The world of non-coding RNA. Espen Enerly

Size: px
Start display at page:

Download "The world of non-coding RNA. Espen Enerly"

Transcription

1 The world of non-coding RNA Espen Enerly

2 ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations

3 Common for all ncrna Per def.: never translated Not spurious transcripts Always/often works together with proteins RNA-RNA, RNA, RNA-DNA and RNA-Protein Different mutational pattern than CDS

4 Non coding RNA genes Gene groups (today ): rrna trna snrna snorna Long mrna like ncrna Antisense (transcribed from same locus; cis-acting) mirna Other groups tncrna (tiny non coding RNA; mirna like) strna (small temporal RNA; early grouping of mirna) Riboregulators/sRNA/saRNA (bacteria; cis- and trans-acting) acting) sirna (processed RNA and not a gene group) Introns

5 RNA processing Mattick et al. 2003

6 Well known ncrna rrna ribosomal RNA: component of the ribosome trna - transfer RNA: Guides the adding of amino acids during translation snrna Component of the splicing complex

7 Small nucleolar RNA. rrna editing via complementary binding 2 groups different secondary structure Modify differently Function: Ribosome assembly and/or function! genes identified Eukaryotes and archaebacteria 1. H/ACA snorna 2. C/D box snorna

8 Long mrna like ncrna No ORF (no coding potential) Spliced Many well known, essential genes e.g XIST, X-chromosome inactivation ~20 kb cdna Non sequence specific function Regulated by an antisense (TSIX). Number of genes? Several thousands mouse cdna cluster lack coding potential Many remains to be discovered

9 Antisense Transcribed from the same locus on the opposite strand dsrna in nucleus Effect: A. Editing of sense transcript which prevents export) B. Local silencing and heterochromatin formation Retrotransposons Repetitive elements Common among imprinted genes >8% of the human genes contain antisense transcripts e.g. Air Antisense to a cluster of imprinted genes

10 MicroRNAs Definition of mirnas ~22 nt long Processed from Dicer Hairpin precursor Phylogenetic conservation RNase III enzymes Recognize dsrna e.g. Dicer, Drosha ++ proteins Drosha Dicer Lee et al., EMBO 2002 and Nature 2003

11 MicroRNAs (2) ~ human mirna genes (most of them identified) Most famous: Lin-4 and Let-7 Developmental regulators in C. elegans Target unknown in most situations Ambros, Cell 2001

12 RNA interference (RNAi) and small interfering RNA (sirna) RNA interference Mechanism/process/ method Degrades long double stranded RNA Dicer Used to generate KO Introduce long dsrna or sirna (~22 nt) Dicer Long dsrna sirna mirnp-risc McManus and Sharp, 2002 Target cleavage

13 RNA interference (RNAi) and small interfering RNA (sirna) RNA interference Mechanism/process method Degrades long double stranded RNA Dicer Used to generate KO Introduce long dsrna or sirna (~22 nt) Target recognition Plant/animal disparity PremiRNA Dicer Long dsrna sirna and mirna mirnp-risc Translational repression McManus and Sharp, 2002 Target cleavage

14 RNA interference (RNAi) and small interfering RNA (sirna) Secondary sirnas and Transitive RNAi RdRP (RNA dependent RNA Polymerase) Amplification Found in Neurospora, C. elegans, and Arabidopsis Not in Drosophila and human Random degradative PCR- model Therapeutic possibilities Delivery, delivery, delivery Specificity (!) Systemic response (spreading) Plants, C. elegans Design of sirna In silico prediction sirna cocktail Secondary sirnas, generated from the dsrna extended (orange) upstream of the primary target region (blue) by RdRP, promote transitive RNAi against their sequence homologous gene family members (A) or alternatively spliced mrnas (B). Nishikura, 2001

15 mirna examples Altered mirna metabolism = pleiotropic developmental defects Leaf morphogenesis in plants JAW locus encode a mirna Cleave TCP4 mrna and regulate the level of this transcript Bantam i Drosophila Mir-23 in human Scarecrow i Arabidopsis Hot topics Target identification Regulation of mirna Pre-miRNA Mature mirna mrna Wild type Mutant

16 Localization and organization? Localization Intergenic regions (Between protein coding genes) Intronic e.g. mirna, long ncrna, e.g. snorna,, mirna(!) Organization Individual e.g. long ncrna, mirna and snorna Polycistronic e.g. rrna, mirna, and snorna

