Workshop on Methods for Isolation and Identification of Campylobacter spp. June 13-17, 2005

Size: px
Start display at page:

Download "Workshop on Methods for Isolation and Identification of Campylobacter spp. June 13-17, 2005"

Transcription

1 Workshop on Methods for Isolation and Identification of Campylobacter spp June 13-17, 2005 Goal: build capacity within the state public health laboratories to effectively identify Campylobacter species and detect outbreaks by: Providing hands-on experience with laboratory procedures for the isolation and characterization of the Campylobacter species commonly isolated from clinical specimens

2 Pre / Post assessment results Participant Pre-Test Post-test % increase in score 1 57% 82% 25% 2 43% 57% 14% 3 51% 80% 29% 4 44% 69% 25% 5 38% 75% 37% 6 35% 65% 30% 7 37% 59% 22% 8 48% 78% 30% 9 47% 72% 25% 10 53% 87% 34% 11 47% 68% 21% 12 25% 52% 27% 13 44% 67% 23% 14 49% 84% 35% 15 40% 53% 13% 16 32% 81% 49%

3 PFGE and Beyond: PulseNet in the Next Decade Bala Swaminathan, PhD Centers for Disease Control and Prevention

4 Why Next Generation Subtyping Methods? PFGE (and other RFLP-based methods) are difficult to standardize Comparability of patterns within and between laboratories requires strict adherence to a standard protocol Normalization of patterns is complex PFGE is labor-intensive and requires high concentrations of a pure culture In some instances or for some pathogen groups, discrimination may not be adequate

5 Requirements for the next generation subtyping method for PulseNet Broad applicability Rapid results (<( 24 h) Inexpensive Better discrimination than PFGE Quantitative relatedness between strains Accurate snapshot of the genome diversity Backward compatibility with PFGE data Easy to perform on a routine basis Amenable to automation Results should be readily comparable within and between laboratories

6 Perna et al, Nature 409: , 2001

7 Methodologic Approaches Multi-locus locus sequence typing (MLST) Inadequate discrimination for most enteric pathogens for outbreak investigations Useful for Campylobacter jejuni Multi-locus locus Variable-Number Tandem Repeat Analysis (MLVA) Most promising for near-term subtyping High throughput SNP analysis Method of choice for the long term

8 Multilocus VNTR Analysis (MLVA) MLVA (Multi( Locus VNTR Analysis) Variable Number Tandem Repeats (VNTRs) Conserved repeat motif found in the genome Example: TAACCG Variable numbers of repeat units among isolates of the same species MLVA examines the number of repeats at multiple loci to determine genetic relationships Isolate A Isolate B Isolate C Isolate D TAACCG TAACCGTAACCG TAACCGTAACCGTAACCGTAACCG TAACCGTAACCGTAACCGTAACCGTAACCG

9 Variable Number Tandem Repeats VNTRs Insertion Deletion

10 Multiple Locus VNTR Analysis can be developed from low-pass sequence data

11 Development of E coli O157 MLVA protocol Contract awarded to the Massachusetts Department of Public Health / State Laboratory Institute in fall 2001 Collaboration with Dr Paul Keim (The Northern Arizona University)

12 E coli O157 strains used in the initial validation at CDC 152 isolates analyzed by both MLVA and PFGE using XbaI Geographically diverse sporadic isolates with unique XbaI PFGE patterns (UPP collection) Outbreak isolates from eight well characterized outbreaks Epidemiologically unrelated isolates clustered by PFGE A subset of 54 isolates were further characterized with BlnI

13 Nine VNTR loci included in the optimized MLVA protocol for E coli O157 VNTR Alternative name 1 Repeat size (bp) No of repeats No of alleles Inside ORF Minimum Maximum VNTR-3 Vhec3, TR Yes VNTR-9 Vhec4, TR No VNTR-10 Vhec1, TR Yes VNTR-17 TR Yes VNTR-19 TR Yes VNTR-25 TR No VNTR-34 Vhec2, TR Yes VNTR-36 Vhec No VNTR Yes 1 Vhec loci are form Lindstedt et al (2003); TR loci are from Noller et al (2003)

14 Discriminatory power of MLVA 152 isolates compared to PFGE 133 unique MLVA patterns 126 unique XbaI I PFGE patterns A subset of 54 isolates were characterized by PFGE using two enzymes 35 unique MLVA patterns 39 unique XbaI-Bln BlnI I PFGE patterns

15 VNTR_vals MLVA_composite Clustering of outbreak isolates and some selected sporadic isolates by MLVA 100 F5733 H6436 G5308 F6141 H F7382 F8751 F8768 F7383 F7384 C9523 C9581 C9815 G5244 A7793 F7349 F7350 F7351 F7353 F7354 F6749 F6750 A8184 EDL933 EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA GA / Stool GA / Stool ME / Environmental GA / Meat CT / Stool VA / Stool NJ / Stool CO / Stool CO / Ground beef NJ / Hamburger NJ / Fatal case WA / Sporadic CA / Outbreak AZ / Sporadic WA / Sporadic OR / Stool WI / Stool WI / Stool WI / Taco meat WI / Stool WI / Stool NY / Fatal case NY / Sibling MI / Stool MI / Hamburger GA water park outbreak CT apple cider outbreak CO outbreak NJ outbreak Western States outbreak WI restaurant outbreak NY County Fair MI outbreak

