Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations

Size: px
Start display at page:

Download "Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations"

Transcription

1 Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations AlCoB 2014 First International Conference on Algorithms for Computational Biology Thiago da Silva Arruda Institute of Computing University of Campinas Campinas, SP, Brazil Ulisses Dias Institute of Computing University of Campinas Campinas, SP, Brazil Zanoni Dias Institute of Computing University of Campinas Campinas, SP, Brazil Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27

2 Outline Genome Rearrangement Field Length-Weighted Inversions Greedy Randomized Search Procedure Experimental Results Conclusions Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27

3 Part I Genome Rearrangement Field Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27

4 Genome Rearrangement Field Genome Rearrangements Genes are shared by genomes from different species. Given two contemporary genomes, gene order and orientation may differ Yesrsinia pestis Nepal Yesrsinia pestis Angola Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27

5 Genome Rearrangement Field Genome Rearrangements Genomes undergo large scale mutations during the evolutionary process (move DNA-sequence from one place to the other). An inversion occurs when a chromosome breaks at two locations called breakpoints, and the DNA between the breakpoints is reversed. Pseudomonas putida KT Pseudomonas putida F1 Inversion 0... i-1 i... j j+1... n ρ(i,j) 0... i-1 -j... -i j+1... n Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27

6 Genome Rearrangement Field Evolutionary Distance The genetic data available for many organisms allows accurate evolutionary inference. The traditional approach uses nucleotide (or amino acid) comparison to find the edit distance. When mutational events (like inversions) affect very large stretches of DNA sequence? Whole-Genome Distance Measure. Compute the minimum number of lage-scale events needed to transform one genome into the other (parsimony criterion). Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27

7 Genome Rearrangement Field Evolutionary Distance Regarding the computation of parsimonious scenarios when only inversions are considered. A polynomial problem (Hannenhali and Pevzner, 1998). GRIMM is the most used tool for this job. Several studies have shown that inversions are shorter than expected under a neutral model. The sorting by inversion problem do not take into account the length of the reversed sequence. The sequence of operations that most likely happened during the evolution may not involve the movement of many long sequences. Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27

8 Part II Length-Weighted Inversions Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27

9 Length-Weighted Inversions Genome Representation We regard genomes as permutations: π = (π 1 π 2... π n ), for π i Z, 1 π i n and i j π i π j. Same Orientation Different Orientation Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27

10 Length-Weighted Inversions Sorting by Inversions Problem Given the gene order of two contemporary genomes, the task of finding the minimum number of inversions which transform one genome into the other is called Sorting by Inversion Problem Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27

11 Length-Weighted Inversions Sorting by Length-Weighted Inversions Problem cost = cost = 5 cost = 4 cost = 1 cost = 2 Total = 14 Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27

12 Part III Greedy Randomized Search Procedure Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27

13 Greedy Randomized Search Procedure Building Blocks Initial Solution Neighborhood Local Search Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27

14 Greedy Randomized Search Procedure Building Blocks Initial Solution A solution is a sequence of permutations s =< s 0,s 1,...,s m > such that s k differs from s k 1 by one inversion, 1 k m, s 0 = π and s m = ι. s =< ( ),( ),( ),( ),( ) >. We use an optimal solution for the Sorting by Inversions Problem as Initial Solution. Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27

15 Greedy Randomized Search Procedure Building Blocks Neighborhood Let s =< s 0,s 1,...,s m > be the current solution. Another solution s =< s 0,s 1,...,s m > is in the neighborhood of s, namely N f (s), if they differ by a frame that has no more than f elements. j - i +1 = f Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27

16 Greedy Randomized Search Procedure Building Blocks Local Search Our method iteratively improves the current solution. Each step requires a local change. The local change will be restricted to a given frame choosen by random. If a less costly sequence is found, it is made the current solution. Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27

17 Greedy Randomized Search Procedure Local Search - Definitions Let < s i,...,s j > be the frame where the change will be performed. We will call s i = α and s j = β. Breakpoint: pair of elements that are consecutive in α but not consecutive in β. α = ( ) β = ( ) Entropy: How far each element in α is from its position in beta. ent(α,β) = n p(α,i) p(β,i). i=1 Benefit: for any inversion ρ, the benefit δ is given by: δ(α,β,ρ) = ent(π,β) ent(π ρ,β) cost(ρ) Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27

