Recombinant DNA Unit Exam
|
|
|
- Avis Lamb
- 9 years ago
- Views:
Transcription
1 Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the first G. Does cleavage by BamHI result in a 5 or 3 overhang? What is the sequence of this overhang? 5 GGATCC 3 3 CCTAGG 5 b) BclI cleaves after the first T. Does cleavage by BclI result in a 5 or 3 overhang? What is the sequence of this overhang? 5 TGATC 3 3 ACTAGT 5 c) You are given the DNA shown below. 5 ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3 3 TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5 i) If this DNA was cut with BamHI, how many DNA fragment would you expect? Write out the sequence of these double-stranded DNA fragments. ii) If the DNA shown above was cut with BclI, how many DNA fragment would you expect? Write out the sequence of these double-stranded DNA fragments. d) You can ligate the smaller restriction fragment produced in (c, i) to the smaller restriction fragment produced in (c, ii). Write out the sequence of the resulting recombinant fragment. e) Could you cut the fragment from (d) with either BamHI or BclI? Explain. 1
2 Question 2 You have isolated two different yeast strains, strain 1 and strain 2, each of which fails to grow in the absence of arginine. You want to clone the wild type copy of the gene or genes that are mutated in strain 1 and strain 2. To do so you plan to: 1) Obtain fragments of the entire yeast genomic DNA 2) Cut the chosen vector and ligate each fragment into a vector 3) Use this pool of original and recombinant vectors to transform E. coli cells 4) Select for E. coli cells that have obtained an original or recombinant vectors 5) Screen for E. coli transformed with a recombinant plasmid 6) Obtain recombinant plasmids from the library and transform yeast 7) Clone by complementation the gene that can restore the yeast to arginine prototrophy. a) To construct a yeast genomic library in E. coli that will allow you to successfully complete step 7 above, what would be the phenotype of the yeast you would choose as the donor for the genomic DNA? b) You choose the vector pblue, shown below. Note that the cloning site lies within lacz, the coding region of the gene that encodes β-galactosidase. A cell that expresses β-galactosidase can take a substrate called X-gal and cleave the β-1,6 linkage to form a product that is bright blue. For each of the following sequences found on pblue, list the step or steps (1-7 above) for which that sequence is needed and explain the role that sequence plays. Yeast ori: Ori (yeast) Amp r : E. coli ori: pblue Cloning site Ori (E. coli) c) You digest both the yeast genomic DNA and many copies of the vector with the BamH1 restriction enzyme. You mix the genomic fragments with the cut vectors and add DNA ligase. You then transform E. coli cells with the ligation mix and plate on solid agar medium. Describe what medium you could use to distinguish the bacterial colonies that carry a non-recombinant vector from the ones that carry a new recombinant vector. Explain how this media would allow you distinguish the bacterial colonies that carry a non-recombinant vector from the ones that carry a new recombinant plasmid. 2
3 Question 2, continued d) You successfully create a yeast genomic library in E. coli cells, and obtain a clone that can restore the yeast of strain 1 to arginine prototrophy. Would it be possible to use the same library to clone by complementation the gene that can restore the yeast of strain 2 to arginine prototrophy? Explain. e) You successfully identify a recombinant vector that restores yeast strain 1 to arginine prototrophy (clone 1). You are curious as to whether this recombinant vector can also rescue a bacterial cell that is arg (i.e., it is also an arginine auxotroph). Give 2 reasons why this recombinant vector will NOT work to rescue the arg bacterial cell. f) Your friend suggests that you use her yeast cdna library to attempt to restore an arg bacterial cell to arginine prototrophy. i) Briefly describe how a cdna library is different from a genomic library. ii) You transform arg bacterial cells with your friend s yeast cdna library and find a clone, clone 2, that restores the cells to arginine prototrophy. What sequence NOT found on pblue would have been present on the vector that your friend used to create this library? Explain why this sequence is required. iii) You transform a different arg bacterial strain with clone 2 and find that clone 2 does NOT restore these cells to arginine prototrophy. What does this suggest about synthesis of arginine in bacterial cells? Explain. 3