16 Conclusions from the on-going validation of the E coli O157 MLVA protocol Overall, MLVA slightly less discriminating than PFGE with two enzymes MLVA can further discriminate some of the most common PFGE patterns Epidemiological congruence of the MLVA data appears to be equal to or better than PFGE Development of interpretation guidelines may pose a challenge

17 2005: Future plans July: : Complete the CDC internal validation of the E coli O157 MLVA protocol August-September September: : Begin collaborative validation of the E coli O157 MLVA protocol by transferring the protocol to PulseNet participating laboratories

18 PFGE vs MLVA in Outbreak Isolates (Data from Minnesota Dept of Health) Outbreak OB1 (n=6) OB2 (n=32) OB3 (n=6) OB4 (n=8) OB5 (n=6) OB6 (n=10) PFGE TM 14 (4) TM 215 (1) TM 352 (1) TM 127 TM 5b TM 2d TM 1a TM 43 Outbreak Type MLVA MST 48 MST 62 (1) MST 81 (1) MST 60 (1) MST 61 (29) MST 10 (2) MST 8 (2) MST 105 (2) MST 70 MST 27 (5) MST 30 (1) MST 54 (1) MST 85 (9) Frequency of Outbreak type in Sporadic Isolates PFGE 3 (27%) 0 (0%) 0 (0%) 2 (18%) 1 (09%) 3 (27%) 1 (09%) 0 (0%) MLVA 0 (0%) 0 (0%) 2 (18%) 0 (0%) 0 (0%) 0 (0%) 0 (0%) 0 (0%) 4 (36%) 0 (0%) 0 (0%)

19 Discrimination of Phage Typing and MLVA Within Common SE PFGE Types Most Common No MLVA Types No Phage Types No PFGE Types PFGE Types SE11B6 12 7* NA SE1B NA Phage Types 4 14 NA NA 3 13a 17 NA 11 MLVA Types MSE11 NA 4 5 MSE9 NA 5 4 *Includes RDNC Data from Minnesota Department of Health

20 SNP-based Typing of E coli O157

21 AAGGTTA ATGGTTA

22 SNPs as genotyping markers Unambiguous data Easy to exchange/compare in database Good potential for automation Amenable to high-throughput platforms Useful for long-term epidemiology/population genetics Alternative for typing highly clonal species, serotypes

23 In silico genome comparison Anchor Sakai query EDL933 Most genes are 100% identical ~100 loci bearing SNPs (phageborne, sequencing errors, or paralogous ) Need a better strategy to identify novel SNPs

24 NimbleGen CGR microarray Mutation Mapping Resequencing Singh-Gasson et al 1999 Nat Biotechnol 17: Nuwaysir et al 2002 Genome Res 12:

25 Selection of genes for CGR Conserved among different E coli O157 isolates Single-copy in the genome Re-sequencing capacity per slide ~12Mb (~1,200 genes) 376 O157-specific genes in 95 size-conserved S-loops (including many virulence factors) ~69 housekeeping genes with putative SNPs 754 additional backbone genes randomly-selected throughout the entire genome Large virulence plasmid (po157) Ohnishi et al 2002 PNAS 99:

26 O157 strains for resequencing Strain Origin Year Characteristics PFGE pattern Sakai Japan 1996 stx1+, stx F5733 Georgia 1998 stx1+, stx G5289 Washington 1994 stx2+, Phage type Virginia 2001 stx2+, PFGE type N0436 Colorado 2002 stx N0303 New York 2001 stx1+, stx N0587 North Carolina 2001 stx F6141 Georgia 1998 stx1+, stx F8768 Colorado 2002 stx G5101 Washington 1993 stx1+, stx2+, Mug+, Urea /89 Germany 1989 stx2+, Sorbitol+, O157:H- 2528

27 SNP (376: G-A) G in gene ECs3157 (12Kb, putative sulfatase)

28 Deletions in gene ECs4864 (41Kb, RhsH core protein)

29 Gene absence in ECs2974 (950-bp, Shiga toxin I subunit A)

30 Summary 1,199 complete chromosomal genes (1,167,510-bp) + po157 (92,721-bp) 823 backbone genes (22% of 3,729) 376 S-loop genes (23% of 1,632) 836 SNPs in 511 genes (42% of 1,199) 309 in 9 typical O157:H7 isolates On average, 34 SNPs/1,199 genes between two isolates Estimated ~152 SNPs/5,361 genes between two isolates Non-synonymous : Synonymous = 499 : 337 SNP location: (Backbone vs S-loop) = 552 (350 loci) : 284 (161 loci) Polymorphism (%): (Backbone vs S-loop) = 0125% : 0143%