18 Greedy Randomized Search Procedure Local Search We start the construction of new frame that will starts with α and ends with β. We select inversions that decrease the number of breakpoints. When no inversion of the kind exists, we execute one step of the algorithm proposed by Bergeron, 2006 for the Sorting by Inversions Problem. Building a Frame α... β Benefit Inversion Inv 1 Inv 2... Inv 5 Inv 6 Inv 7... Five best scored permutations Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27

19 Greedy Randomized Search Procedure Local Search We rank the selected inversions based on the benefit. The inversions ranked as high as fifth qualify to the second phase. We choose one inversion based on a random process called roulette wheel selection mechanism. Each inversion has a selection likelihood proportional to the square of its benefit. Building a Frame α... β Benefit Inversion Inv 1 Inv 2... Inv 5 Inv 6 Inv 7... Five best scored permutations Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27

20 Part IV Experimental Results Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27

21 Experimental Results Parameters Frame Size: < 14,12,10,8,6,4 > Iterations: 900 (150 for each frame size). Instances: we generated 1000 permutations whose sizes range from 10 to 100 in intervals of 5. Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27

22 Experimental Results Number of Improved Initial Solutions 100% 90% 80% 70% 60% 50% 40% 30% 20% 10% 0% Permutation size Percentage of Times our Heuristic Improved the Initial Solution Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27

23 Experimental Results 15% Average Improvement 12% 9% 6% 3% 0% Permutation size Percentage of Improvement on the Initial Solution Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27

24 Experimental Results Average Cost Swidan GRASP 0 GRIMM Permutation Size Comparative Analysis: Average Cost Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27

25 Part V Conclusions Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27

26 Conclusions We presented a new method for the length-weighted inversion problem on signed permutations. We considered the case where the weight function is simply the number of elements in the reversed segment. We were able to improve the initial solution in 94% of the cases. Our solutions cost 12% less than the initial solution, on average. We also show that our method provides solution that are less costly than a previous algorithm. Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27

27 Acknowledgments Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27

Asexual Versus Sexual Reproduction in Genetic Algorithms 1

Asexual Versus Sexual Reproduction in Genetic Algorithms 1 Asexual Versus Sexual Reproduction in Genetic Algorithms Wendy Ann Deslauriers (wendyd@alumni.princeton.edu) Institute of Cognitive Science,Room 22, Dunton Tower Carleton University, 25 Colonel By Drive

More information

Worksheet - COMPARATIVE MAPPING 1

Worksheet - COMPARATIVE MAPPING 1 Worksheet - COMPARATIVE MAPPING 1 The arrangement of genes and other DNA markers is compared between species in Comparative genome mapping. As early as 1915, the geneticist J.B.S Haldane reported that

More information

Pairwise Sequence Alignment

Pairwise Sequence Alignment Pairwise Sequence Alignment carolin.kosiol@vetmeduni.ac.at SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What

More information

DNA Insertions and Deletions in the Human Genome. Philipp W. Messer

DNA Insertions and Deletions in the Human Genome. Philipp W. Messer DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.

More information

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized: Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How

More information

BASIC STATISTICAL METHODS FOR GENOMIC DATA ANALYSIS

BASIC STATISTICAL METHODS FOR GENOMIC DATA ANALYSIS BASIC STATISTICAL METHODS FOR GENOMIC DATA ANALYSIS SEEMA JAGGI Indian Agricultural Statistics Research Institute Library Avenue, New Delhi-110 012 seema@iasri.res.in Genomics A genome is an organism s

More information

Regents Biology REGENTS REVIEW: PROTEIN SYNTHESIS

Regents Biology REGENTS REVIEW: PROTEIN SYNTHESIS Period Date REGENTS REVIEW: PROTEIN SYNTHESIS 1. The diagram at the right represents a portion of a type of organic molecule present in the cells of organisms. What will most likely happen if there is

More information

Hidden Markov Models

Hidden Markov Models 8.47 Introduction to omputational Molecular Biology Lecture 7: November 4, 2004 Scribe: Han-Pang hiu Lecturer: Ross Lippert Editor: Russ ox Hidden Markov Models The G island phenomenon The nucleotide frequencies

More information

Genetic Algorithm. Based on Darwinian Paradigm. Intrinsically a robust search and optimization mechanism. Conceptual Algorithm

