Coordination entre réplication et transcription: organisation du génome humain
|
|
|
- Lily Lawson
- 8 years ago
- Views:
Transcription
1 Coordination entre réplication et transcription: organisation du génome humain Claude Thermes Centre de Génétique Moléculaire, CNRS, Gif-sur-Yvette, FRANCE 23/09/2009
2 REPLICATION AND GENOME ORGANIZATION INTRODUCTION PART I : PREDICTIONS ON THE REPLICATION OF THE HUMAN GENOME BY SEQUENCE ANALYSIS PART II : EXPERIMENTAL VERIFICATION OF THE PREDICTIONS
3 ORIGIN Replication in Eubacteria speed of the replication fork : 500 to 1000 nucleotides/second time to replicate the E. coli genome ( base pairs) : < 40 TER
4 Replication and gene orientation in bacteria
5 Similar type of organization in eukaryotes, in human, in mammals...?
6 Replication origins in the human genome origins Human genome ( base pairs) replication fork speed: nucl/s the genome is divided in ~ replication units replication is achieved in ~ 8 hours
7 Large number of origins Stochasticity (one origin is not active in all cell divisions) All regions must be replicated, but only once tight control of the replication program replication factories: specialized sites occupied by several active replicons Cook Science 284 (1999)
8 Only 10-15% of replicons are active simultaneously during S phase Different origins activated at different moments of S phase Replication factories assemble dynamically in an organized program early middle/late D. Dimitrova, Nat. Rev. Genet. (2005) regions that replicate synchronuously in one cycle replicate synchronuously in the next cycle Replication program clonally inherited
9 Human spatio-temporal replication program : Where are the ~ replication origins on the genome? How is their activation orchestrated during the S phase?
10 Sequence associated with replication origins S. cerevisiae : ARS regions (~ 125 bp ; 11 bp ACS consensus) ; all origins experimentally determined S. pombe : ARS (~ 750 bp; no consensus, but AT-stretch) a number of origins experimentally determined multicellular eukaryotes : replication origins are mostly unknown! very few origins experimentally determined no consensus sequence (epigenetic elements) Human : replication origins expected ~ 30 well established ; 300 recently proposed by microarray experiments (Cadoret et al. PNAS 2009)
11 PART I PREDICTIONS ON THE REPLICATION OF THE HUMAN GENOME BY SEQUENCE ANALYSIS
12 NUCLEOTIDE COMPOSITIONAL SKEWS IN GENOME SEQUENCES
13 SECOND PARITY RULE On the same strand: [A] = [T ] ; [G] = [C] Bacterial genomes 1,4 1,4 1,2 1,2 A (Mb) 1 0,8 0,6 0,4 G (Mb) 1 0,8 0,6 0,4 0,2 0, ,2 0,4 0,6 0,8 1 1,2 1, ,2 0,4 0,6 0,8 1 1,2 1,4 T (Mb) C (Mb)
14 SECOND PARITY RULE On large scale, on the same strand: [A] = [T ] ; [G] = [C] Human chromosomes A (Mb) 40 G (Mb) T (Mb) C (Mb)
15 20 Mbp fragment of human chromosome 9 % C G Mega base pairs (Mbp) 1 point = 1 kilo base pairs
16 SECOND PARITY RULE Same rates of mutation, selection, fixation, on the 2 strands Same complementary substitution rates on the same strand n(c T) = n(g A)
17 cytosine deamination C T T T T TCGCATAGCGATGCATTCGGC AGCGTATCGCTACGTAAGCCG TTGCATAGTGATGCATTTGGC AGCGTATCGCTACGTAAGCCG TTGCATAGTGATGCATTTGGC AACGTATCACTACGTAAACCG T T T TTACATAGTGATACATTTAGC AATGTATCACTATGTAAATCG on each strand n(c T) = n(g A)
18 Same nucleotide substitution rates on the 2 strands Same complementary sustitution rates on the same strand Symmetrical A G (C T) = (G A) substitution matrix T C
19 Same nucleotide substitution rates on the 2 strands Same complementary sustitution rates on the same strand Symmetrical A G (C T) = (G A) (G T) = (C A) substitution matrix T C
20 Same nucleotide substitution rates on the 2 strands Same complementary sustitution rates on the same strand Symmetrical substitution matrix A G (C T) = (G A) (G T) = (C A) (A T) = (T A) T C
21 Same nucleotide substitution rates on the 2 strands Same complementary sustitution rates on the same strand Symmetrical substitution matrix A T G C (C T) = (G A) (G T) = (C A) (A T) = (T A) (C G) = (G C) (A G) = (T C) (A C) = (T G)
22 Same nucleotide substitution rates on the 2 strands Same complementary sustitution rates on the same strand A G Symmetrical substitution matrix Applied to a genome for millions years T C
23 Same nucleotide substitution rates on the 2 strands Same complementary sustitution rates on the same strand A G Symmetrical substitution matrix Applied to a genome for millions years T C at equilibrium [A] = [T] and [G] = [C] (same strand) Sueoka, Lobry, J. Mol. Evol. 40:318 (1995)
