Crime Scenes and Genes
|
|
|
- Winifred Glenn
- 10 years ago
- Views:
Transcription
1
2 Glossary Agarose Biotechnology Cell Chromosome DNA (deoxyribonucleic acid) Electrophoresis Gene Micro-pipette Mutation Nucleotide Nucleus PCR (Polymerase chain reaction) Primer STR (short tandem repeats) A polysaccharide derived from seaweed that is used for the separation of molecules in electrophoresis. A broad term generally used to describe the use of biology in industrial processes such as agriculture, brewing and drug development. The term also refers to the production of genetically modified organisms or the manufacture of products from genetically modified organisms. The basic unit of all organisms, containing structures called organelles, including the nucleus which holds a copy of the organism s complete genome. A large molecule (strand) of highly coiled DNA containing genes. A molecule consisting of a long chain of nucleotides (or bases) that are joined together with phosphate linkages. Contains the genetic code that controls the production of proteins. Using an electric charge to separate molecules in a solution or gel according to size. It is used to separate fragments of DNA. A sequence of DNA that either codes for the synthesis of a specific protein or has a specific regulatory function. A measuring instrument that is used to transfer small volumes of samples, typically ranging from 0.2µL to 1000µL. The process by which a gene undergoes a change in the base sequence. Also known as a base a subunit of nucleic acids. In DNA there are four types adenine, thymine, guanine and cytosine. The order of the bases along the DNA strand is what encodes our genes. The structure or organelle within the cell that contains the chromosomes. A process in which a segment of DNA is copied multiple times using an enzyme known as a DNA polymerase. A defined, short length of DNA used to start the copying process in PCR. Short DNA sequences that are repeated in a head-to-tail manner. They are useful in DNA profiling. Glossary extracts from: and 2
3 Objectives of the workshop Understand the structure of DNA and how it is manipulated to produce DNA profiles Obtain a basic knowledge of polymerase chain reaction (PCR) and its importance in DNA profiling Learn how electrophoresis is used to display DNA profiles Learn to compare pieces of evidence to identify any samples from suspects that match samples from crime scenes Use scientific understanding and reasoning to justify your conclusions Equipment list Activity 1: Gel electrophoresis Electrophoresis tank Power pack TAE buffer Agarose gel, approx 1.1% (made by presenter) Fake DNA samples (food dyes) crime scene, suspects 1, 2, 3 and 4 Sharps container Box of disposable tips Pipette Activity 2: Case studies Background information sheets for each case (3 case studies) DNA profiles for each case Safety notes for students Electrophoresis tanks are used with high voltage students are not to touch them unless instructed to do so Students should wear gloves when handling the samples as they contain glycerine which is classed as a hazardous substance No food or drinks are allowed in the lab Students should wash their hands before leaving workshop Safety notes for QUT ambassadors Do not allow students to turn the power packs on or off unless under your direct supervision and instruction Do not allow the students to handle the gel or the TAE buffer Heat-proof gloves to be used when handling heated agarose gel 3
4 Background DNA profiling Each of us has a unique DNA profile. A technique called electrophoresis is used to obtain DNA profiles, relying on sections of our DNA that are known as non-coding DNA (DNA that does not code for a protein). We have many sections of non-coding DNA in our genome. Within this non-coding DNA are areas called short tandem repeats (STRs). For example, you may have a stretch of DNA made up of the following base sequence: ATCTTCTAACACATGACCGATCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGTTCCATGATAGCACAT This sequence starts off looking random, but then has repeats of the sequence CATG towards the middle. It becomes random again near the end. The repetitive section of the sequence is what is referred to as an STR. For a given STR, you will have inherited different numbers of the repeated sequence from each of your parents. For example, you may have inherited 11 repeats of the CATG sequence, as shown above, on a chromosome from your mother, and 3 repeats of this sequence