Genetic Algorithm. Based on Darwinian Paradigm. Intrinsically a robust search and optimization mechanism. Conceptual Algorithm 24 Genetic Algorithm Based on Darwinian Paradigm Reproduction Competition Survive Selection Intrinsically a robust search and optimization mechanism Slide -47 - Conceptual Algorithm Slide -48 - 25 Genetic

More information

Genetic Algorithms commonly used selection, replacement, and variation operators Fernando Lobo University of Algarve

Genetic Algorithms commonly used selection, replacement, and variation operators Fernando Lobo University of Algarve Genetic Algorithms commonly used selection, replacement, and variation operators Fernando Lobo University of Algarve Outline Selection methods Replacement methods Variation operators Selection Methods

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

Human-Mouse Synteny in Functional Genomics Experiment

Human-Mouse Synteny in Functional Genomics Experiment Human-Mouse Synteny in Functional Genomics Experiment Ksenia Krasheninnikova University of the Russian Academy of Sciences, JetBrains krasheninnikova@gmail.com September 18, 2012 Ksenia Krasheninnikova

More information

Bio-Informatics Lectures. A Short Introduction

Bio-Informatics Lectures. A Short Introduction Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively

More information

Master's projects at ITMO University. Daniil Chivilikhin PhD Student @ ITMO University

Master's projects at ITMO University. Daniil Chivilikhin PhD Student @ ITMO University Master's projects at ITMO University Daniil Chivilikhin PhD Student @ ITMO University General information Guidance from our lab's researchers Publishable results 2 Research areas Research at ITMO Evolutionary

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Genome Explorer For Comparative Genome Analysis

Genome Explorer For Comparative Genome Analysis Genome Explorer For Comparative Genome Analysis Jenn Conn 1, Jo L. Dicks 1 and Ian N. Roberts 2 Abstract Genome Explorer brings together the tools required to build and compare phylogenies from both sequence

More information

GA as a Data Optimization Tool for Predictive Analytics

GA as a Data Optimization Tool for Predictive Analytics GA as a Data Optimization Tool for Predictive Analytics Chandra.J 1, Dr.Nachamai.M 2,Dr.Anitha.S.Pillai 3 1Assistant Professor, Department of computer Science, Christ University, Bangalore,India, chandra.j@christunivesity.in

More information

Alpha Cut based Novel Selection for Genetic Algorithm

Alpha Cut based Novel Selection for Genetic Algorithm Alpha Cut based Novel for Genetic Algorithm Rakesh Kumar Professor Girdhar Gopal Research Scholar Rajesh Kumar Assistant Professor ABSTRACT Genetic algorithm (GA) has several genetic operators that can

More information

Biological Sciences Initiative. Human Genome

Biological Sciences Initiative. Human Genome Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.

More information

6 Creating the Animation

6 Creating the Animation 6 Creating the Animation Now that the animation can be represented, stored, and played back, all that is left to do is understand how it is created. This is where we will use genetic algorithms, and this

More information

Protein Protein Interaction Networks

Protein Protein Interaction Networks Functional Pattern Mining from Genome Scale Protein Protein Interaction Networks Young-Rae Cho, Ph.D. Assistant Professor Department of Computer Science Baylor University it My Definition of Bioinformatics

More information

arxiv:1501.07546v1 [q-bio.gn] 29 Jan 2015

arxiv:1501.07546v1 [q-bio.gn] 29 Jan 2015 A Computational Method for the Rate Estimation of Evolutionary Transpositions Nikita Alexeev 1,2, Rustem Aidagulov 3, and Max A. Alekseyev 1, 1 Computational Biology Institute, George Washington University,

More information

Bioinformatics Resources at a Glance

Bioinformatics Resources at a Glance Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just

More information

1 Mutation and Genetic Change

1 Mutation and Genetic Change CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds

More information

MUTATION, DNA REPAIR AND CANCER

MUTATION, DNA REPAIR AND CANCER MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful

More information

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office

More information

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want 1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very

More information

PREDA S4-classes. Francesco Ferrari October 13, 2015

PREDA S4-classes. Francesco Ferrari October 13, 2015 PREDA S4-classes Francesco Ferrari October 13, 2015 Abstract This document provides a description of custom S4 classes used to manage data structures for PREDA: an R package for Position RElated Data Analysis.