4 Question 3 Millions of children that depend primarily on rice as a food staple become blind each year due to vitamin A deficiency. Humans cannot synthesize vitamin A and must have a supply of vitamin A or vitamin A precursor like beta-carotene in their diet. You want to create a strain of yeast that has the complete beta-carotene pathway so you can easily study the biochemistry of beta-carotene and vitamin A synthesis. You have a yeast strain that has 5 of the required 7 enzymes for beta-carotene synthesis. You need to provide these yeast cells with the two missing enzymes, crt1 from bacteria and psy2 from daffodils. To clone the gene encoding crt1 into yeast, you plan to 1. Cut bacterial genomic DNA. 2. Clone it into an appropriate expression vector (vector 1) to create a library. 3. Transform your yeast cells with the library. 4. Select for yeast cells that have obtained any vector. 5. Screen the selected colonies for production of the crt1 protein using an antibody. a) The cloning vector chosen for this experiment has the gene leu1 +, which encodes an enzyme needed to synthesize the amino acid leucine and can be used as a selectable marker. To successfully complete step 4 above, what genotype and phenotype would your yeast strain be prior to transformation? b) List the minimum features, in addition to the leu1 + gene, required in the vector for all steps 1-5 outlined above to be successful. For any DNA sequence(s) listed, indicate what type of organism it would come from. You are also given some DNA sequence from the psy2 locus as shown below. To complete the production of the yeast strain capable of synthesizing beta-carotene, you decide to use Polymerase Chain Reaction (PCR) to amplify the psy2 coding sequence based on the flanking sequence shown below. 5 TCCGGCGGAATTCCAAGGCCT 3 AGGCCGCCTTAAGGTTCCGGA psy2 CGTCGACTCCGGC 3 GCAGCTGAGGCCG 5 c) Circle the set of primer(s) could you use to amplify the entire psy2 coding sequence. Set 1: 5 AGGCCG 3 5 GCCGGA 3 Set 2: 5 TCCGGC 3 5 ACCGGG 3 Set 3: 5 TCCGGC 3 5 GCCGGA 3 4
5 Question 3, continued You successfully amplify the psy2 coding sequence (repeated below for you) and plan to clone the PCR fragment into vector 2. The cloning sites available on this vector are shown below. StuI: 5 -AGG CCT-3 SalI cuts: 5 -G TCGAC-3 EcoRI: 5 -G AATTC-3 3 -TCC GGA-5 3 -CAGCT G-5 3 -CTTAA G-5 Promoter StuI SalI EcoRI Vector 2 5 TCCGGCGGAATTCCAAGGCCT 3 AGGCCGCCTTAAGGTTCCGGA Start codon psy2 CGTCGACTCCGGC 3 GCAGCTGAGGCCG 5 d) There are two different ways to insert the amplified psy2 coding sequence into vector 2. Give the restriction enzyme(s) that you could use to cut the vector and the psy2 coding sequence for each of these. Option 1: Option 2: Cut plasmid with: Cut psy2 loci with: e) Which of these options would you use to create a recombinant vector that could express psy2 in yeast? Why? Question 4 The following is the DNA sequence of the wild type allele of Gene Z that you want to amplify using the polymerase chain reaction (PCR). 5 CTCGAGGTGAATATGAAAG CATTTGGCGCGTAATCGATA3 Gene Z 3 GAGCTCCACTTATACTTTC GTAAACCGCGCATTAGCTAT5 a) If you amplify a DNA sequence through PCR what are the reaction components that you would absolutely need? Briefly state the function of each of these components. b) Circle the set of primers from the options below, which you would use for PCR reaction in part (a)? Set 1: 5 TACACTTATACTTTC3 and 3 GTAAACCGCGCATTAG5 Set 2: 5 CTCGAGGTGAATAT3 and 3 CCGCGCATTAGCTAT5 Set 3: 5 GAGTTACACTTATAC3 and 3 TGGCGAGTAATCGATA5 5
6 Question 4, continued c) In the PCR reaction, you need a three-step reaction cycle, which results in a chain reaction that produces an exponentially growing population of identical DNA molecules. Each step of a reaction cycle is performed at a specific temperature i.e. 95 o C for Step 1, 55 o C for step 2 and 70 o C for Step 3. Briefly explain why the three steps are performed under different temperatures. d) You decide to determine the complete nucleotide sequence of Gene Z by DNA sequencing using fluorescent nucleotides. Which of the above nucleotides(s) (1/2/3) are used in DNA sequencing reaction? Circle all that apply. Which of the above nucleotides(s) (1/2/3) would you fluorescently tag for DNA sequencing? 6
7 Question 5 You are given a plasmid. In order to map this plasmid you set up a series of restriction digests and obtain the following results using agarose gel electrophoresis. M M 2 4.2Kb 3.5Kb 3.2Kb 2.5Kb 2.0Kb 1.5Kb 1.0Kb *M1 and M2 are DNA markers. 800b 700b p p 600b 500b p p 400b p 300b p 200b p 100b p Lane Digest Size of fragments in bp 1 BamHI and SmaI 4200, SmaI and KpnI 3200, 1500, KpnI and BglII 2500, 1500, BamHI and KpnI 3500, 1000, KpnI 3500, BglII and BamHI 3500, 1500 a) What is the approximate size of the plasmid? b) Add the SmaI, KpnI, BglII sites to plasmid map. On your map give the distances between each of the restriction sites. BamHI 7
8 MIT OpenCourseWare SC Fundamentals of Biology Fall 2011 For information about citing these materials or our Terms of Use, visit:
HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:
HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone
restriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
Biotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
Recombinant DNA Technology
Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium
DNA Scissors: Introduction to Restriction Enzymes
DNA Scissors: Introduction to Restriction Enzymes Objectives At the end of this activity, students should be able to 1. Describe a typical restriction site as a 4- or 6-base- pair palindrome; 2. Describe
Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.
Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists
Recombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
GENE CLONING AND RECOMBINANT DNA TECHNOLOGY
GENE CLONING AND RECOMBINANT DNA TECHNOLOGY What is recombinant DNA? DNA from 2 different sources (often from 2 different species) are combined together in vitro. Recombinant DNA forms the basis of cloning.
Bio 102 Practice Problems Recombinant DNA and Biotechnology
Bio 102 Practice Problems Recombinant DNA and Biotechnology Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which of the following DNA sequences could be the recognition site
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
Gene Cloning. Reference. T.A. Brown, Gene Cloning, Chapman and Hall. S.B. Primrose, Molecular Biotechnology, Blackwell
Gene Cloning 2004 Seungwook Kim Chem. & Bio. Eng. Reference T.A. Brown, Gene Cloning, Chapman and Hall S.B. Primrose, Molecular Biotechnology, Blackwell Why Gene Cloning is Important? A century ago, Gregor
CLONING IN ESCHERICHIA COLI
CLONING IN ESCHERICHIA COLI Introduction: In this laboratory, you will carry out a simple cloning experiment in E. coli. Specifically, you will first create a recombinant DNA molecule by carrying out a
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
Gene Mapping Techniques
Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction
A and B are not absolutely linked. They could be far enough apart on the chromosome that they assort independently.
Name Section 7.014 Problem Set 5 Please print out this problem set and record your answers on the printed copy. Answers to this problem set are to be turned in to the box outside 68-120 by 5:00pm on Friday
Forensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
Molecular Cloning, Product Brochure
, Product Brochure Interest in any of the products, request or order them at Bio-Connect. Bio-Connect B.V. T NL +31 (0)26 326 44 50 T BE +32 (0)2 503 03 48 Begonialaan 3a F NL +31 (0)26 326 44 51 F BE
Genetics Lecture Notes 7.03 2005. Lectures 1 2
Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several
Bacterial Transformation and Plasmid Purification. Chapter 5: Background
Bacterial Transformation and Plasmid Purification Chapter 5: Background History of Transformation and Plasmids Bacterial methods of DNA transfer Transformation: when bacteria take up DNA from their environment
pmod2-puro A plasmid containing a synthetic Puromycin resistance gene Catalog # pmod2-puro For research use only Version # 11H29-MM
pmod2-puro A plasmid containing a synthetic Puromycin resistance gene Catalog # pmod2-puro For research use only Version # 11H29-MM PrOduct information content: - 20 mg of lyophilized pmod2-puro plasmid
Molecular and Cell Biology Laboratory (BIOL-UA 223) Instructor: Ignatius Tan Phone: 212-998-8295 Office: 764 Brown Email: ignatius.tan@nyu.