within the STR on the matching chromosome from your father. The different numbers of repeats within an STR results in DNA of different lengths. Because of this, electrophoresis can be used to show how many repeats you have. Generating a DNA profile usually involves analysing an individual's DNA for ten different STRs on different chromosomes. Statistically, no two people (except identical twins) are likely to have the same numbers of repeats in all of these STRs. Polymerase chain reaction (PCR) is used to produce many copies of the ten STRs before they are later analysed using electrophoresis. The different lengths of DNA will show up as bands at different spots on the electrophoresis gel (see picture). The banding pattern produced is called a DNA profile and can be analysed. If a crime suspect's DNA profile for 10 STRs matches the STR profile of a sample found at the crime scene, there is a very high probability that both lots of DNA are from the same person. However, if the profiles differ for even one STR, this cannot be assumed. DNA is used as evidence in court, but it is considered circumstantial' evidence, and can only be used as proof with other supporting evidence. However, it has proven useful in establishing the innocence of suspects
5 Workshop activities In this workshop there is one hands-on activity gel electrophoresis. The class is split into groups of 3-4 (no more than 8 groups) and each group will have one set of equipment to use. The other activity is not hands-on, and consists of some case studies in which profiles are used in varying scenarios. Activities are run as follows: Activity 1: Gel electrophoresis Presenter will put the agarose gel into the electrophoresis tank provided and take out the comb from the gel, ensuring the wells are visible. 1. Use the pipette to put a tip on the end, and make sure it is set to 10µL 2. Use the pipette to aspirate (remove) the first sample (the crime scene sample) from the tube, by depressing the button on the top of the pipette, placing the tip into the sample, and slowly releasing the button 3. To pipette the sample into the gel, gently place the tip just inside the top of the first well, then depress the button (not too quickly) so that the sample settles into the bottom of the well (it has glycerol in it so will sink into the well as it s heavier than the buffer in the tank) 4. Eject the tip into the sharps container by pressing the little button on the side of the pipette 5. Repeat steps 2 to 4 for each sample 6. Once all 5 samples are in the gel, place the lid on the electrophoresis tank and check with the presenter before switching the power-pack on to 100V (or 200V if there is limited time) 7. It will take about 15 mins to separate out the dyes on the gel (return to desk to complete case studies, as below) NOTE: If TAE buffer runs out, bicarb soda is kept in the kit and can be used to make a 0.2% buffer solution by adding 2g bicarb soda to 1L of water. 2 Activity 2: Case studies 1. Choose a case study to start off with and read the background information 2. Examine the DNA profiles and answer the questions Rundown of workshop Time Activities 0-15 Introduction and explanation of activity, get students into groups Students load their gels and start electrophoresis Students work on the case studies and fill in worksheet Students check their electrophoresis results Students finish their worksheets Go through results, answer questions 2 5
6 A good example of a set up is shown on the following page. The sets are best spread out as much as possible around the room (school laboratories tend to have the workbenches with sinks and power points around the edges of the room). Two groups share one power pack and one sharps bin, so they will need to be somewhat close in order for the cords to reach. Groups can work on opposite sides of protruding bench, which are often positioned near the sinks and have good access to the power points. The presenter can then easily see each group s work from the end of each bench. The case studies are laminated and are best kept on the desks, away from the electrophoresis sets. Photos of the electrophoresis sets are shown in the photos below the diagram. Desks case study 3 Desks case study 2 Desks case study 1 This picture shows two sets of electrophoresis sets, on opposite sides of a bench and sharing a sharps bin and a power pack (shown at the right). 6