More information

Introduction To Genetic Algorithms

Introduction To Genetic Algorithms 1 Introduction To Genetic Algorithms Dr. Rajib Kumar Bhattacharjya Department of Civil Engineering IIT Guwahati Email: rkbc@iitg.ernet.in References 2 D. E. Goldberg, Genetic Algorithm In Search, Optimization

More information

Genetic Algorithm Performance with Different Selection Strategies in Solving TSP

Genetic Algorithm Performance with Different Selection Strategies in Solving TSP Proceedings of the World Congress on Engineering Vol II WCE, July 6-8,, London, U.K. Genetic Algorithm Performance with Different Selection Strategies in Solving TSP Noraini Mohd Razali, John Geraghty

More information

Hybrid Genetic Algorithm for DNA Sequencing with Errors

Hybrid Genetic Algorithm for DNA Sequencing with Errors Journal of Heuristics, 8: 495 502, 2002 c 2002 Kluwer Academic Publishers. Manufactured in The Netherlands. Hybrid Genetic Algorithm for DNA Sequencing with Errors JACEK B LAŻEWICZ AND MARTA KASPRZAK Institute

More information

College of information technology Department of software

College of information technology Department of software University of Babylon Undergraduate: third class College of information technology Department of software Subj.: Application of AI lecture notes/2011-2012 ***************************************************************************

More information

CPO Science and the NGSS

CPO Science and the NGSS CPO Science and the NGSS It is no coincidence that the performance expectations in the Next Generation Science Standards (NGSS) are all action-based. The NGSS champion the idea that science content cannot

More information

MAKING AN EVOLUTIONARY TREE

MAKING AN EVOLUTIONARY TREE Student manual MAKING AN EVOLUTIONARY TREE THEORY The relationship between different species can be derived from different information sources. The connection between species may turn out by similarities

More information

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur

More information

A Non-Linear Schema Theorem for Genetic Algorithms

A Non-Linear Schema Theorem for Genetic Algorithms A Non-Linear Schema Theorem for Genetic Algorithms William A Greene Computer Science Department University of New Orleans New Orleans, LA 70148 bill@csunoedu 504-280-6755 Abstract We generalize Holland

More information

Focusing on results not data comprehensive data analysis for targeted next generation sequencing

Focusing on results not data comprehensive data analysis for targeted next generation sequencing Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes

More information

Integrating DNA Motif Discovery and Genome-Wide Expression Analysis. Erin M. Conlon

Integrating DNA Motif Discovery and Genome-Wide Expression Analysis. Erin M. Conlon Integrating DNA Motif Discovery and Genome-Wide Expression Analysis Department of Mathematics and Statistics University of Massachusetts Amherst Statistics in Functional Genomics Workshop Ascona, Switzerland

More information

Volume 3, Issue 2, February 2015 International Journal of Advance Research in Computer Science and Management Studies

Volume 3, Issue 2, February 2015 International Journal of Advance Research in Computer Science and Management Studies Volume 3, Issue 2, February 2015 International Journal of Advance Research in Computer Science and Management Studies Research Article / Survey Paper / Case Study Available online at: www.ijarcsms.com

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

Constructing nurse schedules at large hospitals

Constructing nurse schedules at large hospitals Intl. Trans. in Op. Res. 10 (2003) 245 265 INTERNATIONAL TRANSACTIONS IN OPERATIONAL RESEARCH Constructing nurse schedules at large hospitals Tiago M. Dias a, Daniel F. Ferber b, Cid C. de Souza c and

More information

Comparative Study: ACO and EC for TSP

Comparative Study: ACO and EC for TSP Comparative Study: ACO and EC for TSP Urszula Boryczka 1 and Rafa l Skinderowicz 1 and Damian Świstowski1 1 University of Silesia, Institute of Computer Science, Sosnowiec, Poland, e-mail: uboryczk@us.edu.pl

More information

GenBank, Entrez, & FASTA

GenBank, Entrez, & FASTA GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,

More information

Integer Programming: Algorithms - 3

Integer Programming: Algorithms - 3 Week 9 Integer Programming: Algorithms - 3 OPR 992 Applied Mathematical Programming OPR 992 - Applied Mathematical Programming - p. 1/12 Dantzig-Wolfe Reformulation Example Strength of the Linear Programming

More information

Next Generation Sequencing: Technology, Mapping, and Analysis

Next Generation Sequencing: Technology, Mapping, and Analysis Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took

More information

Genetomic Promototypes

Genetomic Promototypes Genetomic Promototypes Mirkó Palla and Dana Pe er Department of Mechanical Engineering Clarkson University Potsdam, New York and Department of Genetics Harvard Medical School 77 Avenue Louis Pasteur Boston,

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information

Evolutionary SAT Solver (ESS)

Evolutionary SAT Solver (ESS) Ninth LACCEI Latin American and Caribbean Conference (LACCEI 2011), Engineering for a Smart Planet, Innovation, Information Technology and Computational Tools for Sustainable Development, August 3-5, 2011,

More information

DnaSP, DNA polymorphism analyses by the coalescent and other methods.