24 WHAT BIOLOGICAL MECHANISMS CAN BREAK THESE SYMMETRIES?
25 Okazaki fragments helicase Primase-DNA pol Eucaryotes: nt Procaryotes: nt 5 3 5
26 Replication asymmetry of mutation/repair between leading and lagging strands REPLICATION ORIGIN [G] [C] ; [A] [T] S GC = [G] [C] [G] + [C] Bacillus subtilis S TA = [T] [A] [T] + [A] S GC S GC S < 0 S > 0 x 10 6 pb 5 Lagging strand G < C Leading strand G > C 3 T < A T > A
27 Replication terminus Bacillus subtilis S GC G < C G > C Compositional skew used to detect replication origins and terminus in bacterial genomes
28 NUCLEOTIDE COMPOSITIONAL SKEWS IN THE HUMAN GENOME
29 NUCLEOTIDE SKEWS ASSOCIATED WITH REPLICATION
30 REPLICATION Skew around already known origins S = S TA + S GC MCM4 TOP1 MYC S S x x (kb( kb) (kb( kb) x (kb( kb) x (kb( kb)
31 SKEW PROFILE OF THE HUMAN GENOME genes (strand +) genes (strand -) intergenic regions x (Mb) Brodie et al., Phys. Rev. Lett. (2005)
32 SKEW PROFILE OF THE HUMAN GENOME genes (strand +) genes (strand -) intergenic regions x (Mb) Brodie et al., Phys. Rev. Lett. (2005)
33 SKEW PROFILE OF THE HUMAN GENOME N-domain genes (strand +) genes (strand -) intergenic regions x (Mb) Brodie et al., Phys. Rev. Lett. (2005)
34 Model of replication in N-domains O T N-domain O T O S Procaryote Human at each cycle: after several cycles: after N cycles: Ori 1 Ori 2 Ori 1 Ori 2 Ori 1 Ori 2 Ori1 Ori2 Replication forks S Asymmetry of replicating forks decreases along N-domains Touchon et al. Proc. Natl. Acad. Sci. USA (2005)
35 MODEL OF SKEW IN N-DOMAINS transcriptional skew profile (-) (+) OR I replicative skew profile OR I transcribed strand non-transcribed strand 5 3 S 0 superposition of transcription and replication ORI ORI 5 3 S 0
36 Step 1 : multi-scale shape detection of N-domains Wavelet analysis N-domain wavelet Nicolay et al. Phys. Rev. E (2007)
37 Step 1 : multi-scale shape detection of N-domains Wavelet analysis N-domain wavelet Nicolay et al. Phys. Rev. E (2007)
38 Step 1 : multi-scale shape detection of N-domains Wavelet analysis N-domain wavelet Nicolay et al. Phys. Rev. E (2007)
39 Step 1 : multi-scale shape detection of N-domains Wavelet analysis N-domain wavelet Nicolay et al. Phys. Rev. E (2007)
40 Step 1 : multi-scale shape detection of N-domains Wavelet analysis N-domain wavelet Nicolay et al. Phys. Rev. E (2007)
41 CHARACTERIZATION OF THE N-DOMAINS Huvet et al. Gen. Res. (2007) Domain size Chromosome coverage N ,5 1 1,5 2 2,5 3 x Mb 0 Chr 678 domains 30% human genome Mean size : 1,2+/-0,6 Mb 1016 candidate origins Huvet et al. Gen. Res. (2007)
42 CHARACTERIZATION OF THE N-DOMAINS Half-domains L1 S (%) h h h slope1=-h/l 1 L2 slope2=-h/l 2 L3 slope3=-h/l 3
43 «ASYMMETRY» OF THE HUMAN GENOME N-domains ~40 % inverted N-domains 0.6 %
44 GENE ORGANISATION IN N-DOMAINS
45 GENES ARE HIGHLY ORGANIZED IN N-DOMAINS near extremities, genes are more abundant near extremities, transcription is co oriented with the replication fork progression near extremities, genes broadly expressed far from extremities, genes are rare and expressed in few tissues Gene density putative ORI putative ORI Transcription distance to N-domain borders (Mbp) Huvet et al. Gen. Res. (2007)
46 GENES ARE HIGHLY ORGANIZED IN N-DOMAINS near extremities, genes are abundant transcription is co oriented with the replication fork progression near extremities, genes broadly expressed far from extremities, genes are expressed in few tissues N-domain Proportion of transcribed nucleotides Relative position in N-domains