7 Instructions for making agarose A 1.1% (w/v) agarose is used for the electrophoresis activity. Preparation is as follows: 1. Measure the appropriate amount of agarose using the measuring spoons and put it into the 500mL Schott bottle. 2. Measure the corresponding amount of TAE buffer needed (see table below) using the measuring cylinder, and pour it into the bottle. 3. Swirl the agarose and TAE so it is mixed in together. 4. Loosen the lid a little and microwave the mixture until all the agarose is dissolved, and the solution is clear and homogenous (2-4 mins depending on volume). Don t allow the solution to boil too much. 5. Open the lid of the jar tilting the bottle neck away from you and allow the molten agarose solution to cool down (5-10 mins). 6. Pour the agarose into the gel casting moulds and allow to set (the gel will turn cloudy). Please note: most classroom laboratories are not air-conditioned and therefore the gels can take some time to set. Placing them in a fridge will help them to set quickly, especially in warmer months. Quantities: Number of gels Agarose TAE buffer 2 large/3 small 1.1g (= ½ tsp) 100mL 4 large/6 small 2.2g (= 1 tsp) 200mL 8 large/12 small 4.4g (= 2 tsp) 400mL 7
8 Crime Scenes and Genes: DNA electrophoresis sample preparation The base dyes must be prepared into working solutions first. To do this, mix each dye (yellow, red, blue and cochinella) with glycerol and water in a ratio of 1:9:9 (approximately). Refer to the table below for a series of volumes. Volume 10mL 15mL 20mL Food dye 530µL 800µL 1060µL Glycerol 4735µL 7100µL 9470µL Water 4735µL 7100µL 9470µL Once the working dye solutions have been prepared, the samples can be made from these by mixing the dyes together. Please refer to the table below for instructions. Amounts are for a total volume of 10mL (except 20mL for the suspect 3/crime scene sample). Once 10mL volumes have been made, they can be dispensed into the labelled 1.5mL tubes. Sample Red Yellow Blue Cochinella Suspect 3/crime scene 10mL 10mL Suspect 1 4mL 6mL Suspect mL 3.33mL 3.33mL Suspect 4 4mL 6mL 8
9 Script A PowerPoint presentation is used for this activity. This acts as the script for the workshop. The presentation includes instructions on how to use the pipettes and load the gels. Worksheet On the following page is the worksheet which is used for this workshop. Acknowledgments This document was compiled by Phillipa Perrott and Maria Barrett. 9
10 CRIME SCENES AND GENES Crime Scenes and Genes Case number Which suspect s DNA profile matches the DNA profile on the balaclava? 2. Is this sufficient evidence that this suspect committed the crime? Why/why not? Case number Which samples match the suspect s DNA profile and where were they found? 2. Which samples match the victim s DNA profile and where were they found? 3. What would the profile look like if the victim s and the suspect s blood were mixed together? (This is referred to as a mixed sample.) 4. Can you think of example situations where a mixed sample might occur? Case number Which man is the most likely father of the child? 2. What does each line on a DNA profile represent? Your Gel Results 1. Which of your suspects has the same profile as the crime scene profile? 2. Which travels faster on a gel a large molecule or a smaller molecule? 3. Which coloured dye is made up of the smallest molecule? 4. What would happen if you put the gel in the tank the wrong way? 10
The Techniques of Molecular Biology: Forensic DNA Fingerprinting
Revised Fall 2011 The Techniques of Molecular Biology: Forensic DNA Fingerprinting The techniques of molecular biology are used to manipulate the structure and function of molecules such as DNA and proteins
Lab 5: DNA Fingerprinting
Lab 5: DNA Fingerprinting You are about to perform a procedure known as DNA fingerprinting. The data obtained may allow you to determine if the samples of DNA that you will be provided with are from the
DNA Electrophoresis Lesson Plan
DNA Electrophoresis Lesson Plan Primary Learning Outcomes: Students will learn how to properly load a well in an agarose gel. Students will learn how to analyze the results of DNA electrophoresis. Students
Objectives: Vocabulary:
Introduction to Agarose Gel Electrophoresis: A Precursor to Cornell Institute for Biology Teacher s lab Author: Jennifer Weiser and Laura Austen Date Created: 2010 Subject: Molecular Biology and Genetics
RAINBOW ELECTROPHORESIS 1 An Introduction to Gel Electrophoresis
RAINBOW ELECTROPHORESIS 1 An Introduction to Gel Electrophoresis INTRODUCTION This laboratory will demonstrate the basics of electrophoresis and the theory behind the separation of molecules on an agarose