Molecular and Cell Biology Laboratory (BIOL-UA 223) Instructor: Ignatius Tan Phone: 212-998-8295 Office: 764 Brown Email: [email protected] Course Hours: Section 1: Mon: 12:30-3:15 Section 2: Wed: 12:30-3:15
Design of conditional gene targeting vectors - a recombineering approach
Recombineering protocol #4 Design of conditional gene targeting vectors - a recombineering approach Søren Warming, Ph.D. The purpose of this protocol is to help you in the gene targeting vector design
pcas-guide System Validation in Genome Editing
pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible
DNA CLONING. DNA segment has been developed: polymerase chain reaction PCR. Viral DNA-s bacteriophage λ, filamentous bacteriophages
DNA CLONING - What is cloning? The isolation of discrete pieces of DNA from their host organism and their amplification through propagation in the same or a different host More recently an alternitive,
Cloning Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems
Promega Notes Number 71, 1999, p. 10 Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems By Kimberly Knoche, Ph.D., and Dan Kephart, Ph.D. Promega Corporation Corresponding
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
AP BIOLOGY 2007 SCORING GUIDELINES
AP BIOLOGY 2007 SCORING GUIDELINES Question 4 A bacterial plasmid is 100 kb in length. The plasmid DNA was digested to completion with two restriction enzymes in three separate treatments: EcoRI, HaeIII,
Trasposable elements: P elements
Trasposable elements: P elements In 1938 Marcus Rhodes provided the first genetic description of an unstable mutation, an allele of a gene required for the production of pigment in maize. This instability
Becker Muscular Dystrophy
Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency
Genetics 301 Sample Final Examination Spring 2003
Genetics 301 Sample Final Examination Spring 2003 50 Multiple Choice Questions-(Choose the best answer) 1. A cross between two true breeding lines one with dark blue flowers and one with bright white flowers
Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
Troubleshooting the Single-step PCR Site-directed Mutagenesis Procedure Intended to Create a Non-functional rop Gene in the pbr322 Plasmid
Troubleshooting the Single-step PCR Site-directed Mutagenesis Procedure Intended to Create a Non-functional rop Gene in the pbr322 Plasmid Lina Jew Department of Microbiology & Immunology, University of
pcmv6-neo Vector Application Guide Contents
pcmv6-neo Vector Application Guide Contents Package Contents and Storage Conditions... 2 Product Description... 2 Introduction... 2 Production and Quality Assurance... 2 Methods... 3 Other required reagents...
2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the
2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
Basic Concepts Recombinant DNA Use with Chapter 13, Section 13.2
Name Date lass Master 19 Basic oncepts Recombinant DN Use with hapter, Section.2 Formation of Recombinant DN ut leavage Splicing opyright lencoe/mcraw-hill, a division of he Mcraw-Hill ompanies, Inc. Bacterial
European Medicines Agency
European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein
DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA
DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence
LAB 10 DNA TRANSFORMATION
LAB 10 DNA TRANSFORMATION STUDENT GUIDE GOAL The objective of this lab is to successfully perform DNA transformation of a recombinant plasmid and use blue-white selection to select recombinant clones.
Integrated Protein Services
Integrated Protein Services Custom protein expression & purification Version DC04-0012 Expression strategy The first step in the recombinant protein generation process is to design an appropriate expression
Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
BCOR101 Midterm II Wednesday, October 26, 2005
BCOR101 Midterm II Wednesday, October 26, 2005 Name Key Please show all of your work. 1. A donor strain is trp+, pro+, met+ and a recipient strain is trp-, pro-, met-. The donor strain is infected with
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Susan Carson Heather B. Miller D.Scott Witherow ELSEVIER AMSTERDAM BOSTON HEIDELBERG LONDON NEW YORK OXFORD PARIS SAN DIEGO SAN
Bio 102 Practice Problems Genetic Code and Mutation
Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine
Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix
CLONING & MAPPING DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix LIBRARY PREP FOR NET GEN SEQUENCING PROTEIN
An Overview of DNA Sequencing
An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure
and their applications
Restriction endonucleases eases and their applications History of restriction ti endonucleases eases and its role in establishing molecular biology Restriction enzymes Over 10,000 bacteria species have
STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS
STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS THESIS SUBMITTED FOR THE DEGREB OF DOCTOR OF PHILOSOPHY (SCIENCE) OF THE UNIVERSITY OF CALCUTTA 1996 NRISINHA DE, M.Sc DEPARTMENT OF BIOCHEMISTRY
Cloning GFP into Mammalian cells
Protocol for Cloning GFP into Mammalian cells Studiepraktik 2013 Molecular Biology and Molecular Medicine Aarhus University Produced by the instructors: Tobias Holm Bønnelykke, Rikke Mouridsen, Steffan
4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?
Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.
