Crime Scenes and Genes

Transcription

1

2 Glossary Agarose Biotechnology Cell Chromosome DNA (deoxyribonucleic acid) Electrophoresis Gene Micro-pipette Mutation Nucleotide Nucleus PCR (Polymerase chain reaction) Primer STR (short tandem repeats) A polysaccharide derived from seaweed that is used for the separation of molecules in electrophoresis. A broad term generally used to describe the use of biology in industrial processes such as agriculture, brewing and drug development. The term also refers to the production of genetically modified organisms or the manufacture of products from genetically modified organisms. The basic unit of all organisms, containing structures called organelles, including the nucleus which holds a copy of the organism s complete genome. A large molecule (strand) of highly coiled DNA containing genes. A molecule consisting of a long chain of nucleotides (or bases) that are joined together with phosphate linkages. Contains the genetic code that controls the production of proteins. Using an electric charge to separate molecules in a solution or gel according to size. It is used to separate fragments of DNA. A sequence of DNA that either codes for the synthesis of a specific protein or has a specific regulatory function. A measuring instrument that is used to transfer small volumes of samples, typically ranging from 0.2µL to 1000µL. The process by which a gene undergoes a change in the base sequence. Also known as a base a subunit of nucleic acids. In DNA there are four types adenine, thymine, guanine and cytosine. The order of the bases along the DNA strand is what encodes our genes. The structure or organelle within the cell that contains the chromosomes. A process in which a segment of DNA is copied multiple times using an enzyme known as a DNA polymerase. A defined, short length of DNA used to start the copying process in PCR. Short DNA sequences that are repeated in a head-to-tail manner. They are useful in DNA profiling. Glossary extracts from: and 2

3 Objectives of the workshop Understand the structure of DNA and how it is manipulated to produce DNA profiles Obtain a basic knowledge of polymerase chain reaction (PCR) and its importance in DNA profiling Learn how electrophoresis is used to display DNA profiles Learn to compare pieces of evidence to identify any samples from suspects that match samples from crime scenes Use scientific understanding and reasoning to justify your conclusions Equipment list Activity 1: Gel electrophoresis Electrophoresis tank Power pack TAE buffer Agarose gel, approx 1.1% (made by presenter) Fake DNA samples (food dyes) crime scene, suspects 1, 2, 3 and 4 Sharps container Box of disposable tips Pipette Activity 2: Case studies Background information sheets for each case (3 case studies) DNA profiles for each case Safety notes for students Electrophoresis tanks are used with high voltage students are not to touch them unless instructed to do so Students should wear gloves when handling the samples as they contain glycerine which is classed as a hazardous substance No food or drinks are allowed in the lab Students should wash their hands before leaving workshop Safety notes for QUT ambassadors Do not allow students to turn the power packs on or off unless under your direct supervision and instruction Do not allow the students to handle the gel or the TAE buffer Heat-proof gloves to be used when handling heated agarose gel 3

4 Background DNA profiling Each of us has a unique DNA profile. A technique called electrophoresis is used to obtain DNA profiles, relying on sections of our DNA that are known as non-coding DNA (DNA that does not code for a protein). We have many sections of non-coding DNA in our genome. Within this non-coding DNA are areas called short tandem repeats (STRs). For example, you may have a stretch of DNA made up of the following base sequence: ATCTTCTAACACATGACCGATCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGTTCCATGATAGCACAT This sequence starts off looking random, but then has repeats of the sequence CATG towards the middle. It becomes random again near the end. The repetitive section of the sequence is what is referred to as an STR. For a given STR, you will have inherited different numbers of the repeated sequence from each of your parents. For example, you may have inherited 11 repeats of the CATG sequence, as shown above, on a chromosome from your mother, and 3 repeats of this sequence within the STR on the matching chromosome from your father. The different numbers of repeats within an STR results in DNA of different lengths. Because of this, electrophoresis can be used to show how many repeats you have. Generating a DNA profile usually involves analysing an individual's DNA for ten different STRs on different chromosomes. Statistically, no two people (except identical twins) are likely to have the same numbers of repeats in all of these STRs. Polymerase chain reaction (PCR) is used to produce many copies of the ten STRs before they are later analysed using electrophoresis. The different lengths of DNA will show up as bands at different spots on the electrophoresis gel (see picture). The banding pattern produced is called a DNA profile and can be analysed. If a crime suspect's DNA profile for 10 STRs matches the STR profile of a sample found at the crime scene, there is a very high probability that both lots of DNA are from the same person. However, if the profiles differ for even one STR, this cannot be assumed. DNA is used as evidence in court, but it is considered circumstantial' evidence, and can only be used as proof with other supporting evidence. However, it has proven useful in establishing the innocence of suspects