17 Summary of the groups Gene groups (today ): snorna Long mrna like ncrna Antisense (transcribed from same locus; cis-acting) mirna Other groups tncrna (tiny non coding RNA; mirna like) strna (small temporal RNA; early grouping of mirna) Riboregulators/sRNA/saRNA (bacteria; cis- and trans-acting) acting) sirna (processed RNA from mirna, exogenous dsrna,, viral dsrna or antisense) Introns

18 Processes which involves ncrnas Protein synthesis (rrna/trna/snorna snorna) Splicing and alternative splicing (snrna/snorna( snrna/snorna/+) /+) Translational regulation (mirna) mrna stability (mirna/sirna) Virus protection Suggested to be the evolutionary origin of RNAi mrna export (antisense) Chromatin modification (antisense/sirna) Transposon control Genomic imprinting X-chromosome inactivation DNA methylation ++

19 Non-coding RNAs: The architects of eukaryotic complexity (John Mattick) The traditional view most genes encode proteins and these are sufficient in themselves to specify and organize the autopoietic programming of complex biological entities The new view (Mattick s( view) 1) A second tier of genetic output and a network of parallel RNA- mediated interactions has evolved in multi-cellular eukaryotes 2) Expansion of ncrna in higher organisms suggests that evolution of complexity may not only have been dependent on more proteins and protein isoforms 3) Alteration in the RNA control architecture is responsible for much of the phenotypic alteration between individuals and species 4) Much of this is hidden in the introns

20 Introns as ncrna 95 % of pre-mrnas are introns Traditional view: Rapidly degraded, only minor regulatory functions Some introns contain ncrnas (snorna, mirna) Some are stabile and exported to cytoplasm Conserved elements (5'-introns)

21 Why is it discovered first now? RNA isolation disfavor ncrnas Poly-A A extraction Small RNA discarded Gene identification programs are specialized for protein coding genes RNA interference (1998) Tool to generate knockouts Gene therapy

22 Q & A

23 Bioinformatics In silico ncrna gene identification In silico target identification Implication for network construction Many genes have dual output RNAs as a hidden layer of regulation Increasing interest for RNA structure prediction ++

24 Antisense Air

Outline. interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work?

Outline. interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work? Outline Outline interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work? What is RNA interference? Recently discovered regulatory level. Genome immune system.

More information

Micro RNAs: potentielle Biomarker für das. Blutspenderscreening

Micro RNAs: potentielle Biomarker für das. Blutspenderscreening Micro RNAs: potentielle Biomarker für das Blutspenderscreening micrornas - Background Types of RNA -Coding: messenger RNA (mrna) -Non-coding (examples): Ribosomal RNA (rrna) Transfer RNA (trna) Small nuclear

More information

Functional and Biomedical Aspects of Genome Research

Functional and Biomedical Aspects of Genome Research Functional and Biomedical Aspects of Genome Research 20 11 35 Vorlesung SS 04 Bartsch, Jockusch & Schmitt-John Mi. 9:15-10:00, in W7-135 13 Functional RNAs Thomas Schmitt-John micro RNAs small interfering

More information

Year 3 Pharm.D Dr. V. Chitra

Year 3 Pharm.D Dr. V. Chitra Year 3 Pharm.D Dr. V. Chitra RNA processing CENTRAL DOGMA DNA RNA PROTEIN DNA is the genetic material, located in the nucleus. mrna carries a faithful copy of a gene into the cytoplasm for protein synthesis.

More information

HOST DEFENSE AGAINST VIRUS INFECTION OF PLANTS Post transcriptional gene silencing (PTGS) or RNA interference (RNAi) represents a sequence specific

HOST DEFENSE AGAINST VIRUS INFECTION OF PLANTS Post transcriptional gene silencing (PTGS) or RNA interference (RNAi) represents a sequence specific HOST DEFENSE AGAINST VIRUS INFECTION OF PLANTS Post transcriptional gene silencing (PTGS) or RNA interference (RNAi) represents a sequence specific antiviral defense mechanism in plants. has parallels

More information

RNAi Shooting the Messenger!

RNAi Shooting the Messenger! RNAi Shooting the Messenger! Bronya Keats, Ph.D. Department of Genetics Louisiana State University Health Sciences Center New Orleans Email: bkeats@lsuhsc.edu RNA interference (RNAi) A mechanism by which

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

Functional RNAs; RNA catalysts, mirna,

Functional RNAs; RNA catalysts, mirna, Functional RNAs; RNA catalysts, mirna, srna, RNAi... RNAs have many functions rrna (ribosomal RNA) trna (transfer RNA) mrna (Messenger RNA) snrna (including snorna) ) (Small nuclear RNA- splicing) Other

More information

Regulation of Gene Expression

Regulation of Gene Expression Chapter 18 Regulation of Gene Expression PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from