31 836 SNPs in 511 Conserved Chromosomal Genes

32 Conclusions PFGE will continue to be an essential subtyping method for PulseNet in the near future MLVA may provide additional discrimination for E coli O157:[H7] and some Salmonella serotypes Will start transferring MLVA protocol for E coli O157 :[H7]to state and local public health laboratories in 2005 SNP is the subtyping method of the future; SNP may be used in combination with MLVA Much work remains to be done on new subtyping methods for PulseNet; we hope to continue active participation with public health laboratories

33 Bioterrorism Preparedness and Response Funds for PulseNet Activities ELC and BT are separate funding streams with different (some overlap) goals and objectives ELC funds have not increased maintenance of successful projects; some new projects BT funds for PulseNet Enhance preparedness accelerated or more informative subtyping Increase surge capacity Foodborne pathogen priorities: E coli O157:[H7], Listeria

Molecular typing of VTEC: from PFGE to NGS-based phylogeny

Molecular typing of VTEC: from PFGE to NGS-based phylogeny Molecular typing of VTEC: from PFGE to NGS-based phylogeny Valeria Michelacci 10th Annual Workshop of the National Reference Laboratories for E. coli in the EU Rome, November 5 th 2015 Molecular typing

More information

Identification and Characterization of Foodborne Pathogens by Whole Genome Sequencing: A Shift in Paradigm

Identification and Characterization of Foodborne Pathogens by Whole Genome Sequencing: A Shift in Paradigm Identification and Characterization of Foodborne Pathogens by Whole Genome Sequencing: A Shift in Paradigm Peter Gerner-Smidt, MD, ScD Enteric Diseases Laboratory Branch EFSA Scientific Colloquium N o

More information

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità Inventory of the expertise on molecular typing of Verocytotoxin-producing

More information

Whole genome sequencing of foodborne pathogens: experiences from the Reference Laboratory. Kathie Grant Gastrointestinal Bacteria Reference Unit

Whole genome sequencing of foodborne pathogens: experiences from the Reference Laboratory. Kathie Grant Gastrointestinal Bacteria Reference Unit Whole genome sequencing of foodborne pathogens: experiences from the Reference Laboratory Kathie Grant Gastrointestinal Bacteria Reference Unit 16 th June 2014 Planning for Implementation of WGS 2011-2014

More information

Typing in the NGS era: The way forward!

Typing in the NGS era: The way forward! Typing in the NGS era: The way forward! Valeria Michelacci NGS course, June 2015 Typing from sequence data NGS-derived conventional Multi Locus Sequence Typing (University of Warwick, 7 housekeeping genes)

More information

Multi-locus sequence typing (MLST) of C. jejuni infections in the United States Patrick Kwan, PhD

Multi-locus sequence typing (MLST) of C. jejuni infections in the United States Patrick Kwan, PhD Multi-locus sequence typing (MLST) of C. jejuni infections in the United States Patrick Kwan, PhD National Campylobacter and Helicobacter Reference Laboratory Enteric Diseases Laboratory Branch Centers

More information

The National Antimicrobial Resistance Monitoring System (NARMS)

The National Antimicrobial Resistance Monitoring System (NARMS) The National Antimicrobial Resistance Monitoring System (NARMS) Strategic Plan 2012-2016 Table of Contents Background... 2 Mission... 3 Overview of Accomplishments, 1996-2011... 4 Strategic Goals and Objectives...

More information

Innovations in Molecular Epidemiology

Innovations in Molecular Epidemiology Innovations in Molecular Epidemiology Molecular Epidemiology Measure current rates of active transmission Determine whether recurrent tuberculosis is attributable to exogenous reinfection Determine whether

More information

Use of Whole Genome Sequencing (WGS) of food-borne pathogens for public health protection

Use of Whole Genome Sequencing (WGS) of food-borne pathogens for public health protection EFSA Scientific Colloquium n 20 Use of Whole Genome Sequencing (WGS) of food-borne pathogens for public health protection Parma, Italy, 16-17 June 2014 Why WGS based approach Infectious diseases are responsible

More information

Heather Hanson, MPH Bureau of Communicable Disease NYC Department of Health and Mental Hygiene

Heather Hanson, MPH Bureau of Communicable Disease NYC Department of Health and Mental Hygiene Heather Hanson, MPH Bureau of Communicable Disease NYC Department of Health and Mental Hygiene Initial Cluster Detection July 6, 2011-NJDOH Epi contacted NYSDOH and NYCDOHMH about an increase in S. Heidelberg

More information

Does Big Data offer Better Solutions for Microbial Food Safety and Quality?