47 GENES ARE HIGHLY ORGANIZED IN N-DOMAINS near origins, genes are abundant transcription is co oriented with the replication fork progression near extremities, genes broadly expressed far from extremities, genes are expressed in few tissues putative ORI N-domain putative ORI Mean breadth of expression distance to borders (Mbp)
48 COORDINATION OF REPLICATION AND TRANSCRIPTION N-domain putative early ORI putative master early ORI Huvet et al. Gen. Res. (2007)
49 PART II EXPERIMENTAL VERIFICATION OF PREDICTIONS
50 PREDICTION I N-DOMAINS RESULT FROM ASYMMETRIC MUTATION PATTERNS
51 Nucleotide substitutions Sequence alignement of 3 primate genomes Macaca mulatta AACTTTCGGTG GGTGGATGGG GATCCT TGTGTC CGTGT (rhesus monkey) Pan troglodytes AACTTTCA AGTAGTGGATGGA AATCCCGTGTAGTGT (chimpanzee) Homo sapiens AACTTTCGGTAGTGGG GTGGT TATCCCGTTTAGCGT
52 Nucleotide substitutions Sequence alignement of 3 primate genomes 3 mutations Macaca mulatta (3) (rhesus monkey) (1) (1) AACTTTCGGTG GGTGGATGGG GATCCT TGTGTC CGTGT 1 mutation Pan troglodytes AACTTTCA AGTAGTGGATGCA ATTCCCGTGTAGTGT (chimpanzee) Homo sapiens 1 mutation AACTTTCGGTAGTGGG GTGGT TATCCCGTTTAGCGT
53 Substitution rates in N-domains A G A -> C? A vers? C A vers? C?? A -> G? A vers? G A vers? G?? A -> T? A vers? T A vers? T?? C -> A? C vers? A C vers? A?? C -> G? C vers? G C vers? G?? C -> T? C vers? T C vers? T?? G -> A? G vers? A G vers? A?? G -> C? G vers? C G vers? C?? G -> T? G vers? T G vers? T?? T -> A? T vers? A T vers? A?? T -> C? T vers? C T vers? C?? T -> G? T vers? G T vers? G?? T C
54 SUBSTITUTION RATES A->G AND T->C ALONG THE N-DOMAINS S Normalized substitution rates A->G Substitution rate T->C Relative position in the domain
55 COMPOSITION AT EQUILIBRIUM REPRODUCES THE «N» SKEW PROFILE N-domain Skew S Substitution rate Relative position in the domain N-DOMAINS RESULT FROM ASYMMETRIC MUTATION PATTERNS
56 COMPOSITION AT EQUILIBRIUM REPRODUCES THE «N» SKEW PROFILE Skew S Substitution rate Relative position in the domain The domains are not at equilibrium Age : several hundred million years
57 PREDICTION 2 : N-DOMAINS BORDERS HARBOR EARLY REPLICATION INITIATION ZONES
58 DETERMINATION OF THE REPLICATION TIMING PROFILE OF THE HUMAN GENOME
59 Determination of replication timing profile by massive sequencing of neoreplicated DNA A. Rappailles, G. Guilbaud, O. Hyrien Asynchronous HeLa cells Incorporation BrdU + Fixation + Cell sorting S1, S2, S3, S4 S G2 S1 S2 S3 S4 G2 DNA Extraction+Sonication (250 à 4000 pb)+denature qpcr test Immuno-precipitation Random priming 10 minutes (generate double strand) Beta Globin (late replication) Lamin B2 (early replication) Ilumina Solexa sequencing (Sequence reads: 43,974,937)
60 Replication timing within a human chromosome Control (S) Signal (S1) Enrichment Signal/Control 10Mb
61 Replication timing within a chromosome region Early S1 S1 S phase S2 S3 S3 S2 S2 S3 Late S4 S4 S4 1Mb
62 Replication timing within a chromosome region Early S1 S phase S2 S3 Late S4 1Mb
63 Computation of TR50 (time for 50% replication) S1 TR50=0.37 S2 Tag number S3 S4 Replication timing during S phase Early Late
64 Replication timing within a chromosome region Early S1 S phase S2 S3 Late S4 TR50 0 1Mb 1