DnaSP, DNA polymorphism analyses by the coalescent and other methods. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Author affiliation: Julio Rozas 1, *, Juan C. Sánchez-DelBarrio 2,3, Xavier Messeguer 2 and Ricardo Rozas 1 1 Departament de Genètica,

More information

DEVELOPMENT OF A WEBBASED APPLICATION TO DETECT PALINDROMES IN DNA SEQUENCES

DEVELOPMENT OF A WEBBASED APPLICATION TO DETECT PALINDROMES IN DNA SEQUENCES DEVELOPMENT OF A WEBBASED APPLICATION TO DETECT PALINDROMES IN DNA SEQUENCES Fatma Eltayeb 1, Muna Elbahir 2, Sahar Mohamed 3, Mohamed Ahmed and 4 Nazar Zaki 5 1, 2, 3,4 Faculty of Mathematical Science,

More information

ISSN: 2319-5967 ISO 9001:2008 Certified International Journal of Engineering Science and Innovative Technology (IJESIT) Volume 2, Issue 3, May 2013

ISSN: 2319-5967 ISO 9001:2008 Certified International Journal of Engineering Science and Innovative Technology (IJESIT) Volume 2, Issue 3, May 2013 Transistor Level Fault Finding in VLSI Circuits using Genetic Algorithm Lalit A. Patel, Sarman K. Hadia CSPIT, CHARUSAT, Changa., CSPIT, CHARUSAT, Changa Abstract This paper presents, genetic based algorithm

More information

PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org

PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,

More information

Management Science Letters

Management Science Letters Management Science Letters 4 (2014) 905 912 Contents lists available at GrowingScience Management Science Letters homepage: www.growingscience.com/msl Measuring customer loyalty using an extended RFM and

More information

14.10.2014. Overview. Swarms in nature. Fish, birds, ants, termites, Introduction to swarm intelligence principles Particle Swarm Optimization (PSO)

14.10.2014. Overview. Swarms in nature. Fish, birds, ants, termites, Introduction to swarm intelligence principles Particle Swarm Optimization (PSO) Overview Kyrre Glette kyrrehg@ifi INF3490 Swarm Intelligence Particle Swarm Optimization Introduction to swarm intelligence principles Particle Swarm Optimization (PSO) 3 Swarms in nature Fish, birds,

More information

Lecture 19: Proteins, Primary Struture

Lecture 19: Proteins, Primary Struture CPS260/BGT204.1 Algorithms in Computational Biology November 04, 2003 Lecture 19: Proteins, Primary Struture Lecturer: Pankaj K. Agarwal Scribe: Qiuhua Liu 19.1 The Building Blocks of Protein [1] Proteins

More information

Modified Version of Roulette Selection for Evolution Algorithms - the Fan Selection

Modified Version of Roulette Selection for Evolution Algorithms - the Fan Selection Modified Version of Roulette Selection for Evolution Algorithms - the Fan Selection Adam S lowik, Micha l Bia lko Department of Electronic, Technical University of Koszalin, ul. Śniadeckich 2, 75-453 Koszalin,

More information

Comparative genomic hybridization Because arrays are more than just a tool for expression analysis

Comparative genomic hybridization Because arrays are more than just a tool for expression analysis Microarray Data Analysis Workshop MedVetNet Workshop, DTU 2008 Comparative genomic hybridization Because arrays are more than just a tool for expression analysis Carsten Friis ( with several slides from

More information

New Modifications of Selection Operator in Genetic Algorithms for the Traveling Salesman Problem

New Modifications of Selection Operator in Genetic Algorithms for the Traveling Salesman Problem New Modifications of Selection Operator in Genetic Algorithms for the Traveling Salesman Problem Radovic, Marija; and Milutinovic, Veljko Abstract One of the algorithms used for solving Traveling Salesman