Does Big Data offer Better Solutions for Microbial Food Safety and Quality? Does Big Data offer Better Solutions for Microbial Food Safety and Quality? Martin Wiedmann Department of Food Science Cornell University, Ithaca, NY E-mail: [email protected] Acknowledgments Helpful discussions

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just

More information

The PCA Peanut Butter Outbreak - Minnesota s Involvement and Perspective

The PCA Peanut Butter Outbreak - Minnesota s Involvement and Perspective The PCA Peanut Butter Outbreak - Minnesota s Involvement and Perspective Dave Boxrud, MS Laboratory Supervisor Minnesota Department of Health Stephanie Meyer, MPH Epidemiologist Minnesota Department of

More information

General Services Administration Federal Supply Service Authorized Federal Supply Schedule Price List

General Services Administration Federal Supply Service Authorized Federal Supply Schedule Price List General Services Administration Federal Supply Service Authorized Federal Supply Schedule Price List GSA Schedule 66 Scientific Equipment and Services SIN 66-1000 Professional Scientific Services IHRC,

More information

Bacterial Next Generation Sequencing - nur mehr Daten oder auch mehr Wissen? Dag Harmsen Univ. Münster, Germany dharmsen@uni-muenster.

Bacterial Next Generation Sequencing - nur mehr Daten oder auch mehr Wissen? Dag Harmsen Univ. Münster, Germany dharmsen@uni-muenster. Bacterial Next Generation Sequencing - nur mehr Daten oder auch mehr Wissen? Dag Harmsen Univ. Münster, Germany [email protected] Commercial Disclosure Dag Harmsen is co-founder and partial owner

More information

QUICK QUIZ ANSWERS. 3. Some foodborne pathogens can also be spread by water, from person-to-person, and from animal-to-person. A. True B.

QUICK QUIZ ANSWERS. 3. Some foodborne pathogens can also be spread by water, from person-to-person, and from animal-to-person. A. True B. QUICK QUIZ ANSWERS MODULE 1 1. An outbreak is an increase in the number of cases of a particular disease greater than is expected for a given time and place. ANSWER:. An outbreak is two or more cases of

More information

A Primer of Genome Science THIRD

A Primer of Genome Science THIRD A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:

More information

Milk protein genetic variation in Butana cattle

Milk protein genetic variation in Butana cattle Milk protein genetic variation in Butana cattle Ammar Said Ahmed Züchtungsbiologie und molekulare Genetik, Humboldt Universität zu Berlin, Invalidenstraβe 42, 10115 Berlin, Deutschland 1 Outline Background

More information

CALL FOR DATA ON VEROTOXIGENIC ESCHERICHIA COLI (VTEC) / SHIGATOXIGENIC E. COLI (STEC)

CALL FOR DATA ON VEROTOXIGENIC ESCHERICHIA COLI (VTEC) / SHIGATOXIGENIC E. COLI (STEC) Joint FAO/WHO Expert Meetings on Microbiological Risk Assessment (JEMRA) CALL FOR DATA ON VEROTOXIGENIC ESCHERICHIA COLI (VTEC) / SHIGATOXIGENIC E. COLI (STEC) Background Deadline: 17 June 2016 Verotoxigenic

More information

Legislative Summary Sheet: Bills Related to Military Families Recently Introduced into State Legislatures

Legislative Summary Sheet: Bills Related to Military Families Recently Introduced into State Legislatures Legislative Summary Sheet: Bills Related to Military Families Recently Introduced into State Legislatures This legislative summary sheet was developed to give an overview of the policy and legislation

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 [email protected]

More information

Standard Op PulseNet QA/QC Manual. Standards

Standard Op PulseNet QA/QC Manual. Standards PulseNet Quality Assurance/Quality Control (QA/QC) Manual Standard Op PulseNet QA/QC Manual Standards PNG01 PNG02 PNG03 PNG04 PNG05 PNG06 PNG07 PNG08 PNG09 PNL01 PNL02 PNL03 PNL04 PNL05 PNL06 PNL07 PNL08

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Use of Whole Genome. of food-borne pathogens for public health protection. Efsa Scientific Colloquium Summary Report. 16-17 June 2014, Parma, Italy

Use of Whole Genome. of food-borne pathogens for public health protection. Efsa Scientific Colloquium Summary Report. 16-17 June 2014, Parma, Italy 20 Efsa Scientific Colloquium Summary Report ISSN 2363-2240 Use of Whole Genome Sequencing (WGS) of food-borne pathogens for public health protection 16-17 June 2014, Parma, Italy EFSA Scientific Colloquium

More information

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long

More information

2016 Individual Exchange Premiums updated November 4, 2015

2016 Individual Exchange Premiums updated November 4, 2015 2016 Individual Exchange Premiums updated November 4, 2015 Within the document, you'll find insights across 50 states and DC with available findings (i.e., carrier participation, price leadership, gross

More information

LexisNexis Law Firm Billable Hours Survey Top Line Report. June 11, 2012

LexisNexis Law Firm Billable Hours Survey Top Line Report. June 11, 2012 LexisNexis Law Firm Billable Hours Survey Top Line Report June 11, 2012 Executive Summary by Law Firm Size According to the survey, we found that attorneys were not billing all the time they worked. There