65 Replication timing within a chromosome region Early S1 S phase S2 S3 Late S4 TR50 0 Early replicating region with a small TR50 1Mb 1
66 Replication timing within a chromosome region Early S1 S phase S2 S3 Late S4 TR50 0 Late replicating region with a large TR50 1Mb 1
67 Chr 17
68 Mean replication timing profile within N-domains N-domain Early 0.50 S phase 0.55 Late N-domain borders harbor early replication initiation zones
69 SPATIO-TEMPORAL MODEL OF REPLICATION OF N-DOMAINS
70 DOMINO MODEL FOR N-DOMAIN REPLICATION A. Goldar and O. Hyrien ORI ORI ORI ORI N-domain ORI ORI ORI ORI Early Late ORI ORI master ORI ori ori Activation of replication origins propagate along N-domains
71 SIMULATION OF THE DOMINO MODEL FOR N-DOMAIN REPLICATION A. Goldar and O. Hyrien ORI ORI Replication Polarity experiment X (Mbp)
72 EVOLUTION OF N-DOMAINS
73 CONSERVATION OF N-DOMAINS IN MAMMALIAN GENOMES human S mouse S dog S x (kbp) Homologous regions
74 N-domains are at least years old? 350 MY 320 MY 80 MY 450 MY??
75 N-domains are at least years old? 350 MY 320 MY 80 MY 450 MY? Genomes are exceptionally stable in N-domains What does reflect this genomic stability? Are N-domain borders hotspots of instability during evolution? Is it also true in cancer cells??
76 Yves d'aubenton-carafa Chunlong Chen (CGM) Lauranne Duquenne (PBIL, Lyon) Maxime Huvet (Imp. Coll. London) Marie Touchon (ABI, Pasteur) Claude Thermes (CGM, Gif-sur-Yvette) Benjamin Audit Antoine Baker Edward-Benedict Brodie of Brodie Guillaume Chevereau Samuel Nicolay Cédric Vaillant Lamia Zaghloul Alain Arneodo (Joliot-Curie, ENS-Lyon) Arach Goldar (CEA, Gif-sur-Yvette) Aurélien Rappailles Guillaume Guilbaud Olivier Hyrien (ENS-Paris) Supports: CNRS, ACI IMPBio, ANR
Chapter 6 DNA Replication
Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore
DNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
MATCH Commun. Math. Comput. Chem. 61 (2009) 781-788
MATCH Communications in Mathematical and in Computer Chemistry MATCH Commun. Math. Comput. Chem. 61 (2009) 781-788 ISSN 0340-6253 Three distances for rapid similarity analysis of DNA sequences Wei Chen,
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh
Title: Surveying Genome to Identify Origins of DNA Replication In Silico
Title: Surveying Genome to Identify Origins of DNA Replication In Silico Abstract: DNA replication origins are the bases to realize the process of chromosome replication and analyze the progress of cell
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?
Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription
Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional
Current Motif Discovery Tools and their Limitations
Current Motif Discovery Tools and their Limitations Philipp Bucher SIB / CIG Workshop 3 October 2006 Trendy Concepts and Hypotheses Transcription regulatory elements act in a context-dependent manner.
Next Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem
FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem Elsa Bernard Laurent Jacob Julien Mairal Jean-Philippe Vert September 24, 2013 Abstract FlipFlop implements a fast method for de novo transcript
Appendix C DNA Replication & Mitosis
K.Muma Bio 6 Appendix C DNA Replication & Mitosis Study Objectives: Appendix C: DNA replication and Mitosis 1. Describe the structure of DNA and where it is found. 2. Explain complimentary base pairing:
MORPHEUS. http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix.