More information

Effect of Using Neural Networks in GA-Based School Timetabling

Effect of Using Neural Networks in GA-Based School Timetabling Effect of Using Neural Networks in GA-Based School Timetabling JANIS ZUTERS Department of Computer Science University of Latvia Raina bulv. 19, Riga, LV-1050 LATVIA janis.zuters@lu.lv Abstract: - The school

More information

Principles of Evolution - Origin of Species

Principles of Evolution - Origin of Species Theories of Organic Evolution X Multiple Centers of Creation (de Buffon) developed the concept of "centers of creation throughout the world organisms had arisen, which other species had evolved from X

More information

Evolutionary Detection of Rules for Text Categorization. Application to Spam Filtering

Evolutionary Detection of Rules for Text Categorization. Application to Spam Filtering Advances in Intelligent Systems and Technologies Proceedings ECIT2004 - Third European Conference on Intelligent Systems and Technologies Iasi, Romania, July 21-23, 2004 Evolutionary Detection of Rules

More information

A Review And Evaluations Of Shortest Path Algorithms

A Review And Evaluations Of Shortest Path Algorithms A Review And Evaluations Of Shortest Path Algorithms Kairanbay Magzhan, Hajar Mat Jani Abstract: Nowadays, in computer networks, the routing is based on the shortest path problem. This will help in minimizing

More information

A Framework for Genetic Algorithms in Games

A Framework for Genetic Algorithms in Games A Framework for Genetic Algorithms in Games Vinícius Godoy de Mendonça Cesar Tadeu Pozzer Roberto Tadeu Raiitz 1 Universidade Positivo, Departamento de Informática 2 Universidade Federal de Santa Maria,

More information

Randomized Sorting as a Big Data Search Algorithm

Randomized Sorting as a Big Data Search Algorithm Int'l Conf. on Advances in Big Data Analytics ABDA' 7 Randomized Sorting as a Big Data Search Algorithm I. Avramovic and D. S. Richards Department of Computer Science, George Mason University, Fairfax,

More information

Year 10: The transmission of heritable characteristics from one generation to the next involves DNA

Year 10: The transmission of heritable characteristics from one generation to the next involves DNA 1 Overview In this activity, students identify an unknown code (Activity 1) and then apply it to identify the message in an unknown text (Activity 2). Discussion questions consolidate the learning,and

More information

Evolution (18%) 11 Items Sample Test Prep Questions

Evolution (18%) 11 Items Sample Test Prep Questions Evolution (18%) 11 Items Sample Test Prep Questions Grade 7 (Evolution) 3.a Students know both genetic variation and environmental factors are causes of evolution and diversity of organisms. (pg. 109 Science

More information

Bob Jesberg. Boston, MA April 3, 2014

Bob Jesberg. Boston, MA April 3, 2014 DNA, Replication and Transcription Bob Jesberg NSTA Conference Boston, MA April 3, 2014 1 Workshop Agenda Looking at DNA and Forensics The DNA, Replication i and Transcription i Set DNA Ladder The Double

More information

TOWARD BIG DATA ANALYSIS WORKSHOP

TOWARD BIG DATA ANALYSIS WORKSHOP TOWARD BIG DATA ANALYSIS WORKSHOP 邁 向 巨 量 資 料 分 析 研 討 會 摘 要 集 2015.06.05-06 巨 量 資 料 之 矩 陣 視 覺 化 陳 君 厚 中 央 研 究 院 統 計 科 學 研 究 所 摘 要 視 覺 化 (Visualization) 與 探 索 式 資 料 分 析 (Exploratory Data Analysis, EDA)

More information

Hierarchical Bayesian Modeling of the HIV Response to Therapy

Hierarchical Bayesian Modeling of the HIV Response to Therapy Hierarchical Bayesian Modeling of the HIV Response to Therapy Shane T. Jensen Department of Statistics, The Wharton School, University of Pennsylvania March 23, 2010 Joint Work with Alex Braunstein and

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov

More information

Practical Applications of Evolutionary Computation to Financial Engineering

Practical Applications of Evolutionary Computation to Financial Engineering Hitoshi Iba and Claus C. Aranha Practical Applications of Evolutionary Computation to Financial Engineering Robust Techniques for Forecasting, Trading and Hedging 4Q Springer Contents 1 Introduction to

More information

LECTURE 6 Gene Mutation (Chapter 16.1-16.2)