More information

Next Generation Sequencing: Technology, Mapping, and Analysis

Next Generation Sequencing: Technology, Mapping, and Analysis Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University [email protected] http://tandem.bu.edu/ The Human Genome Project took

More information

Hail-related claims under comprehensive coverage

Hail-related claims under comprehensive coverage Bulletin Vol. 29, No. 3 : April 2012 Hail-related claims under comprehensive coverage Claims for hail damage more than doubled in 2011 compared with the previous three years. Hail claims are primarily

More information

SNPbrowser Software v3.5

SNPbrowser Software v3.5 Product Bulletin SNP Genotyping SNPbrowser Software v3.5 A Free Software Tool for the Knowledge-Driven Selection of SNP Genotyping Assays Easily visualize SNPs integrated with a physical map, linkage disequilibrium

More information

Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation

Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation PN 100-9879 A1 TECHNICAL NOTE Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation Introduction Cancer is a dynamic evolutionary process of which intratumor genetic and phenotypic

More information

Commonly Used STR Markers

Commonly Used STR Markers Commonly Used STR Markers Repeats Satellites 100 to 1000 bases repeated Minisatellites VNTR variable number tandem repeat 10 to 100 bases repeated Microsatellites STR short tandem repeat 2 to 6 bases repeated

More information

Staphylococcus aureus Protein A (spa) Typing

Staphylococcus aureus Protein A (spa) Typing Staphylococcus aureus Protein A (spa) Typing Senior scientist Henrik Hasman, National Food Institute-DTU Henrik Hasman [email protected] +45 35 88 63 47 Typing method for S. aureus Gold standard - Phage

More information

SeattleSNPs Interactive Tutorial: Web Tools for Site Selection, Linkage Disequilibrium and Haplotype Analysis

SeattleSNPs Interactive Tutorial: Web Tools for Site Selection, Linkage Disequilibrium and Haplotype Analysis SeattleSNPs Interactive Tutorial: Web Tools for Site Selection, Linkage Disequilibrium and Haplotype Analysis Goal: This tutorial introduces several websites and tools useful for determining linkage disequilibrium

More information

QUALITY AND SAFETY TESTING

QUALITY AND SAFETY TESTING QUALITY AND SAFETY TESTING Large scale of solutions for the identification and rapid detection of micro-organisms. Easier investment in molecular techniques Frédéric BAR, Key Account Manager b2 b3b4 Quality

More information

ENS Governmental Format Status (As of 06/16/2008)

ENS Governmental Format Status (As of 06/16/2008) Alaska AK Production (G) Region D Tan - Development Required Alabama AL Production (G) Region C Arkansas AR Production (G) Region C D Yellow - Pended for required Beta Site Green - In Production - Direct

More information

Provisioning robust automated analytical pipelines for whole genome-based public health microbiological typing

Provisioning robust automated analytical pipelines for whole genome-based public health microbiological typing Provisioning robust automated analytical pipelines for whole genome-based public health microbiological typing Anthony Underwood Bioinformatics Unit, Infectious Disease Informatics, Microbiological Services,

More information

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur

More information

STATE INCOME TAX WITHHOLDING INFORMATION DOCUMENT

STATE INCOME TAX WITHHOLDING INFORMATION DOCUMENT STATE INCOME TAX WITHHOLDING INFORMATION DOCUMENT Zurich American Life Insurance Company (ZALICO) Administrative Offices: PO BOX 19097 Greenville, SC 29602-9097 800/449-0523 This document is intended to

More information

How To Get A National Rac (And Mac)

How To Get A National Rac (And Mac) 7 th National RAC (and MAC) Summit December 5 6, 2012 Washington, DC Jane Snecinski P.O. Box 12078 Atlanta, GA 30355 www.postacuteadvisors.com National client base (both public and private sector) based

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

Cost and Benefits of Individual and Family Health Insurance. December 2013

Cost and Benefits of Individual and Family Health Insurance. December 2013 Cost and Benefits of Individual and Family Health Insurance December 2013 ehealth 12.2013 Table of Contents Introduction and Background... 3 Methodology Summary... 3 Report Highlights - Policies active

More information

A Fast, Accurate, and Automated Workflow for Multi Locus Sequence Typing of Bacterial Isolates

A Fast, Accurate, and Automated Workflow for Multi Locus Sequence Typing of Bacterial Isolates Application Note MLST A Fast, Accurate, and Automated Workflow for Multi Locus Sequence Typing of Bacterial Isolates Using Applied Biosystems 3130 and 3730 Series Capillary Electrophoresis Systems and

More information

Appendix B: Provincial Case Definitions for Reportable Diseases

Appendix B: Provincial Case Definitions for Reportable Diseases Infectious Diseases Protocol Appendix B: Provincial Case Definitions for Reportable Diseases Disease: Verotoxin-producing E. coli infection indicator conditions, including Hemolytic Uremic Syndrome (HUS)