MORPHEUS http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix. Reference: MORPHEUS, a Webtool for Transcripton Factor Binding Analysis Using
Human-Mouse Synteny in Functional Genomics Experiment
Human-Mouse Synteny in Functional Genomics Experiment Ksenia Krasheninnikova University of the Russian Academy of Sciences, JetBrains krasheninnikova@gmail.com September 18, 2012 Ksenia Krasheninnikova
1.5 page 3 DNA Replication S. Preston 1
AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 3 l. DNA Replication 1. Go through PowerPoint 2. Read notes p2 and then watch the animation
Biological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
DNA: Structure and Replication
7 DNA: Structure and Replication WORKING WITH THE FIGURES 1. In Table 7-1, why are there no entries for the first four tissue sources? For the last three entries, what is the most likely explanation for
2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
Genomes and SNPs in Malaria and Sickle Cell Anemia
Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
Forensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
Translation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
Sample Questions for Exam 3
Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.
FINDING RELATION BETWEEN AGING AND
FINDING RELATION BETWEEN AGING AND TELOMERE BY APRIORI AND DECISION TREE Jieun Sung 1, Youngshin Joo, and Taeseon Yoon 1 Department of National Science, Hankuk Academy of Foreign Studies, Yong-In, Republic
Every time a cell divides the genome must be duplicated and passed on to the offspring. That is:
DNA Every time a cell divides the genome must be duplicated and passed on to the offspring. That is: Original molecule yields 2 molecules following DNA replication. Our topic in this section is how is
DNA Replication in Prokaryotes
OpenStax-CNX module: m44488 1 DNA Replication in Prokaryotes OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,
GENE REGULATION. Teacher Packet
AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures
Scottish Qualifications Authority
National Unit specification: general information Unit code: FH2G 12 Superclass: RH Publication date: March 2011 Source: Scottish Qualifications Authority Version: 01 Summary This Unit is a mandatory Unit
Human Genome Organization: An Update. Genome Organization: An Update
Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion
Structure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
Introduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
Copyright 1999 2003 by Mark Brandt, Ph.D.
Central dogma of molecular biology The term central dogma of molecular biology is patterned after religious terminology. owever, it refers to a process that is subject to the changes in understanding that
Statistical modeling of non-coding DNA
Statistical modeling of non-coding DNA 25/06/03 Infmeeting, Genova 23-25 June 2003 Overview Investigation of Inverted Repeats (IRs) in complete genomes of bacteria; IReD a web server of Inverted Repeats
Next Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took
Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing
STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAAC GTGCAC GTGAAC Wouter Coppieters Head of the genomics core facility GIGA center, University of Liège Bioruptor NGS: Unbiased DNA
Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.
Transfection Key words: Transient transfection, Stable transfection, transfection methods, vector, plasmid, origin of replication, reporter gene/ protein, cloning site, promoter and enhancer, signal peptide,
Genetics Test Biology I
Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.
Integrating DNA Motif Discovery and Genome-Wide Expression Analysis. Erin M. Conlon
Integrating DNA Motif Discovery and Genome-Wide Expression Analysis Department of Mathematics and Statistics University of Massachusetts Amherst Statistics in Functional Genomics Workshop Ascona, Switzerland
2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
Data Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
DNA as a Mass-Storage Device: 1
DNA as a Mass-Storage Device Robert J. Robbins Johns Hopkins University rrobbins@gdb.org DNA as a Mass-Storage Device: 1 Goals of the Genome Project Sequence the Genome equivalent to obtaining an image
Interaktionen von Nukleinsäuren und Proteinen
Sonja Prohaska Computational EvoDevo Universitaet Leipzig June 9, 2015 DNA is never naked in a cell DNA is usually in association with proteins. In all domains of life there are small, basic chromosomal
Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage
Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research March 17, 2011 Rendez-Vous Séquençage Presentation Overview Core Technology Review Sequence Enrichment Application
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
A Guide to LAMP primer designing (PrimerExplorer V4)
A Guide to LAMP primer designing (PrimerExplorer V4) Eiken Chemical Co., Ltd. _ Contents Key factors in designing LAMP primers 1. The LAMP primer 2. 2 Key factors in the LAMP primer design 3. The steps
MUTATION, DNA REPAIR AND CANCER
MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful
Expression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu
Expression and Purification of Recombinant Protein in bacteria and Yeast Presented By: Puspa pandey, Mohit sachdeva & Ming yu DNA Vectors Molecular carriers which carry fragments of DNA into host cell.