BioS 323: Molecular Biology Laboratory. Fall Semester 2014- CRN3636 Tuesday & Thursday 2PM to 5PM 3068 SEL
Instructors: Dr. Suzanne McCutcheon email: [email protected] Office: 3050 SEL Phone: 312-996-5047 BioS 323: Molecular Biology Laboratory Fall Semester 2014- CRN3636 Tuesday & Thursday 2PM to 5PM 3068 SEL
Genetic Engineering and Biotechnology
1 So, what is biotechnology?? The use of living organisms to carry out defined chemical processes for industrial or commercial application. The office of Technology Assessment of the U.S. Congress defines
Description: Molecular Biology Services and DNA Sequencing
Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:
Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541
PRODUCT INFORMATION Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541 Lot _ Store at -20 C Expiry Date _ www.thermoscientific.com/onebio CERTIFICATE OF ANALYSIS The Phusion Site-Directed Mutagenesis
DNA Technology Mapping a plasmid digesting How do restriction enzymes work?
DNA Technology Mapping a plasmid A first step in working with DNA is mapping the DNA molecule. One way to do this is to use restriction enzymes (restriction endonucleases) that are naturally found in bacteria
2006 7.012 Problem Set 3 KEY
2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each
How many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
Genetics Test Biology I
Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.
Ms. Campbell Protein Synthesis Practice Questions Regents L.E.
Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide
UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet
1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:.
Nucleic Acid Techniques in Bacterial Systematics
Nucleic Acid Techniques in Bacterial Systematics Edited by Erko Stackebrandt Department of Microbiology University of Queensland St Lucia, Australia and Michael Goodfellow Department of Microbiology University
IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR)
IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) Background Infectious diseases caused by pathogenic organisms such as bacteria, viruses, protozoa,
Genetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
Protein Expression and Analysis. Vijay Yajnik, MD, PhD GI Unit MGH
Protein Expression and Analysis Vijay Yajnik, MD, PhD GI Unit MGH Identify your needs Antigen production Biochemical studies Cell Biology Protein interaction studies including proteomics Structural studies
Biology Final Exam Study Guide: Semester 2
Biology Final Exam Study Guide: Semester 2 Questions 1. Scientific method: What does each of these entail? Investigation and Experimentation Problem Hypothesis Methods Results/Data Discussion/Conclusion
Section 16.1 Producing DNA fragments
Section 16.1 Producing DNA fragments Recombinant DNA combined DNA of two different organisms The process of using DNA technology to make certain proteins is as follows: 1.) Isolation of the DNA fragments
BaculoDirect Baculovirus Expression System Free your hands with the BaculoDirect Baculovirus Expression System
BaculoDirect Baculovirus Expression System Free your hands with the BaculoDirect Baculovirus Expression System The BaculoDirect Baculovirus Expression System gives you: Unique speed and simplicity High-throughput
Gene mutation and molecular medicine Chapter 15
Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to
Expression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu
Expression and Purification of Recombinant Protein in bacteria and Yeast Presented By: Puspa pandey, Mohit sachdeva & Ming yu DNA Vectors Molecular carriers which carry fragments of DNA into host cell.
Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.
Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.