More information

Quality Assurance and Validation of Next Generation Sequencing

Quality Assurance and Validation of Next Generation Sequencing Quality Assurance and Validation of Next Generation Sequencing Amy Gargis, Ph.D. IHRC Inc. BioDefense Research and Development Laboratory Laboratory Preparedness and Response Branch Next Generation Sequencing:

More information

Food Safety Issues Arising at Food Production in a Global Market

Food Safety Issues Arising at Food Production in a Global Market Journal of Agribusiness 18(1), Special Issue (March 2000):129S133 2000 Agricultural Economics Association of Georgia Food Safety Issues Arising at Food Production in a Global Market Michael P. Doyle Foodborne

More information

Health Insurance Price Index Report for Open Enrollment and Q1 2014. May 2014

Health Insurance Price Index Report for Open Enrollment and Q1 2014. May 2014 Health Insurance Price Index Report for Open Enrollment and May 2014 ehealth 5.2014 Table of Contents Introduction... 3 Executive Summary and Highlights... 4 Nationwide Health Insurance Costs National

More information

INTRODUCTION. Figure 1. Contributions by Source and Year: 2012 2014 (Billions of dollars)

INTRODUCTION. Figure 1. Contributions by Source and Year: 2012 2014 (Billions of dollars) Annual Survey of Public Pensions: State- and Locally- Administered Defined Benefit Data Summary Report: Economy-Wide Statistics Division Briefs: Public Sector By Phillip Vidal Released July 2015 G14-ASPP-SL

More information

COMMERCIAL FINANCE ASSOCIATION. Annual Asset-Based Lending and Factoring Surveys, 2008

COMMERCIAL FINANCE ASSOCIATION. Annual Asset-Based Lending and Factoring Surveys, 2008 COMMERCIAL FINANCE ASSOCIATION Annual Asset-Based Lending and Factoring Surveys, 2008 Non-Member Edition May 6, 2009 R.S. Carmichael & Co., Inc. Commercial Finance Association 70 West Red Oak Lane (4 th

More information

Replacing TaqMan SNP Genotyping Assays that Fail Applied Biosystems Manufacturing Quality Control. Begin

Replacing TaqMan SNP Genotyping Assays that Fail Applied Biosystems Manufacturing Quality Control. Begin User Bulletin TaqMan SNP Genotyping Assays May 2008 SUBJECT: Replacing TaqMan SNP Genotyping Assays that Fail Applied Biosystems Manufacturing Quality Control In This Bulletin Overview This user bulletin

More information

Challenges and Progress: Implementing HIV Screening in Health-Care Settings

Challenges and Progress: Implementing HIV Screening in Health-Care Settings Challenges and Progress: Implementing HIV Screening in Health-Care Settings Bernard M. Branson, M.D. Associate Director for Laboratory Diagnostics Divisions of HIV/AIDS Prevention National Center for HIV/AIDS,

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

ANTHONY P. CARNEVALE NICOLE SMITH JEFF STROHL

ANTHONY P. CARNEVALE NICOLE SMITH JEFF STROHL State-Level Analysis HELP WANTED PROJECTIONS of JOBS and EDUCATION REQUIREMENTS Through 2018 JUNE 2010 ANTHONY P. CARNEVALE NICOLE SMITH JEFF STROHL Contents 1 Introduction 3 U.S. Maps: Educational concentrations

More information

Alaska (AK) Arizona (AZ) Arkansas (AR) California-RN (CA-RN) Colorado (CO)

Alaska (AK) Arizona (AZ) Arkansas (AR) California-RN (CA-RN) Colorado (CO) Beth Radtke 50 Included in the report: 7/22/2015 11:15:28 AM Alaska (AK) Arizona (AZ) Arkansas (AR) California-RN (CA-RN) Colorado (CO) Connecticut (CT) Delaware (DE) District Columbia (DC) Florida (FL)

More information

Focusing on results not data comprehensive data analysis for targeted next generation sequencing

Focusing on results not data comprehensive data analysis for targeted next generation sequencing Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes

More information

The high school's nurse reported no notable illnesses among the students.