GenBank: A Database of Genetic Sequence Data
GenBank: A Database of Genetic Sequence Data Computer Science 105 Boston University David G. Sullivan, Ph.D. An Explosion of Scientific Data Scientists are generating ever increasing amounts of data. Relevant
DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
Recombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
Introduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
The world of non-coding RNA. Espen Enerly
The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often
Modeling and Simulation of Gene Regulatory Networks
Modeling and Simulation of Gene Regulatory Networks Hidde de Jong INRIA Grenoble - Rhône-Alpes Hidde.de-Jong@inria.fr http://ibis.inrialpes.fr INRIA Grenoble - Rhône-Alpes and IBIS IBIS: systems biology
Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne
Sanger Sequencing and Quality Assurance Zbigniew Rudzki Department of Pathology University of Melbourne Sanger DNA sequencing The era of DNA sequencing essentially started with the publication of the enzymatic
Replication Study Guide
Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have
Human Genome and Human Genome Project. Louxin Zhang
Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular
Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)
Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur
Figure 1: Genome sizes of different organisms.
How big are genomes? Genomes are now being sequenced at such a rapid rate that it is fair to say that it is becoming routine. As a result, there is a growing interest in trying to understand the meaning
DNA. Discovery of the DNA double helix
DNA Replication DNA Discovery of the DNA double helix A. 1950 s B. Rosalind Franklin - X-ray photo of DNA. C. Watson and Crick - described the DNA molecule from Franklin s X-ray. What is DNA? Question:
Algorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
Basic Concepts of DNA, Proteins, Genes and Genomes
Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate
Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium
Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium I. Introduction: Sequence based assays of transcriptomes (RNA-seq) are in wide use because of their favorable
Localised Sex, Contingency and Mutator Genes. Bacterial Genetics as a Metaphor for Computing Systems
Localised Sex, Contingency and Mutator Genes Bacterial Genetics as a Metaphor for Computing Systems Outline Living Systems as metaphors Evolutionary mechanisms Mutation Sex and Localized sex Contingent
AP Biology Essential Knowledge Student Diagnostic
AP Biology Essential Knowledge Student Diagnostic Background The Essential Knowledge statements provided in the AP Biology Curriculum Framework are scientific claims describing phenomenon occurring in
mirnaselect pep-mir Cloning and Expression Vector
Product Data Sheet mirnaselect pep-mir Cloning and Expression Vector CATALOG NUMBER: MIR-EXP-C STORAGE: -80ºC QUANTITY: 2 vectors; each contains 100 µl of bacterial glycerol stock Components 1. mirnaselect
Gene Expression Assays
APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency
Understanding the dynamics and function of cellular networks
Understanding the dynamics and function of cellular networks Cells are complex systems functionally diverse elements diverse interactions that form networks signal transduction-, gene regulatory-, metabolic-
Control of Gene Expression
Home Gene Regulation Is Necessary? Control of Gene Expression By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring
An Overview of DNA Sequencing
An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure
PROYECTO GENOMA HUMANO. Medicina Molecular 2011 Maestría en Biología Molecular Médica- UBA
PROYECTO GENOMA HUMANO Medicina Molecular 2011 Maestría en Biología Molecular Médica- UBA GENOMA HUMANO Medicina Molecular 2011 Maestría en Biología Molecular Médica- UBA Some landmarks on the way to 1940s
13.4 Gene Regulation and Expression
13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.