LECTURE 6 Gene Mutation (Chapter 16.1-16.2) LECTURE 6 Gene Mutation (Chapter 16.1-16.2) 1 Mutation: A permanent change in the genetic material that can be passed from parent to offspring. Mutant (genotype): An organism whose DNA differs from the

More information

Statistical mechanics for real biological networks

Statistical mechanics for real biological networks Statistical mechanics for real biological networks William Bialek Joseph Henry Laboratories of Physics, and Lewis-Sigler Institute for Integrative Genomics Princeton University Initiative for the Theoretical

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

RNA Structure and folding

RNA Structure and folding RNA Structure and folding Overview: The main functional biomolecules in cells are polymers DNA, RNA and proteins For RNA and Proteins, the specific sequence of the polymer dictates its final structure

More information

Offline sorting buffers on Line

Offline sorting buffers on Line Offline sorting buffers on Line Rohit Khandekar 1 and Vinayaka Pandit 2 1 University of Waterloo, ON, Canada. email: rkhandekar@gmail.com 2 IBM India Research Lab, New Delhi. email: pvinayak@in.ibm.com

More information

Terms: The following terms are presented in this lesson (shown in bold italics and on PowerPoint Slides 2 and 3):

Terms: The following terms are presented in this lesson (shown in bold italics and on PowerPoint Slides 2 and 3): Unit B: Understanding Animal Reproduction Lesson 4: Understanding Genetics Student Learning Objectives: Instruction in this lesson should result in students achieving the following objectives: 1. Explain

More information

Replication Study Guide

Replication Study Guide Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have

More information

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS

More information

A greedy algorithm for the DNA sequencing by hybridization with positive and negative errors and information about repetitions

A greedy algorithm for the DNA sequencing by hybridization with positive and negative errors and information about repetitions BULLETIN OF THE POLISH ACADEMY OF SCIENCES TECHNICAL SCIENCES, Vol. 59, No. 1, 2011 DOI: 10.2478/v10175-011-0015-0 Varia A greedy algorithm for the DNA sequencing by hybridization with positive and negative

More information

An ACO/VNS Hybrid Approach for a Large-Scale Energy Management Problem

An ACO/VNS Hybrid Approach for a Large-Scale Energy Management Problem An ACO/VNS Hybrid Approach for a Large-Scale Energy Management Problem Challenge ROADEF/EURO 2010 Roman Steiner, Sandro Pirkwieser, Matthias Prandtstetter Vienna University of Technology, Austria Institute

More information

Comparison of Major Domination Schemes for Diploid Binary Genetic Algorithms in Dynamic Environments

Comparison of Major Domination Schemes for Diploid Binary Genetic Algorithms in Dynamic Environments Comparison of Maor Domination Schemes for Diploid Binary Genetic Algorithms in Dynamic Environments A. Sima UYAR and A. Emre HARMANCI Istanbul Technical University Computer Engineering Department Maslak

More information

Memory Allocation Technique for Segregated Free List Based on Genetic Algorithm

Memory Allocation Technique for Segregated Free List Based on Genetic Algorithm Journal of Al-Nahrain University Vol.15 (2), June, 2012, pp.161-168 Science Memory Allocation Technique for Segregated Free List Based on Genetic Algorithm Manal F. Younis Computer Department, College

More information

Network Protocol Analysis using Bioinformatics Algorithms

Network Protocol Analysis using Bioinformatics Algorithms Network Protocol Analysis using Bioinformatics Algorithms Marshall A. Beddoe Marshall_Beddoe@McAfee.com ABSTRACT Network protocol analysis is currently performed by hand using only intuition and a protocol

More information

A Genetic Algorithm Processor Based on Redundant Binary Numbers (GAPBRBN)

A Genetic Algorithm Processor Based on Redundant Binary Numbers (GAPBRBN) ISSN: 2278 1323 All Rights Reserved 2014 IJARCET 3910 A Genetic Algorithm Processor Based on Redundant Binary Numbers (GAPBRBN) Miss: KIRTI JOSHI Abstract A Genetic Algorithm (GA) is an intelligent search

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

Sequence Analysis 15: lecture 5. Substitution matrices Multiple sequence alignment

Sequence Analysis 15: lecture 5. Substitution matrices Multiple sequence alignment Sequence Analysis 15: lecture 5 Substitution matrices Multiple sequence alignment A teacher's dilemma To understand... Multiple sequence alignment Substitution matrices Phylogenetic trees You first need