The high school's nurse reported no notable illnesses among the students. GASTROENTERITIS OUTBREAK ATTRIBUTED TO CLOSTRIDIUM PERFRINGENS TYPE A ENTEROTOXIN MIAMI COUNTY, KANSAS FEBRUARY 2006 FINAL REPORT DATE April 10, 2006 OUTBREAK INVESTIGATORS Christine Godfrey, Public Health

More information

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each

More information

TURIN. Historical capital of Italy. City of Art, Nature, Food and Sport. Turin is crossed by the Po river, the Italy s longest river

TURIN. Historical capital of Italy. City of Art, Nature, Food and Sport. Turin is crossed by the Po river, the Italy s longest river TURIN Historical capital of Italy City of Art, Nature, Food and Sport Turin is crossed by the Po river, the Italy s longest river The Mole Antonelliana (1863-1889), 167.5 Meters tall is the symbol of the

More information

Transmission of genetic variation: conjugation. Transmission of genetic variation: conjugation

Transmission of genetic variation: conjugation. Transmission of genetic variation: conjugation Transmission of genetic variation: conjugation Transmission of genetic variation: conjugation Bacterial Conjugation is genetic recombination in which there is a transfer of DNA from a living donor bacterium

More information

Marijuana and driving in the United States: prevalence, risks, and laws

Marijuana and driving in the United States: prevalence, risks, and laws Marijuana and driving in the United States: prevalence, risks, and laws Casualty Actuarial Society Spring Meeting Colorado Springs, Colorado May 19, 2015 Anne T. McCartt iihs.org IIHS is an independent,

More information

The Human Genome Project

The Human Genome Project The Human Genome Project Brief History of the Human Genome Project Physical Chromosome Maps Genetic (or Linkage) Maps DNA Markers Sequencing and Annotating Genomic DNA What Have We learned from the HGP?

More information

WHO Regional Office for Europe update on avian influenza A (H7N9) virus

WHO Regional Office for Europe update on avian influenza A (H7N9) virus WHO Regional Office for Europe update on avian influenza A (H7N9) virus Situation update 2: 30 April 2013 Address requests about publications of the WHO Regional Office for Europe to: Publications WHO

More information

Becker Muscular Dystrophy

Becker Muscular Dystrophy Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency

More information

Next Generation Sequencing in Public Health Laboratories. 2014 Survey Results

Next Generation Sequencing in Public Health Laboratories. 2014 Survey Results Next Generation Sequencing in Public Health Laboratories 2014 Survey Results MAY 2015 This project was 100% funded with federal funds from a federal program of $215,972. This publication was supported

More information

Community College/Technical Institute Mission Convergence Study

Community College/Technical Institute Mission Convergence Study Center for Community College Policy Education Commission of the States Community College/Technical Institute Mission Convergence Study Phase 1: Survey of the States Prepared by Donald E. Puyear, Ph.D.

More information

Originally published as:

Originally published as: Originally published as: Weiss, B., Rabsch, W., Prager, R., Tietze, E., Koch, J., Mutschmann, F., Roggentin, P., Frank, C. Babies and bearded dragons: Sudden increase in reptile-associated Salmonella enterica

More information

Globally, about 9.7% of cancers in men are prostate cancers, and the risk of developing the

Globally, about 9.7% of cancers in men are prostate cancers, and the risk of developing the Chapter 5 Analysis of Prostate Cancer Association Study Data 5.1 Risk factors for Prostate Cancer Globally, about 9.7% of cancers in men are prostate cancers, and the risk of developing the disease has

More information

Resource Brief: Ombudsman Program Data Management Systems

Resource Brief: Ombudsman Program Data Management Systems Resource Brief: Ombudsman Program Prepared by the National Association of State Units on Aging National Long-Term Care Ombudsman Resource Center National Citizens' Coalition for Nursing Home Reform 1424

More information

SEQUENCING. From Sample to Sequence-Ready

SEQUENCING. From Sample to Sequence-Ready SEQUENCING From Sample to Sequence-Ready ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES, NOT ONCE, BUT EVERY TIME The highest-quality amplicons more sensitive, accurate, and specific Full support for all major

More information

90-400 APPENDIX B. STATE AGENCY ADDRESSES FOR INTERSTATE UIB CLAIMS

90-400 APPENDIX B. STATE AGENCY ADDRESSES FOR INTERSTATE UIB CLAIMS INTERSTATE UIB CLAIMS Alabama Multi- Unit (#01) Industrial Relations Bldg. Montgomery, AL 31604 Alaska Interstate Unit (#02) P.O. Box 3-7000 Juneau, AK 99801 Arizona Interstate Liable Office (#03) Department

More information

Annual Report on Zoonoses in Denmark 2014

Annual Report on Zoonoses in Denmark 2014 Annual Report on Zoonoses in Denmark 2014 Edited by: Anne Wingstrand, Anna Irene Vedel Sørensen and Birgitte Helwigh Danish Zoonosis Centre National Food Institute Technical University of Denmark Luise

More information

A Salmonella Geno-Serotyping Array (SGSA) for the Rapid Classification of Serovars

A Salmonella Geno-Serotyping Array (SGSA) for the Rapid Classification of Serovars A Salmonella Geno-Serotyping Array (SGSA) for the Rapid Classification of Serovars Catherine Yoshida 1, Erika J. Lingohr 1, Kristyn Franklin 1, Levente Bodrossy 2,5, Muna Anjum 3, Clifford G. Clark 4,

More information

Use and Characteristics of Electronic Health Record Systems Among Office-based Physician Practices: United States, 2001 2013