July 7th 2009 DNA sequencing
July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer
Bob Jesberg. Boston, MA April 3, 2014
DNA, Replication and Transcription Bob Jesberg NSTA Conference Boston, MA April 3, 2014 1 Workshop Agenda Looking at DNA and Forensics The DNA, Replication i and Transcription i Set DNA Ladder The Double
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
Outline. MicroRNA Bioinformatics. microrna biogenesis. short non-coding RNAs not considered in this lecture. ! Introduction
Outline MicroRNA Bioinformatics Rickard Sandberg Dept. of Cell and Molecular Biology (CMB) Karolinska Institutet! Introduction! microrna target site prediction! Useful resources 2 short non-coding RNAs
Worksheet - COMPARATIVE MAPPING 1
Worksheet - COMPARATIVE MAPPING 1 The arrangement of genes and other DNA markers is compared between species in Comparative genome mapping. As early as 1915, the geneticist J.B.S Haldane reported that
Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms
Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Introduction Mate pair sequencing enables the generation of libraries with insert sizes in the range of several kilobases (Kb).
REMOTE CONTROL by DNA as a Bio-sensor -antenna.
REMOTE CONTROL by DNA as a Bio-sensor -antenna. "Piezoelectric quantum transduction is a fundamental property of at- distance induction of genetic control " Paolo Manzelli: pmanzelli@gmail.com ; www.edscuola.it/lre.html;www.egocreanet.it
Genetomic Promototypes
Genetomic Promototypes Mirkó Palla and Dana Pe er Department of Mechanical Engineering Clarkson University Potsdam, New York and Department of Genetics Harvard Medical School 77 Avenue Louis Pasteur Boston,
Molecular Cell Biology WS2011
Molecular Cell Biology WS2011 Lecturer: Dr. Andreas Prokesch, Inst. for Genomics and Bioinformatics, TUG Purpose of this series of lectures: to offer you the basic knowledge required to know and understand
Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations
Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations AlCoB 2014 First International Conference on Algorithms for Computational Biology Thiago da Silva Arruda Institute
Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat
Bioinformatique et Séquençage Haut Débit, Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat 1 RNA Transcription to RNA and subsequent
Complex multicellular organisms are produced by cells that switch genes on and off during development.
Home Control of Gene Expression Gene Regulation Is Necessary? By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring
Genome and DNA Sequence Databases. BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009
Genome and DNA Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009 Admin Reading: Chapters 1 & 2 Notes available in PDF format on-line (see class calendar page): http://www.soe.ucsc.edu/classes/bme110/spring09/bme110-calendar.html
Milestones of bacterial genetic research:
Milestones of bacterial genetic research: 1944 Avery's pneumococcal transformation experiment shows that DNA is the hereditary material 1946 Lederberg & Tatum describes bacterial conjugation using biochemical
NOVEL GENOME-SCALE CORRELATION BETWEEN DNA REPLICATION AND RNA TRANSCRIPTION DURING THE CELL CYCLE IN YEAST IS PREDICTED BY DATA-DRIVEN MODELS
NOVEL GENOME-SCALE CORRELATION BETWEEN DNA REPLICATION AND RNA TRANSCRIPTION DURING THE CELL CYCLE IN YEAST IS PREDICTED BY DATA-DRIVEN MODELS Orly Alter (a) *, Gene H. Golub (b), Patrick O. Brown (c)
To be able to describe polypeptide synthesis including transcription and splicing
Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain
Transmission of genetic variation: conjugation. Transmission of genetic variation: conjugation
Transmission of genetic variation: conjugation Transmission of genetic variation: conjugation Bacterial Conjugation is genetic recombination in which there is a transfer of DNA from a living donor bacterium
MAKING AN EVOLUTIONARY TREE
Student manual MAKING AN EVOLUTIONARY TREE THEORY The relationship between different species can be derived from different information sources. The connection between species may turn out by similarities
a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled
Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino
Analysis of gene expression data. Ulf Leser and Philippe Thomas
Analysis of gene expression data Ulf Leser and Philippe Thomas This Lecture Protein synthesis Microarray Idea Technologies Applications Problems Quality control Normalization Analysis next week! Ulf Leser:
Mitochondrial DNA Analysis
Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the
Fact Sheet 14 EPIGENETICS
This fact sheet describes epigenetics which refers to factors that can influence the way our genes are expressed in the cells of our body. In summary Epigenetics is a phenomenon that affects the way cells
DNA sequencing via transverse transport: possibilities and fundamental issues
DNA sequencing via transverse transport: possibilities and fundamental issues Massimiliano Di Ventra Department of Physics, University of California, San Diego M. Zwolak and M. Di Ventra, Physical approaches
PRACTICE TEST QUESTIONS
PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.