5 Workshop activities In this workshop there is one hands-on activity gel electrophoresis. The class is split into groups of 3-4 (no more than 8 groups) and each group will have one set of equipment to use. The other activity is not hands-on, and consists of some case studies in which profiles are used in varying scenarios. Activities are run as follows: Activity 1: Gel electrophoresis Presenter will put the agarose gel into the electrophoresis tank provided and take out the comb from the gel, ensuring the wells are visible. 1. Use the pipette to put a tip on the end, and make sure it is set to 10µL 2. Use the pipette to aspirate (remove) the first sample (the crime scene sample) from the tube, by depressing the button on the top of the pipette, placing the tip into the sample, and slowly releasing the button 3. To pipette the sample into the gel, gently place the tip just inside the top of the first well, then depress the button (not too quickly) so that the sample settles into the bottom of the well (it has glycerol in it so will sink into the well as it s heavier than the buffer in the tank) 4. Eject the tip into the sharps container by pressing the little button on the side of the pipette 5. Repeat steps 2 to 4 for each sample 6. Once all 5 samples are in the gel, place the lid on the electrophoresis tank and check with the presenter before switching the power-pack on to 100V (or 200V if there is limited time) 7. It will take about 15 mins to separate out the dyes on the gel (return to desk to complete case studies, as below) NOTE: If TAE buffer runs out, bicarb soda is kept in the kit and can be used to make a 0.2% buffer solution by adding 2g bicarb soda to 1L of water. 2 Activity 2: Case studies 1. Choose a case study to start off with and read the background information 2. Examine the DNA profiles and answer the questions Rundown of workshop Time Activities 0-15 Introduction and explanation of activity, get students into groups Students load their gels and start electrophoresis Students work on the case studies and fill in worksheet Students check their electrophoresis results Students finish their worksheets Go through results, answer questions 2 5

6 A good example of a set up is shown on the following page. The sets are best spread out as much as possible around the room (school laboratories tend to have the workbenches with sinks and power points around the edges of the room). Two groups share one power pack and one sharps bin, so they will need to be somewhat close in order for the cords to reach. Groups can work on opposite sides of protruding bench, which are often positioned near the sinks and have good access to the power points. The presenter can then easily see each group s work from the end of each bench. The case studies are laminated and are best kept on the desks, away from the electrophoresis sets. Photos of the electrophoresis sets are shown in the photos below the diagram. Desks case study 3 Desks case study 2 Desks case study 1 This picture shows two sets of electrophoresis sets, on opposite sides of a bench and sharing a sharps bin and a power pack (shown at the right). 6

7 Instructions for making agarose A 1.1% (w/v) agarose is used for the electrophoresis activity. Preparation is as follows: 1. Measure the appropriate amount of agarose using the measuring spoons and put it into the 500mL Schott bottle. 2. Measure the corresponding amount of TAE buffer needed (see table below) using the measuring cylinder, and pour it into the bottle. 3. Swirl the agarose and TAE so it is mixed in together. 4. Loosen the lid a little and microwave the mixture until all the agarose is dissolved, and the solution is clear and homogenous (2-4 mins depending on volume). Don t allow the solution to boil too much. 5. Open the lid of the jar tilting the bottle neck away from you and allow the molten agarose solution to cool down (5-10 mins). 6. Pour the agarose into the gel casting moulds and allow to set (the gel will turn cloudy). Please note: most classroom laboratories are not air-conditioned and therefore the gels can take some time to set. Placing them in a fridge will help them to set quickly, especially in warmer months. Quantities: Number of gels Agarose TAE buffer 2 large/3 small 1.1g (= ½ tsp) 100mL 4 large/6 small 2.2g (= 1 tsp) 200mL 8 large/12 small 4.4g (= 2 tsp) 400mL 7

8 Crime Scenes and Genes: DNA electrophoresis sample preparation The base dyes must be prepared into working solutions first. To do this, mix each dye (yellow, red, blue and cochinella) with glycerol and water in a ratio of 1:9:9 (approximately). Refer to the table below for a series of volumes. Volume 10mL 15mL 20mL Food dye 530µL 800µL 1060µL Glycerol 4735µL 7100µL 9470µL Water 4735µL 7100µL 9470µL Once the working dye solutions have been prepared, the samples can be made from these by mixing the dyes together. Please refer to the table below for instructions. Amounts are for a total volume of 10mL (except 20mL for the suspect 3/crime scene sample). Once 10mL volumes have been made, they can be dispensed into the labelled 1.5mL tubes. Sample Red Yellow Blue Cochinella Suspect 3/crime scene 10mL 10mL Suspect 1 4mL 6mL Suspect mL 3.33mL 3.33mL Suspect 4 4mL 6mL 8

9 Script A PowerPoint presentation is used for this activity. This acts as the script for the workshop. The presentation includes instructions on how to use the pipettes and load the gels. Worksheet On the following page is the worksheet which is used for this workshop. Acknowledgments This document was compiled by Phillipa Perrott and Maria Barrett. 9

10 CRIME SCENES AND GENES Crime Scenes and Genes Case number Which suspect s DNA profile matches the DNA profile on the balaclava? 2. Is this sufficient evidence that this suspect committed the crime? Why/why not? Case number Which samples match the suspect s DNA profile and where were they found? 2. Which samples match the victim s DNA profile and where were they found? 3. What would the profile look like if the victim s and the suspect s blood were mixed together? (This is referred to as a mixed sample.) 4. Can you think of example situations where a mixed sample might occur? Case number Which man is the most likely father of the child? 2. What does each line on a DNA profile represent? Your Gel Results 1. Which of your suspects has the same profile as the crime scene profile? 2. Which travels faster on a gel a large molecule or a smaller molecule? 3. Which coloured dye is made up of the smallest molecule? 4. What would happen if you put the gel in the tank the wrong way? 10