GenBank: A Database of Genetic Sequence Data
|
|
|
- Hubert Craig
- 10 years ago
- Views:
Transcription
1 GenBank: A Database of Genetic Sequence Data Computer Science 105 Boston University David G. Sullivan, Ph.D. An Explosion of Scientific Data Scientists are generating ever increasing amounts of data. Relevant units include: terabyte (TB) = 1024 GB = 2 40 (or approx ) bytes petabyte (PB) = 1024 TB = 2 50 (or approx ) bytes equivalent to the text in one billion books! it would take over 3 years to read this much info using a high-speed tape drive! The amount of scientific data doubles every year!
2 An Explosion of Scientific Data (cont.) Example: GenBank database of genetic sequences on this graph, the data doubles every months as of May 2006, the doubling time was less than a year and getting shorter! Bases (billions) Aug-97 Aug-98 Aug-99 Aug-00 Aug-01 Aug-02 Aug-03 Aug-04 Aug-05 from: NCBI Field Guide presentation (ftp://ftp.ncbi.nih.gov/pub/fieldguide/slides/current/mtholyoke /) An Explosion of Scientific Data (cont.) The complexity of the data is also increasing. need significant computing power to process it As a result, there is an increasing trend toward scientific data centers that manage large collections of data on the behalf of scientists. provide tools for accessing/manipulating the data
3 GenBank A database of genetic sequence data (DNA, RNA, etc.) contributed by scientists; May 06: ~11,000 submissions/day Managed by the National Center for Biotechnology Information (NCBI) in Bethesda, Maryland NCBI collaborates with two other data centers: Each repository has the same raw data (use a daily sync). The derived data (e.g., info. on genes and proteins) is partially shared. Genetics Primer Genome = the instructions for building an organism recorded in DNA DNA is built from four fundamental units called bases: adenosine (A), guanine (G), cytosine (C), and thymidine (T) form a double helix: two strands connected together in the form a twisted ladder one pair of bases = one rung of the ladder each strand contains the same info. A always pairs with T C always pairs with G the strands are tightly bundled to form chromosomes image from
4 Genetics Primer (cont.) A DNA sequence specifies the bases that appear in a given strand or substrand of DNA. AGCTTTTCATTCTGACTGCAACGGGCAATATGTC up to several hundred million bases per chromosome in humans, this adds up to a total of ~3 billion bases Gene = a sequence of bases that is used to build a protein example: the gene for eye color = the sequence of bases that specifies a protein that makes your eyes look blue, or brown, or Genomics Research The Human Genome Project has determined the full sequence of bases in the human genome. everyone s genome is unique (except identical twins), but 99.9% of the bases are the same in all people the sequenced human genome is an average of sorts Researchers continue to add new sequence data: from the genomes of other organisms over 130,000 different organisms in GenBank from the genomes of other human individuals Researchers compare sequences from different genomes to: identify genes gain insight into the role of a given gene
5 Data Storage in GenBank The data is stored in flat text files. Example record: LOCUS NC_ bp DNA circular BCT 15-OCT-2004 DEFINITION Escherichia coli K12, complete genome. ACCESSION NC_ VERSION NC_ GI: KEYWORDS. SOURCE Escherichia coli K12 ORGANISM Escherichia coli K12 Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales; Enterobacteriaceae; Escherichia. REFERENCE 1 (bases 1 to ) AUTHORS Blattner,F.R., Plunkett,G. III, Bloch,C.A., Perna,N.T. TITLE The complete genome sequence of Escherichia coli K-12 JOURNAL Science 277 (5331), (1997) MEDLINE PUBMED ORIGIN 1 agcttttcat tctgactgca acgggcaata tgtctctgtg tggattaaaa aaagagtgtc 61 tgatagcagc ttctgaactg gttacctgcc gtgagtaaat taaaatttta ttgacttagg 121 tcactaaata ctttaaccaa tataggcata gcgcacagac agataaaaat tacagagtac Stored in compressed form and available by FTP. ftp://ftp.ncbi.nih.gov Data Storage in GenBank (cont.) LOCUS NC_ bp DNA circular BCT 15-OCT-2004 DEFINITION Escherichia coli K12, complete genome. ACCESSION NC_ VERSION NC_ GI: Similar records are grouped together in a file. example: the code BCT above means bacteria the records in this file are all for bacteria The accession number is a permanent and universally unique identifier for a particular sequence. The version number reflects changes made to a sequence. updating the sequence changes the version number, but it doesn t change the accession number Which of these numbers would you use as the primary key?