More information

A Service Revenue-oriented Task Scheduling Model of Cloud Computing

A Service Revenue-oriented Task Scheduling Model of Cloud Computing Journal of Information & Computational Science 10:10 (2013) 3153 3161 July 1, 2013 Available at http://www.joics.com A Service Revenue-oriented Task Scheduling Model of Cloud Computing Jianguang Deng a,b,,

More information

HYBRID GENETIC ALGORITHM PARAMETER EFFECTS FOR OPTIMIZATION OF CONSTRUCTION RESOURCE ALLOCATION PROBLEM. Jin-Lee KIM 1, M. ASCE

HYBRID GENETIC ALGORITHM PARAMETER EFFECTS FOR OPTIMIZATION OF CONSTRUCTION RESOURCE ALLOCATION PROBLEM. Jin-Lee KIM 1, M. ASCE 1560 HYBRID GENETIC ALGORITHM PARAMETER EFFECTS FOR OPTIMIZATION OF CONSTRUCTION RESOURCE ALLOCATION PROBLEM Jin-Lee KIM 1, M. ASCE 1 Assistant Professor, Department of Civil Engineering and Construction

More information

Fact Sheet 14 EPIGENETICS

Fact Sheet 14 EPIGENETICS This fact sheet describes epigenetics which refers to factors that can influence the way our genes are expressed in the cells of our body. In summary Epigenetics is a phenomenon that affects the way cells

More information

Original Article Efficient Genetic Algorithm on Linear Programming Problem for Fittest Chromosomes

Original Article Efficient Genetic Algorithm on Linear Programming Problem for Fittest Chromosomes International Archive of Applied Sciences and Technology Volume 3 [2] June 2012: 47-57 ISSN: 0976-4828 Society of Education, India Website: www.soeagra.com/iaast/iaast.htm Original Article Efficient Genetic

More information

New binary representation in Genetic Algorithms for solving TSP by mapping permutations to a list of ordered numbers

New binary representation in Genetic Algorithms for solving TSP by mapping permutations to a list of ordered numbers Proceedings of the 5th WSEAS Int Conf on COMPUTATIONAL INTELLIGENCE, MAN-MACHINE SYSTEMS AND CYBERNETICS, Venice, Italy, November 0-, 006 363 New binary representation in Genetic Algorithms for solving

More information

Soft-Computing Models for Building Applications - A Feasibility Study (EPSRC Ref: GR/L84513)

Soft-Computing Models for Building Applications - A Feasibility Study (EPSRC Ref: GR/L84513) Soft-Computing Models for Building Applications - A Feasibility Study (EPSRC Ref: GR/L84513) G S Virk, D Azzi, K I Alkadhimi and B P Haynes Department of Electrical and Electronic Engineering, University

More information

Lab 4: 26 th March 2012. Exercise 1: Evolutionary algorithms

Lab 4: 26 th March 2012. Exercise 1: Evolutionary algorithms Lab 4: 26 th March 2012 Exercise 1: Evolutionary algorithms 1. Found a problem where EAs would certainly perform very poorly compared to alternative approaches. Explain why. Suppose that we want to find

More information

Chapter 6 DNA Replication

Chapter 6 DNA Replication Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore

More information

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each

More information

The Applications of Genetic Algorithms in Stock Market Data Mining Optimisation

The Applications of Genetic Algorithms in Stock Market Data Mining Optimisation The Applications of Genetic Algorithms in Stock Market Data Mining Optimisation Li Lin, Longbing Cao, Jiaqi Wang, Chengqi Zhang Faculty of Information Technology, University of Technology, Sydney, NSW

More information

AP Biology Essential Knowledge Student Diagnostic

AP Biology Essential Knowledge Student Diagnostic AP Biology Essential Knowledge Student Diagnostic Background The Essential Knowledge statements provided in the AP Biology Curriculum Framework are scientific claims describing phenomenon occurring in

More information

What mathematical optimization can, and cannot, do for biologists. Steven Kelk Department of Knowledge Engineering (DKE) Maastricht University, NL

What mathematical optimization can, and cannot, do for biologists. Steven Kelk Department of Knowledge Engineering (DKE) Maastricht University, NL What mathematical optimization can, and cannot, do for biologists Steven Kelk Department of Knowledge Engineering (DKE) Maastricht University, NL Introduction There is no shortage of literature about the

More information