Cancer Association Study Data 5.1 Risk factors for Prostate Cancer Globally, about 9.7% of cancers in men are prostate cancers, and the risk of developing the disease has
Resource Brief: Ombudsman Program Data Management Systems
Resource Brief: Ombudsman Program Prepared by the National Association of State Units on Aging National Long-Term Care Ombudsman Resource Center National Citizens' Coalition for Nursing Home Reform 1424
SEQUENCING. From Sample to Sequence-Ready
SEQUENCING From Sample to Sequence-Ready ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES, NOT ONCE, BUT EVERY TIME The highest-quality amplicons more sensitive, accurate, and specific Full support for all major
90-400 APPENDIX B. STATE AGENCY ADDRESSES FOR INTERSTATE UIB CLAIMS
INTERSTATE UIB CLAIMS Alabama Multi- Unit (#01) Industrial Relations Bldg. Montgomery, AL 31604 Alaska Interstate Unit (#02) P.O. Box 3-7000 Juneau, AK 99801 Arizona Interstate Liable Office (#03) Department
Annual Report on Zoonoses in Denmark 2014
Annual Report on Zoonoses in Denmark 2014 Edited by: Anne Wingstrand, Anna Irene Vedel Sørensen and Birgitte Helwigh Danish Zoonosis Centre National Food Institute Technical University of Denmark Luise
A Salmonella Geno-Serotyping Array (SGSA) for the Rapid Classification of Serovars
A Salmonella Geno-Serotyping Array (SGSA) for the Rapid Classification of Serovars Catherine Yoshida 1, Erika J. Lingohr 1, Kristyn Franklin 1, Levente Bodrossy 2,5, Muna Anjum 3, Clifford G. Clark 4,
Use and Characteristics of Electronic Health Record Systems Among Office-based Physician Practices: United States, 2001 2013
Use and Characteristics of Electronic Health Record Systems Among Office-based Physician Practices: United States, 2001 2013 Chun-Ju Hsiao, Ph.D., and Esther Hing, M.P.H. Key findings In 2013, 78% of office-based
Enrollment Snapshot of Radiography, Radiation Therapy and Nuclear Medicine Technology Programs 2013
Enrollment Snapshot of Radiography, Radiation Therapy and Nuclear Medicine Technology Programs 2013 A Nationwide Survey of Program Directors Conducted by the American Society of Radiologic Technologists
List of low tuition universities in the USA. 1. Louisiana Tech University, LA Total Cost to. International Students: $17,472
A list of top universities in the US with low tuition fees for international students. So please find below a comprehensive list of low tuition universities in the US with their respective tuition fees.
Data Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
Forensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
Comparison Group: Small Colleges* [Weighted] Item Variable Responses Count Percent Count Percent Count Percent
Frequency Distributions - (6-20) 6. At this college, I participated in one or more accelerated courses/fast-track programs to help me move through developmental/basic skills/college prep requirements more
Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
Cancellation/Nonrenewal Surplus Lines Exemptions
Cancellation/Nonrenewal Surplus Lines Exemptions * Indicates updates in laws or regulations for the state Contact: Tina Crum, [email protected], 847-553-3804 Disclaimer: This document was prepared by
Comparative genomic hybridization Because arrays are more than just a tool for expression analysis
Microarray Data Analysis Workshop MedVetNet Workshop, DTU 2008 Comparative genomic hybridization Because arrays are more than just a tool for expression analysis Carsten Friis ( with several slides from
FHF prosjekt 900706:
FHF prosjekt 900706: Sporing av laks: SNP-tilnærming Matthew Kent, Harald Grove, Teresa Andersstuen, Mariann Arnyasi, Kristil Sundsaasen, Sigbjørn Lien CIGENE, Dept Animal and Aquaculture Sciences, Norwegian
International Conference on Emerging Infectious Diseases 2015 Poster and Oral Presentation Abstracts
International Conference on Emerging Infectious Diseases 2015 Poster and Oral Presentation Abstracts Emerging Infectious Diseases is providing access to these abstracts on behalf of the ICEID 2015 program
DNA-Analytik III. Genetische Variabilität
DNA-Analytik III Genetische Variabilität Genetische Variabilität Lexikon Scherer et al. Nat Genet Suppl 39:s7 (2007) Genetische Variabilität Sequenzvariation Mutationen (Mikro~) Basensubstitution Insertion
Molecular Diagnostics in the Clinical Microbiology Laboratory
Molecular Diagnostics in the Clinical Microbiology Laboratory Patrick Tang, MD, PhD, FRCPC B.C. Centre for Disease Control University of British Columbia Molecular Diagnostics in the Clinical Microbiology
EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità
Identification and characterization of Verocytotoxin-producing Escherichia coli (VTEC) by Real Time PCR amplification of the main virulence genes and the genes associated with the serogroups mainly associated
The State of Peer Support Services 2015. Allen S. Daniels, Ed.D Peter Ashenden
The State of Peer Support Services 2015 Allen S. Daniels, Ed.D Peter Ashenden Introduction and Overview 1. Training and Certification 2. Understanding Peer Roles 3. Medicaid Billing and Reimbursement for
50-State Analysis. School Attendance Age Limits. 700 Broadway, Suite 810 Denver, CO 80203-3442 303.299.3600 Fax: 303.296.8332
0-State Analysis School Attendance Age Limits 700 Broadway, Suite 810 Denver, CO 80203-32 303.299.3600 Fax: 303.296.8332 Introduction School Attendance Age Limits By Marga Mikulecky April 2013 This 0-State