6 Why Flat Files? Most conventional database systems are not optimized for large strings like the ones needed for genetic sequences. Conventional DBMSs don t support the types of queries that are often needed. biologists use programs (often written in Python or Perl) to perform the queries Flat files can be viewed on any platform without specialized software. Queries I: Text Searches Entrez Nucleotide allows you to perform a text search on the records in GenBank and other related databases. can specify predicates based on one or more fields examples: 3000[SLEN] (sequence length = 3000) 3000:4000[SLEN] (3000 <= sequence length <= 4000) human[orgn] (organism type = human) 3000:4000[SLEN] AND human[orgn] what aspect of SQL does this resemble? if you don't specify field names, Entrez performs the equivalent of a Google search on the records
7 Example of Entrez Nucleotide Queries II: Similarity Searches What if we want to search for sequences that "include" a particular gene or other sequence of bases? Text search does not work well for this problem. Why? genetic sequence data is noisy. errors in sequencing missing data mutations individual variation common queries involve looking for similarities, rather than exact matches problem: noise may make unrelated genes appear similar!
8 Similarity Searches Using BLAST BLAST is a set of online tools for performing similarity searches. nucleotide-nucleotide BLAST (blastn) is used for similarity searches involving DNA sequences BLAST returns some number of hits: sequences containing subsequences whose similarity to the query is statistically significant. the goodness of a match takes into account the number of insertions, deletions, and substitutions that would be needed to create a perfect match. query: TCGTCTGTT hit: aligned query: AGCTTTTCATTCTGAGTCCAACGGGCAAGTC TCG-TCT--GTT Example of a BLAST Query We've changed the database to "Nucleotide collection (nr/nt)" so that sequences from non-human organisms are included.
9 BLAST Results Note that both human and non-human sequences appear in the results. BLAST Results (cont.) Each hit is accompanied by several metrics, including: max score: measures how close the match is higher max scores are better E value: measures statistical significance E = the number of hits you would expect to obtain with this max score purely by chance lower E scores are better
10 BLAST Results (cont.) The results screen also displays the partial match. Example: the query shown on the earlier slides was a 140-base sequence taken from a human sequence in the database. it matches perfectly with other human ones it also partially matches sequences for other organisms, including cows: Using BLAST for Cancer Research Scientists believe that some forms of cancer are caused by viruses. Such viruses may insert copies of their own DNA into the DNA of the infected person. Weber et al. use BLAST to look for cancer-causing viruses. break an infected person's DNA into many pieces run each piece through BLAST use the nr/nt database as before, so that non-human sequences are included
11 Using BLAST for Cancer Research (cont.) Which of the following sequences may be from a virus? GTATAAGTGAACCACTCAGGGTCCTGGCCGGGCACAGTGGCTCACGCCTGTAATCCCAGC ACTTTGGGAGGCCGAGGTGGGTGGATCATGAGGTCAGGAGTTCAAGACCAGCCTGGCCAA CATGGCGAAACATTGTCTCTACTAAAAGTACAAAAATTAGCCAGACGTGGTGGTGCTCAC CTGTAATCCCAGCTACTCGGGAGGCTGAGGCAGGAAAATCACTTGAACCCGGGAGGCGGA TTATTAACTGTTGGTAATCCATATTTTAGGGTTCCTGCAGGTGGTGGCAATAAGCAGGAT ATTCCTAAGGTTTCTGCATACCAATATAGAGTATTTAGGGTGCAGTTACCTGACCCAAAT AAATTTGGTTTACCTGATAATAGTATTTATAATCCTGAAACACAACGTTTAGTGTGGGCC TGTGCTGGAGTGGAAATTGGCCGTGGTCAGCCTTTAGGTGTTGGCCTTAGTGGGCATCCA ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATC TGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAG TTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTG AGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTC References Portions of these notes are based on a presentation by Griffin Weber. Other resources: the genomics primer at the NCBI Handbook ( Weber et al., "Identification of candidate infectious agents by transcript sequence filtering." Nature Genetics Feb; 30(2):
Introduction to Databases and Data Mining
Introduction to Databases and Data Mining Computer Science 105 Boston University David G. Sullivan, Ph.D. Welcome to CS 105! This course examines how collections of data are organized, stored, and processed.