DNA: A Person s Ultimate Fingerprint
A partnership between the UAB Center for Community Outreach Development and McWane Center DNA: A Person s Ultimate Fingerprint This project is supported by a Science Education Partnership Award (SEPA)
Mitochondrial DNA Analysis
Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)
Forensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA
Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns
Today you will extract DNA from some of your cells and learn more about DNA. Extracting DNA from Your Cells
DNA Based on and adapted from the Genetic Science Learning Center s How to Extract DNA from Any Living Thing (http://learn.genetics.utah.edu/units/activities/extraction/) and BioRad s Genes in a bottle
RESTRICTION ENZYME ANALYSIS OF DNA
University of Massachusetts Medical School Regional Science Resource Center SUPPORTING MATHEMATICS, SCIENCE AND TECHNOLOGY EDUCATION 222 Maple Avenue, Stoddard Building Shrewsbury, MA 01545-2732 508.856.5097
Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
Agarose Gel Electrophoresis with Food Color- Teacher Guide
Page 1 of 7 Project Home Gateway to the Project Laboratory Activities What the Project can do in the classroom Biotechnology Resources Favorite resources online and in print Agarose Gel Electrophoresis
The Chinese University of Hong Kong School of Life Sciences Biochemistry Program CUGEN Ltd.
The Chinese University of Hong Kong School of Life Sciences Biochemistry Program CUGEN Ltd. DNA Forensic and Agarose Gel Electrophoresis 1 OBJECTIVES Prof. Stephen K.W. Tsui, Dr. Patrick Law and Miss Fion
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
Computer 6B. Forensic DNA Fingerprinting
Forensic DNA Fingerprinting Computer 6B Scientists working in forensic labs are often asked to perform DNA profiling or fingerprinting to analyze evidence in law enforcement, mass disasters, and paternity
A STUDY ON THE EFFECTIVENESS OF PEER TUTORING AS A TEACHING METHOD IN HIGH SCHOOL BIOTECHNOLOGY LABS. June Camerlengo. Santa Fe High School
A STUDY ON THE EFFECTIVENESS OF PEER TUTORING AS A TEACHING METHOD IN HIGH SCHOOL BIOTECHNOLOGY LABS. 1 June Camerlengo Santa Fe High School A STUDY ON THE EFFECTIVENESS OF PEER TUTORING AS A TEACHING
Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
LAB 7 DNA RESTRICTION for CLONING
BIOTECHNOLOGY I DNA RESTRICTION FOR CLONING LAB 7 DNA RESTRICTION for CLONING STUDENT GUIDE GOALS The goals of this lab are to provide the biotech student with experience in DNA digestion with restriction
How Does a Genetic Counselor Detect Mutant Genes? SECTION E. How Genes and the Environment Influence Our Health CHAPTER 3
CHAPTER 3 How Genes and the Environment Influence Our Health SECTION E How Does a Genetic Counselor Detect Mutant Genes? Chapter 3 Modern Genetics for All Students T 211 Chapter 3: Section E Background
Crime Scene Investigator PCR Basics Kit
Biotechnology Explorer Crime Scene Investigator PCR Basics Kit Catalog #166-2600EDU explorer.bio-rad.com Note: Kit contains temperature-sensitive reagents. pen immediately upon arrival and store components
DNA PROFILING IN FORENSIC SCIENCE
DA PROFILIG I FORESIC SCIECE DA is the chemical code that is found in every cell of an individual's body, and is unique to each individual. Because it is unique, the ability to examine DA found at a crime
Basic Concepts Recombinant DNA Use with Chapter 13, Section 13.2
Name Date lass Master 19 Basic oncepts Recombinant DN Use with hapter, Section.2 Formation of Recombinant DN ut leavage Splicing opyright lencoe/mcraw-hill, a division of he Mcraw-Hill ompanies, Inc. Bacterial
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
Transformation Protocol
To make Glycerol Stocks of Plasmids ** To be done in the hood and use RNase/DNase free tips** 1. In a 10 ml sterile tube add 3 ml autoclaved LB broth and 1.5 ul antibiotic (@ 100 ug/ul) or 3 ul antibiotic
DNA and Forensic Science
DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief
Amazing DNA facts. Hands-on DNA: A Question of Taste Amazing facts and quiz questions
Amazing DNA facts These facts can form the basis of a quiz (for example, how many base pairs are there in the human genome?). Students should be familiar with most of this material, so the quiz could be
DNA Fingerprinting. Biotechnology - Electrophoresis & DNA Fingerprinting Biology 100 - Concepts of Biology 8.1. Name Instructor Lab Section.