Use and Characteristics of Electronic Health Record Systems Among Office-based Physician Practices: United States, 2001 2013 Use and Characteristics of Electronic Health Record Systems Among Office-based Physician Practices: United States, 2001 2013 Chun-Ju Hsiao, Ph.D., and Esther Hing, M.P.H. Key findings In 2013, 78% of office-based

More information

Enrollment Snapshot of Radiography, Radiation Therapy and Nuclear Medicine Technology Programs 2013

Enrollment Snapshot of Radiography, Radiation Therapy and Nuclear Medicine Technology Programs 2013 Enrollment Snapshot of Radiography, Radiation Therapy and Nuclear Medicine Technology Programs 2013 A Nationwide Survey of Program Directors Conducted by the American Society of Radiologic Technologists

More information

List of low tuition universities in the USA. 1. Louisiana Tech University, LA Total Cost to. International Students: $17,472

List of low tuition universities in the USA. 1. Louisiana Tech University, LA Total Cost to. International Students: $17,472 A list of top universities in the US with low tuition fees for international students. So please find below a comprehensive list of low tuition universities in the US with their respective tuition fees.

More information

Data Analysis for Ion Torrent Sequencing

Data Analysis for Ion Torrent Sequencing IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

Comparison Group: Small Colleges* [Weighted] Item Variable Responses Count Percent Count Percent Count Percent

Comparison Group: Small Colleges* [Weighted] Item Variable Responses Count Percent Count Percent Count Percent Frequency Distributions - (6-20) 6. At this college, I participated in one or more accelerated courses/fast-track programs to help me move through developmental/basic skills/college prep requirements more

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

Cancellation/Nonrenewal Surplus Lines Exemptions

Cancellation/Nonrenewal Surplus Lines Exemptions Cancellation/Nonrenewal Surplus Lines Exemptions * Indicates updates in laws or regulations for the state Contact: Tina Crum, [email protected], 847-553-3804 Disclaimer: This document was prepared by

More information

Comparative genomic hybridization Because arrays are more than just a tool for expression analysis

Comparative genomic hybridization Because arrays are more than just a tool for expression analysis Microarray Data Analysis Workshop MedVetNet Workshop, DTU 2008 Comparative genomic hybridization Because arrays are more than just a tool for expression analysis Carsten Friis ( with several slides from

More information

FHF prosjekt 900706:

FHF prosjekt 900706: FHF prosjekt 900706: Sporing av laks: SNP-tilnærming Matthew Kent, Harald Grove, Teresa Andersstuen, Mariann Arnyasi, Kristil Sundsaasen, Sigbjørn Lien CIGENE, Dept Animal and Aquaculture Sciences, Norwegian

More information

International Conference on Emerging Infectious Diseases 2015 Poster and Oral Presentation Abstracts

International Conference on Emerging Infectious Diseases 2015 Poster and Oral Presentation Abstracts International Conference on Emerging Infectious Diseases 2015 Poster and Oral Presentation Abstracts Emerging Infectious Diseases is providing access to these abstracts on behalf of the ICEID 2015 program

More information

DNA-Analytik III. Genetische Variabilität

DNA-Analytik III. Genetische Variabilität DNA-Analytik III Genetische Variabilität Genetische Variabilität Lexikon Scherer et al. Nat Genet Suppl 39:s7 (2007) Genetische Variabilität Sequenzvariation Mutationen (Mikro~) Basensubstitution Insertion

More information

Molecular Diagnostics in the Clinical Microbiology Laboratory

Molecular Diagnostics in the Clinical Microbiology Laboratory Molecular Diagnostics in the Clinical Microbiology Laboratory Patrick Tang, MD, PhD, FRCPC B.C. Centre for Disease Control University of British Columbia Molecular Diagnostics in the Clinical Microbiology

More information

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità Identification and characterization of Verocytotoxin-producing Escherichia coli (VTEC) by Real Time PCR amplification of the main virulence genes and the genes associated with the serogroups mainly associated

More information

The State of Peer Support Services 2015. Allen S. Daniels, Ed.D Peter Ashenden

The State of Peer Support Services 2015. Allen S. Daniels, Ed.D Peter Ashenden The State of Peer Support Services 2015 Allen S. Daniels, Ed.D Peter Ashenden Introduction and Overview 1. Training and Certification 2. Understanding Peer Roles 3. Medicaid Billing and Reimbursement for

More information

50-State Analysis. School Attendance Age Limits. 700 Broadway, Suite 810 Denver, CO 80203-3442 303.299.3600 Fax: 303.296.8332

50-State Analysis. School Attendance Age Limits. 700 Broadway, Suite 810 Denver, CO 80203-3442 303.299.3600 Fax: 303.296.8332 0-State Analysis School Attendance Age Limits 700 Broadway, Suite 810 Denver, CO 80203-32 303.299.3600 Fax: 303.296.8332 Introduction School Attendance Age Limits By Marga Mikulecky April 2013 This 0-State

More information