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
GenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
Analyzing A DNA Sequence Chromatogram
LESSON 9 HANDOUT Analyzing A DNA Sequence Chromatogram Student Researcher Background: DNA Analysis and FinchTV DNA sequence data can be used to answer many types of questions. Because DNA sequences differ
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
Structure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
Searching Nucleotide Databases
Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames
12.1 The Role of DNA in Heredity
12.1 The Role of DNA in Heredity Only in the last 50 years have scientists understood the role of DNA in heredity. That understanding began with the discovery of DNA s structure. In 1952, Rosalind Franklin
Bob Jesberg. Boston, MA April 3, 2014
DNA, Replication and Transcription Bob Jesberg NSTA Conference Boston, MA April 3, 2014 1 Workshop Agenda Looking at DNA and Forensics The DNA, Replication i and Transcription i Set DNA Ladder The Double
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3
DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
SNP Essentials The same SNP story
HOW SNPS HELP RESEARCHERS FIND THE GENETIC CAUSES OF DISEASE SNP Essentials One of the findings of the Human Genome Project is that the DNA of any two people, all 3.1 billion molecules of it, is more than
Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011
Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear
Module 1. Sequence Formats and Retrieval. Charles Steward
The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.
When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want
1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very
Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.
Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists
2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
Biological Sequence Data Formats
Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA
Basic Concepts of DNA, Proteins, Genes and Genomes
Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate
Database Fundamentals
Database Fundamentals Computer Science 105 Boston University David G. Sullivan, Ph.D. Bit = 0 or 1 Measuring Data: Bits and Bytes One byte is 8 bits. example: 01101100 Other common units: name approximate
1.5 page 3 DNA Replication S. Preston 1
AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 3 l. DNA Replication 1. Go through PowerPoint 2. Read notes p2 and then watch the animation
Sequencing the Human Genome
Revised and Updated Edvo-Kit #339 Sequencing the Human Genome 339 Experiment Objective: In this experiment, students will read DNA sequences obtained from automated DNA sequencing techniques. The data
Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
Translation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown
1 DNA Coloring - Transcription & Translation Transcription RNA, Ribonucleic Acid is very similar to DNA. RNA normally exists as a single strand (and not the double stranded double helix of DNA). It contains
A Tutorial in Genetic Sequence Classification Tools and Techniques
A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University [email protected] www.jakemdrew.com Sequence Characters IUPAC nucleotide
Lab # 12: DNA and RNA
115 116 Concepts to be explored: Structure of DNA Nucleotides Amino Acids Proteins Genetic Code Mutation RNA Transcription to RNA Translation to a Protein Figure 12. 1: DNA double helix Introduction Long
Mitochondrial DNA Analysis
Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)
Teaching Bioinformatics to Undergraduates
Teaching Bioinformatics to Undergraduates http://www.med.nyu.edu/rcr/asm Stuart M. Brown Research Computing, NYU School of Medicine I. What is Bioinformatics? II. Challenges of teaching bioinformatics
Genetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
Genomes and SNPs in Malaria and Sickle Cell Anemia
Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing
BLAST. Anders Gorm Pedersen & Rasmus Wernersson
BLAST Anders Gorm Pedersen & Rasmus Wernersson Database searching Using pairwise alignments to search databases for similar sequences Query sequence Database Database searching Most common use of pairwise
DNA Sequencing Overview
DNA Sequencing Overview DNA sequencing involves the determination of the sequence of nucleotides in a sample of DNA. It is presently conducted using a modified PCR reaction where both normal and labeled
DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
Concluding lesson. Student manual. What kind of protein are you? (Basic)
Concluding lesson Student manual What kind of protein are you? (Basic) Part 1 The hereditary material of an organism is stored in a coded way on the DNA. This code consists of four different nucleotides:
Chapter 6 DNA Replication
Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore
HUMAN PROTEINS FROM GENETIC ENGINEERING OF ORGANISMS
HUMAN PROTEINS FROM GM BACTERIA Injecting insulin is an everyday event for many people with diabetes. GENETIC ENGINEERING OF ORGANISMS involves transferring genes from one species into another. Genetic
Bioinformatics Grid - Enabled Tools For Biologists.
Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
Chapter 11: Molecular Structure of DNA and RNA
Chapter 11: Molecular Structure of DNA and RNA Student Learning Objectives Upon completion of this chapter you should be able to: 1. Understand the major experiments that led to the discovery of DNA as
14.3 Studying the Human Genome
14.3 Studying the Human Genome Lesson Objectives Summarize the methods of DNA analysis. State the goals of the Human Genome Project and explain what we have learned so far. Lesson Summary Manipulating
DNA Sequence formats
DNA Sequence formats [Plain] [EMBL] [FASTA] [GCG] [GenBank] [IG] [IUPAC] [How Genomatix represents sequence annotation] Plain sequence format A sequence in plain format may contain only IUPAC characters
Replication Study Guide
Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have
The Human Genome Project. From genome to health From human genome to other genomes and to gene function Structural Genomics initiative
The Human Genome Project From genome to health From human genome to other genomes and to gene function Structural Genomics initiative June 2000 What is the Human Genome Project? U.S. govt. project coordinated
Activity IT S ALL RELATIVES The Role of DNA Evidence in Forensic Investigations
Activity IT S ALL RELATIVES The Role of DNA Evidence in Forensic Investigations SCENARIO You have responded, as a result of a call from the police to the Coroner s Office, to the scene of the death of
Library page. SRS first view. Different types of database in SRS. Standard query form
SRS & Entrez SRS Sequence Retrieval System Bengt Persson Whatis SRS? Sequence Retrieval System User-friendly interface to databases http://srs.ebi.ac.uk Developed by Thure Etzold and co-workers EMBL/EBI
Kaustubha Qanungo Ph.D Biological Sciences Trident Technical College 7000 Rivers Avenue Charleston SC 29464
Call for action: Paradigm shift in teaching microbiology in a community colleges Kaustubha Qanungo Ph.D Biological Sciences Trident Technical College 7000 Rivers Avenue Charleston SC 29464 Project Course:
Make a model DNA strand
Make a model DNA strand Summary A strand of DNA looks like a ladder that has been twisted into a corkscrew. Just like a ladder, a DNA strand has two rails running parallel to each other and rungs that
Special report. Chronic Lymphocytic Leukemia (CLL) Genomic Biology 3020 April 20, 2006
Special report Chronic Lymphocytic Leukemia (CLL) Genomic Biology 3020 April 20, 2006 Gene And Protein The gene that causes the mutation is CCND1 and the protein NP_444284 The mutation deals with the cell
Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison
Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 [email protected]
2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
agucacaaacgcu agugcuaguuua uaugcagucuua
RNA Secondary Structure Prediction: The Co-transcriptional effect on RNA folding agucacaaacgcu agugcuaguuua uaugcagucuua By Conrad Godfrey Abstract RNA secondary structure prediction is an area of bioinformatics
DNA. Discovery of the DNA double helix
DNA Replication DNA Discovery of the DNA double helix A. 1950 s B. Rosalind Franklin - X-ray photo of DNA. C. Watson and Crick - described the DNA molecule from Franklin s X-ray. What is DNA? Question:
DNA Paper Model Activity Level: Grade 6-8
Karen Mayes DNA Paper Model Activity Level: Grade 6-8 Students will be able to: 1. Identify the component molecules of DNA. 2. Construct a model of the DNA double-helix. 3. Identify which bases are found
Human Genome Organization: An Update. Genome Organization: An Update
Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion
How is genome sequencing done?
How is genome sequencing done? Using 454 Sequencing on the Genome Sequencer FLX System, DNA from a genome is converted into sequence data through four primary steps: Step One DNA sample preparation; Step
1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
Algorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
Putting Genomes in the Cloud with WOS TM. ddn.com. DDN Whitepaper. Making data sharing faster, easier and more scalable
DDN Whitepaper Putting Genomes in the Cloud with WOS TM Making data sharing faster, easier and more scalable Table of Contents Cloud Computing 3 Build vs. Rent 4 Why WOS Fits the Cloud 4 Storing Sequences
How Cancer Begins???????? Chithra Manikandan Nov 2009
Cancer Cancer is one of the most common diseases in the developed world: 1 in 4 deaths are due to cancer 1 in 17 deaths are due to lung cancer Lung cancer is the most common cancer in men Breast cancer
Next Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
Genetic Testing in Research & Healthcare
We Innovate Healthcare Genetic Testing in Research & Healthcare We Innovate Healthcare Genetic Testing in Research and Healthcare Human genetic testing is a growing science. It is used to study genes
Focusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
SAP HANA Enabling Genome Analysis
SAP HANA Enabling Genome Analysis Joanna L. Kelley, PhD Postdoctoral Scholar, Stanford University Enakshi Singh, MSc HANA Product Management, SAP Labs LLC Outline Use cases Genomics review Challenges in
Genetics Test Biology I
Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.