Biotechnology - Electrophoresis & DNA Fingerprinting Biology 100 - Concepts of Biology 8.1 Name Instructor Lab Section Objectives: To gain a better understanding of: Fundamental Biotechnology Techniques
Module 3: Strawberry DNA Extraction
Module 3: Strawberry DNA Extraction Teacher/Leader Target Audience: 7-12 Life Science, Biology, Ag Science Overview: In this lab, students will extract DNA from a strawberry using everyday materials and
Genetics Test Biology I
Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.
Bacterial Transformation with Green Fluorescent Protein. Table of Contents Fall 2012
Bacterial Transformation with Green Fluorescent Protein pglo Version Table of Contents Bacterial Transformation Introduction..1 Laboratory Exercise...3 Important Laboratory Practices 3 Protocol...... 4
STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR)
STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR) [email protected] Av/ Puerta de Hierro s/n. 28040 Madrid. Tel: (34) 913944082
DNA SPOOLING 1 ISOLATION OF DNA FROM ONION
DNA SPOOLING 1 ISOLATION OF DNA FROM ONION INTRODUCTION This laboratory protocol will demonstrate several basic steps required for isolation of chromosomal DNA from cells. To extract the chromosomal DNA,
Modeling DNA Replication and Protein Synthesis
Skills Practice Lab Modeling DNA Replication and Protein Synthesis OBJECTIVES Construct and analyze a model of DNA. Use a model to simulate the process of replication. Use a model to simulate the process
BotanoTech: A Comparative Plant Genomics Module
BotanoTech: A Comparative Plant Genomics Module Students imagine themselves as employees of a (fictitious) San Diego Biotech Company Botanotech. The company develops anti-cancer medications and has identified
AGAROSE GEL ELECTROPHORESIS:
AGAROSE GEL ELECTROPHORESIS: BEST PRACTICES (BACK TO THE BASICS) Unit of Tropical Laboratory Medicine April 2009 Marcella Mori WORKFLOW OF AGAROSE GEL ELECTROPHORESIS: THREE STEPS Agarose gel electrophoresis
User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube
User Manual CelluLyser Lysis and cdna Synthesis Kit Version 1.4 Oct 2012 From cells to cdna in one tube CelluLyser Lysis and cdna Synthesis Kit Table of contents Introduction 4 Contents 5 Storage 5 Additionally
Touch DNA and DNA Recovery. H. Miller Coyle
Touch DNA and DNA Recovery 1 2 What is the link between cell biology & forensic science? Cells are the trace substances left behind that can identify an individual. Cells contain DNA. There are two forms
DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA
DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence
PTC DNA Fingerprint Gel
BIO 141 PTC DNA Fingerprint Analysis (Modified 3/14) PTC DNA Fingerprint Gel taster non- non- non- non- 100 bp taster taster taster taster taster taster taster ladder Tt tt Tt TT tt tt Tt tt 500 bp 300
14.3 Studying the Human Genome
14.3 Studying the Human Genome Lesson Objectives Summarize the methods of DNA analysis. State the goals of the Human Genome Project and explain what we have learned so far. Lesson Summary Manipulating
Dudesville: A crime scene under the microscope. QUT Extreme Science
Dudesville: A crime scene under the microscope QUT Extreme Science Glossary QUT Extreme Science DNA Chromatography Forensic Science Locard s Principle (Deoxyribonucleic acid) an extremely long macromolecule
2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
Blood Collection and Processing SOP
Brisbane Breast Bank Blood Collection and Processing SOP Breast Pathology Laboratory University of Queensland Centre for Clinical Research Blood Collection We collect 30ml of blood from patients who have
Using Digital Photography to Supplement Learning of Biotechnology. Methods
RESEARCH ON LEARNING Using Digital Photography to Supplement Learning of Biotechnology Fran n orf l u s AbstrAct The author used digital photography to supplement learning of biotechnology by students
Protocol Micro Lab. K:\Microlab_protocols\Protocols_active\03 Instrument manuals\ml03_001_001 DGGE.doc. Preparation of gels
Preparation of gels Cautions: Wear gloves all times when handling acryl amide and form amide solutions and all work with acryl amide and form amide has to be done in a flow hood. Acryl amide is very toxic.
Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.
Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists
Activity IT S ALL RELATIVES The Role of DNA Evidence in Forensic Investigations
Activity IT S ALL RELATIVES The Role of DNA Evidence in Forensic Investigations SCENARIO You have responded, as a result of a call from the police to the Coroner s Office, to the scene of the death of
SOP Title: Multiplex-PCR check of genomic DNA isolated from FFPE tissue for its usability in array CGH analysis
SOP Title: Multiplex-PCR check of genomic DNA isolated from FFPE tissue for its usability in array CGH analysis The STORE processing methods were shown to be fit-for purpose for DNA, RNA and protein extraction
First Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
Gene Mapping Techniques
Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction
Cloning GFP into Mammalian cells
Protocol for Cloning GFP into Mammalian cells Studiepraktik 2013 Molecular Biology and Molecular Medicine Aarhus University Produced by the instructors: Tobias Holm Bønnelykke, Rikke Mouridsen, Steffan
Biotechnology Explorer
Biotechnology Explorer Chromosome 16: PV92 PCR Informatics Kit Catalog #166-2100EDU explorer.bio-rad.com Note: Kit contains temperature-sensitive reagents. Open immediately upon arrival and store components
Activity 4 Long-Term Effects of Drug Addiction
Activity 4 Long-Term Effects of Drug Addiction Core Concept: Addictive drugs may lead to long-term changes in brain function. Class time required: Approximately 60-80 minutes Teacher Provides: Copy of
Replication Study Guide
Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have
DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
Bob Jesberg. Boston, MA April 3, 2014
DNA, Replication and Transcription Bob Jesberg NSTA Conference Boston, MA April 3, 2014 1 Workshop Agenda Looking at DNA and Forensics The DNA, Replication i and Transcription i Set DNA Ladder The Double
IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR)
IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) Background Infectious diseases caused by pathogenic organisms such as bacteria, viruses, protozoa,
HiPer Immunoelectrophoresis Teaching Kit
HiPer Immunoelectrophoresis Teaching Kit Product Code: HTI005 Number of experiments that can be performed: 5/20 Duration of Experiment: 2 days Day1- Protocol: 4 hours Day2- Observations: 15 minutes Storage
LAB 14 DNA Restriction Analysis
Name: AP Biology Lab 14 LAB 14 DNA Restriction Analysis Introduction: DNA restriction analysis is at the heart of recombinant DNA technology and of the laboratories in this course. The ability to cut DNA
1.5 page 3 DNA Replication S. Preston 1
AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 3 l. DNA Replication 1. Go through PowerPoint 2. Read notes p2 and then watch the animation
DNA Separation Methods. Chapter 12
DNA Separation Methods Chapter 12 DNA molecules After PCR reaction produces many copies of DNA molecules Need a way to separate the DNA molecules from similar sized molecules Only way to genotype samples
PRACTICE TEST QUESTIONS
PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.
Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown
1 DNA Coloring - Transcription & Translation Transcription RNA, Ribonucleic Acid is very similar to DNA. RNA normally exists as a single strand (and not the double stranded double helix of DNA). It contains
Genomic DNA Extraction Kit INSTRUCTION MANUAL
Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview
Genetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
THE ACTIVITY OF LACTASE
THE ACTIVITY OF LACTASE Lab VIS-8 From Juniata College Science in Motion Enzymes are protein molecules which act to catalyze the chemical reactions in living things. These chemical reactions make up the
To be able to describe polypeptide synthesis including transcription and splicing
Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain
Denaturing Gradient Gel Electrophoresis (DGGE)
Laboratory for Microbial Ecology Department of Earth, Ecological and Environmental Sciences University of Toledo Denaturing Gradient Gel Electrophoresis (DGGE) Background information Denaturing gradient
Supported by. A seven part series exploring the fantastic world of science.
Supported by A seven part series exploring the fantastic world of science. Find out what techniques are used by forensic scientists and why they are so useful. Forensic science is the term given to the
Lab # 12: DNA and RNA
115 116 Concepts to be explored: Structure of DNA Nucleotides Amino Acids Proteins Genetic Code Mutation RNA Transcription to RNA Translation to a Protein Figure 12. 1: DNA double helix Introduction Long
- In 1976 1977, Allan Maxam and walter Gilbert devised the first method for sequencing DNA fragments containing up to ~ 500 nucleotides.
DNA Sequencing - DNA sequencing includes several methods and technologies that are used for determining the order of the nucleotide bases adenine, guanine, cytosine, and thymine in a molecule of DNA. -
Teacher Guide: Have Your DNA and Eat It Too ACTIVITY OVERVIEW. http://gslc.genetics.utah.edu
ACTIVITY OVERVIEW Abstract: Students build an edible model of DNA while learning basic DNA structure and the rules of base pairing. Module: The Basics and Beyond Prior Knowledge Needed: DNA contains heritable
Southern Blot Analysis (from Baker lab, university of Florida)
Southern Blot Analysis (from Baker lab, university of Florida) DNA Prep Prepare DNA via your favorite method. You may find a protocol under Mini Yeast Genomic Prep. Restriction Digest 1.Digest DNA with
2D gel Protocol. 2. Determining Protein Concentration of cell lysates
2D gel Protocol 1. Lysis and Protein Extraction from cells Prepare cell lysates with Trizol extraction by following Kathleen Lyons s protocol: AfCS Procedure Protocol PP00000155, Version 1, 05/12/03 (Ref.1).
DNA Replication in Prokaryotes
OpenStax-CNX module: m44488 1 DNA Replication in Prokaryotes OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,
Gel Electrophoresis Teacher Instructions Suggested Grade Level: Grades 7-14 Class Time Required: 1 period (50 minutes)
Biological Sciences Initiative HHMI Gel Electrophoresis Teacher Instructions Suggested Grade Level: Grades 7-14 Class Time Required: 1 period (50 minutes) EQUIPMENT AND MATERIALS NEEDED (per group) Electrophoresis
Protease Peptide Microarrays Ready-to-use microarrays for protease profiling
Protocol Protease Peptide Microarrays Ready-to-use microarrays for protease profiling Contact us: InfoLine: +49-30-97893-117 Order per fax: +49-30-97893-299 Or e-mail: [email protected] www: www.jpt.com
UltraClean Forensic DNA Isolation Kit (Single Prep Format)
UltraClean Forensic DNA Isolation Kit (Single Prep Format) Catalog No. Quantity 14000-10 10 preps 14000-S 1 prep Instruction Manual Please recycle Version: 10302012 1 Table of Contents Introduction...