PrimeSTAR HS DNA Polymerase
Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction
BIOL 225 Genetics-Final Exam December 14, 2006 Dr. Sandra Davis
BIOL 225 Genetics-Final Exam December 14, 2006 Dr. Sandra Davis INSTRUCTIONS: 1. Read the questions carefully and write your answers in the space provided. If you need more space, clearly indicate WHERE
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR
Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR BioTechniques 25:415-419 (September 1998) ABSTRACT The determination of unknown DNA sequences around
Investigating a Eukaryotic Genome: Cloning and Sequencing a Fragment of Yeast DNA
Investigating a Eukaryotic Genome: Cloning and Sequencing a Fragment of Yeast DNA Credits: This lab was created by Sarah C.R. Elgin and developed and written by Kathleen Weston-Hafer. Specific protocols
Sickle cell anemia: Altered beta chain Single AA change (#6 Glu to Val) Consequence: Protein polymerizes Change in RBC shape ---> phenotypes
Protein Structure Polypeptide: Protein: Therefore: Example: Single chain of amino acids 1 or more polypeptide chains All polypeptides are proteins Some proteins contain >1 polypeptide Hemoglobin (O 2 binding
GENOTYPING ASSAYS AT ZIRC
GENOTYPING ASSAYS AT ZIRC A. READ THIS FIRST - DISCLAIMER Dear ZIRC user, We now provide detailed genotyping protocols for a number of zebrafish lines distributed by ZIRC. These protocols were developed
Assembly of Restriction Enzyme Digestions
TECHNICAL MANUAL Assembly of Restriction Enzyme Digestions 12/11 TM367 Assembly of Restriction Enzyme Digestions All technical literature is available at: www.promega.com/protocols/ Visit the web site
Techniques in Molecular Biology (to study the function of genes)
Techniques in Molecular Biology (to study the function of genes) Analysis of nucleic acids: Polymerase chain reaction (PCR) Gel electrophoresis Blotting techniques (Northern, Southern) Gene expression
ptune Inducible Vector
ptune Inducible Vector Application Guide Table of Contents Package contents and Storage Conditions:...2 Related products:...2 Introduction...2 Figure 1. Schematic Diagrams of ptune Inducible vector...3
The Techniques of Molecular Biology: Forensic DNA Fingerprinting
Revised Fall 2011 The Techniques of Molecular Biology: Forensic DNA Fingerprinting The techniques of molecular biology are used to manipulate the structure and function of molecules such as DNA and proteins
Molecular Biology. Yeast Transformation. Yeast Plasmids. Gene Disruption, tagging. Cloning by Complementation. Epistasis
Molecular Biology Yeast Transformation Yeast Plasmids Gene Disruption, tagging Cloning by Complementation Epistasis Transformation Transformation: introduction of DNA 1978, ca 1000x less efficient than
DNA Sequence Analysis
DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
Green Fluorescent Protein (GFP): Genetic Transformation, Synthesis and Purification of the Recombinant Protein
Green Fluorescent Protein (GFP): Genetic Transformation, Synthesis and Purification of the Recombinant Protein INTRODUCTION Green Fluorescent Protein (GFP) is a novel protein produced by the bioluminescent
Genome Editing TOOLS TO SUPPORT CRISPR/CAS9 APPLICATIONS
Genome Editing TOOLS TO SUPPORT CRISPR/CAS9 APPLICATIONS Genome Editing: Tools to Support CRISPR/Cas9 Applications Genome editing is enabled by the development of tools to make precise, targeted changes
The Biotechnology Education Company
EDVTEK P.. Box 1232 West Bethesda, MD 20827-1232 The Biotechnology 106 EDV-Kit # Principles of DNA Sequencing Experiment bjective: The objective of this experiment is to develop an understanding of DNA
Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
Integrated Protein Services
Integrated Protein Services Custom protein expression & purification Last date of revision June 2015 Version DC04-0013 www.iba-lifesciences.com Expression strategy The first step in the recombinant protein
Chapter 6 DNA Replication
Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore
AP Biology TEST #5 - Chapters 11-14, 16 - REVIEW SHEET
NAME: AP Biology TEST #5 - Chapters 11-14, 16 - REVIEW SHEET 1. Griffith's experiments showing the transformation of R strain pneumococcus bacteria to S strain pneumococcus bacteria in the presence of
BacReady TM Multiplex PCR System
BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental
The E. coli Insulin Factory
The E. coli Insulin Factory BACKGROUND Bacteria have not only their normal DNA, they also have pieces of circular DNA called plasmids. Plasmids are a wonderfully ally for biologists who desire to get bacteria
GeneCopoeia Genome Editing Tools for Safe Harbor Integration in. Mice and Humans. Ed Davis, Liuqing Qian, Ruiqing li, Junsheng Zhou, and Jinkuo Zhang
G e n e C o p o eia TM Expressway to Discovery APPLICATION NOTE Introduction GeneCopoeia Genome Editing Tools for Safe Harbor Integration in Mice and Humans Ed Davis, Liuqing Qian, Ruiqing li, Junsheng
Chapter 5: Organization and Expression of Immunoglobulin Genes
Chapter 5: Organization and Expression of Immunoglobulin Genes I. Genetic Model Compatible with Ig Structure A. Two models for Ab structure diversity 1. Germ-line theory: maintained that the genome contributed
TransformAid Bacterial Transformation Kit
Home Contacts Order Catalog Support Search Alphabetical Index Numerical Index Restriction Endonucleases Modifying Enzymes PCR Kits Markers Nucleic Acids Nucleotides & Oligonucleotides Media Transfection