A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques
Proceedings of the 2007 WSEAS International Conference on Computer Engineering and Applications, Gold Coast, Australia, January 17-19, 2007 402 A Multiple DNA Sequence Translation Tool Incorporating Web
DNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
Commonly Used STR Markers
Commonly Used STR Markers Repeats Satellites 100 to 1000 bases repeated Minisatellites VNTR variable number tandem repeat 10 to 100 bases repeated Microsatellites STR short tandem repeat 2 to 6 bases repeated
Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription
Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional
org.rn.eg.db December 16, 2015 org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers.
org.rn.eg.db December 16, 2015 org.rn.egaccnum Map Entrez Gene identifiers to GenBank Accession Numbers org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank
Next Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University [email protected] http://tandem.bu.edu/ The Human Genome Project took
DNA and Forensic Science
DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief
BioBoot Camp Genetics
BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before
Pairwise Sequence Alignment
Pairwise Sequence Alignment [email protected] SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What
PRESTWICK ACADEMY NATIONAL 5 BIOLOGY CELL BIOLOGY SUMMARY
Name PRESTWICK ACADEMY NATIONAL 5 BIOLOGY CELL BIOLOGY SUMMARY Cell Structure Identify animal, plant, fungal and bacterial cell ultrastructure and know the structures functions. Plant cell Animal cell
LESSON 9. Analyzing DNA Sequences and DNA Barcoding. Introduction. Learning Objectives
9 Analyzing DNA Sequences and DNA Barcoding Introduction DNA sequencing is performed by scientists in many different fields of biology. Many bioinformatics programs are used during the process of analyzing
Scottish Qualifications Authority
National Unit specification: general information Unit code: FH2G 12 Superclass: RH Publication date: March 2011 Source: Scottish Qualifications Authority Version: 01 Summary This Unit is a mandatory Unit
Today you will extract DNA from some of your cells and learn more about DNA. Extracting DNA from Your Cells
DNA Based on and adapted from the Genetic Science Learning Center s How to Extract DNA from Any Living Thing (http://learn.genetics.utah.edu/units/activities/extraction/) and BioRad s Genes in a bottle
SMRT Analysis v2.2.0 Overview. 1. SMRT Analysis v2.2.0. 1.1 SMRT Analysis v2.2.0 Overview. Notes:
SMRT Analysis v2.2.0 Overview 100 338 400 01 1. SMRT Analysis v2.2.0 1.1 SMRT Analysis v2.2.0 Overview Welcome to Pacific Biosciences' SMRT Analysis v2.2.0 Overview 1.2 Contents This module will introduce
Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)
Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur
DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA
DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence
DNA Replication in Prokaryotes
OpenStax-CNX module: m44488 1 DNA Replication in Prokaryotes OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,
MUTATION, DNA REPAIR AND CANCER
MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful
Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.
Transfection Key words: Transient transfection, Stable transfection, transfection methods, vector, plasmid, origin of replication, reporter gene/ protein, cloning site, promoter and enhancer, signal peptide,
An agent-based layered middleware as tool integration
An agent-based layered middleware as tool integration Flavio Corradini Leonardo Mariani Emanuela Merelli University of L Aquila University of Milano University of Camerino ITALY ITALY ITALY Helsinki FSE/ESEC
13.2 Ribosomes & Protein Synthesis
13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the
History of DNA Sequencing & Current Applications
History of DNA Sequencing & Current Applications Christopher McLeod President & CEO, 454 Life Sciences, A Roche Company IMPORTANT NOTICE Intended Use Unless explicitly stated otherwise, all Roche Applied
PRACTICE TEST QUESTIONS
PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.
Error Tolerant Searching of Uninterpreted MS/MS Data
Error Tolerant Searching of Uninterpreted MS/MS Data 1 In any search of a large LC-MS/MS dataset 2 There are always a number of spectra which get poor scores, or even no match at all. 3 Sometimes, this
EPIGENETICS DNA and Histone Model
EPIGENETICS ABSTRACT A 3-D cut-and-paste model depicting how histone, acetyl and methyl molecules control access to DNA and affect gene expression. LOGISTICS TIME REQUIRED LEARNING OBJECTIVES DNA is coiled
Teacher Guide: Have Your DNA and Eat It Too ACTIVITY OVERVIEW. http://gslc.genetics.utah.edu
ACTIVITY OVERVIEW Abstract: Students build an edible model of DNA while learning basic DNA structure and the rules of base pairing. Module: The Basics and Beyond Prior Knowledge Needed: DNA contains heritable