EPIGENETICS DNA and Histone Model
EPIGENETICS ABSTRACT A 3-D cut-and-paste model depicting how histone, acetyl and methyl molecules control access to DNA and affect gene expression. LOGISTICS TIME REQUIRED LEARNING OBJECTIVES DNA is coiled
Teacher Demo: Turning Water into Wine into Milk into Beer
SNC2D/2P Chemical Reactions/Chemical Reactions and their Practical Applications Teacher Demo: Turning Water into Wine into Milk into Beer Topics evidence of chemical change types of chemical reactions
Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website
Biomolecular Core Facility AI Dupont Hospital for Children, Rockland Center One, Room 214 Core: (302) 651-6712, Office: (302) 651-6707, [email protected] Katia Sol-Church, Ph.D., Director Jennifer Frenck
Introduction BIOMEDICAL WASTE
Page 1 of 4 Title: Chemical Waste Disposal Guidelines-Research Program or Department: Research Document Type: PROCEDURE Effective Date: January 01,2015 Author Steven Hayes Next Review Date: January 01,2016
DNA is found in all organisms from the smallest bacteria to humans. DNA has the same composition and structure in all organisms!
Biological Sciences Initiative HHMI DNA omponents and Structure Introduction Nucleic acids are molecules that are essential to, and characteristic of, life on Earth. There are two basic types of nucleic
GENOME RUSSIA PROJECT BLOOD SAMPLES COLLECTION, DNA EXTRACTION AND DNA QUALITY CONTROL PROTOCOLS
ST-PETERSBURG STATE UNIVERSITY THEODOSIUS DOBZHANSKY CENTER FOR GENOME BIOINFORMATICS GENOME RUSSIA PROJECT BLOOD SAMPLES COLLECTION, DNA EXTRACTION AND DNA QUALITY CONTROL PROTOCOLS 2015 The object of
SNEAK PEAK inside ACTIVITY. ADVANCE PREPARATION see next page for more details Cut strips of paper, if necessary Label markers, etc.
Dye Detective Learning Objectives: Students learn chemicals can be separated when they have different chemical properties. GRADE LEVEL K 8 SCIENCE TOPICS Physical Properties Atoms and Molecules Solutions
ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S.
A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA... A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA from Shed Reptile Skin ABSTRACT
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
Luminol Test PROCESS SKILLS SCIENCE TOPICS VOCABULARY
EXPERIMENT: LUMINOL TEST Luminol Test Visitors mix a solution of luminol with fake blood (hydrogen peroxide) to produce a reaction that gives off blue light. OBJECTIVES: Visitors learn that some chemical
ExpressArt Bacterial H-TR cdna synthesis kit. With extreme selectivity against rrnas
ExpressArt Bacterial H-TR cdna synthesis kit With extreme selectivity against rrnas suitable for 2 to 4 µg total RNA Catalogue No. 8004-A30 (30 rxns) Reagents Materials are provided for 30 cdna synthesis
VLLM0421c Medical Microbiology I, practical sessions. Protocol to topic J10
Topic J10+11: Molecular-biological methods + Clinical virology I (hepatitis A, B & C, HIV) To study: PCR, ELISA, your own notes from serology reactions Task J10/1: DNA isolation of the etiological agent
The Analysis of Food Samples for the Presence of Genetically Modified Organisms
The Analysis of Food Samples for the Presence of Genetically Modified Organisms Session 5 Agarose Gel Electrophoresis M. Somma, M. Querci WORLD HEALTH ORGANIZATION REGIONAL OFFICE FOR EUROPE ORGANISATION
CHM 130LL: ph, Buffers, and Indicators
CHM 130LL: ph, Buffers, and Indicators Many substances can be classified as acidic or basic. Acidic substances contain hydrogen ions, H +, while basic substances contain hydroxide ions, OH. The relative
Green Fluorescent Protein (GFP): Genetic Transformation, Synthesis and Purification of the Recombinant Protein
Green Fluorescent Protein (GFP): Genetic Transformation, Synthesis and Purification of the Recombinant Protein INTRODUCTION Green Fluorescent Protein (GFP) is a novel protein produced by the bioluminescent
Bio 102 Practice Problems Chromosomes and DNA Replication
Bio 102 Practice Problems Chromosomes and DNA Replication Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which one of the following enzymes is NT a key player in the process