More information

Five-year relative survival rates. Cancer. Age-adjusted cancer death rates. Proteomic Technologies for Cancer Biomarker Discovery 2010/3/22

Five-year relative survival rates. Cancer. Age-adjusted cancer death rates. Proteomic Technologies for Cancer Biomarker Discovery 2010/3/22 Cancer Five-year relative survival rates Basal lamina Underlyig tissue Normal tissue Carcinoma Invasive carcinoma 1 http://www.cancer.org/docroot/home/index.asp 2 Proteomic Technologies for Cancer Biomarker

More information

Protein Synthesis How Genes Become Constituent Molecules

Protein Synthesis How Genes Become Constituent Molecules Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

Bioinformatics: Network Analysis

Bioinformatics: Network Analysis Bioinformatics: Network Analysis Molecular Cell Biology: A Brief Review COMP 572 (BIOS 572 / BIOE 564) - Fall 2013 Luay Nakhleh, Rice University 1 The Tree of Life 2 Prokaryotic vs. Eukaryotic Cell Structure

More information

V22: involvement of micrornas in GRNs

V22: involvement of micrornas in GRNs What are micrornas? V22: involvement of micrornas in GRNs How can one identify micrornas? What is the function of micrornas? Elisa Izaurralde, MPI Tübingen Huntzinger, Izaurralde, Nat. Rev. Genet. 12,

More information

Transcription & Translation. Part of Protein Synthesis

Transcription & Translation. Part of Protein Synthesis Transcription & Translation Part of Protein Synthesis Three processes Initiation Transcription Elongation Termination Initiation The RNA polymerase binds to the DNA molecule upstream of the gene at the

More information

Transcription recap What is translation? Short Video Activity. Initiation Elongation Termination. Short Quiz on Thursday! 6.1 and 6.

Transcription recap What is translation? Short Video Activity. Initiation Elongation Termination. Short Quiz on Thursday! 6.1 and 6. Protein Synthesis Transcription recap What is translation? Initiation Elongation Termination Short Video Activity Short Quiz on Thursday! 6.1 and 6.2 1. RNA polymerase attaches to promoter region 2. Unwinds/unzips

More information

Gene Models & Bed format: What they represent.

Gene Models & Bed format: What they represent. GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,

More information

Controls Over Genes. Chapter 15

Controls Over Genes. Chapter 15 Controls Over Genes Chapter 15 Impacts, Issues: Between You and Eternity Mutations in some genes predispose individuals to develop certain kinds of cancer; mutations in BRAC genes cause breast cancer normal

More information

The vast majority of RNA functions are concerned with protein synthesis.

The vast majority of RNA functions are concerned with protein synthesis. RNA Structure, Function, and Synthesis RNA RNA differs from DNA in both structural and functional respects. RNA has two major structural differences: each of the ribose rings contains a 2 -hydroxyl, and

More information

13.4 Gene Regulation and Expression

13.4 Gene Regulation and Expression 13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

2013 W. H. Freeman and Company. 26 RNA Metabolism

2013 W. H. Freeman and Company. 26 RNA Metabolism 2013 W. H. Freeman and Company 26 RNA Metabolism CHAPTER 26 RNA Metabolism Key topics: Transcription: DNA-dependent synthesis of RNA Capping and splicing: RNA processing Overview of RNA Function Ribonucleic

More information

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed

More information

Control of Gene Expression

Control of Gene Expression Control of Gene Expression (Learning Objectives) Explain the role of gene expression is differentiation of function of cells which leads to the emergence of different tissues, organs, and organ systems

More information

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu. Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.au What is Gene Expression & Gene Regulation? 1. Gene Expression

More information

AP BIOLOGY 2009 SCORING GUIDELINES

AP BIOLOGY 2009 SCORING GUIDELINES AP BIOLOGY 2009 SCORING GUIDELINES Question 4 The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following

More information

Transcription Animations

Transcription Animations Transcription Animations Name: Lew Ports Biology Place http://www.lewport.wnyric.org/jwanamaker/animations/protein%20synthesis%20-%20long.html Protein is the making of proteins from the information found

More information

Outline. MicroRNA Bioinformatics. microrna biogenesis. short non-coding RNAs not considered in this lecture. ! Introduction

Outline. MicroRNA Bioinformatics. microrna biogenesis. short non-coding RNAs not considered in this lecture. ! Introduction Outline MicroRNA Bioinformatics Rickard Sandberg Dept. of Cell and Molecular Biology (CMB) Karolinska Institutet! Introduction! microrna target site prediction! Useful resources 2 short non-coding RNAs

More information

Basic Principles of Transcription and Translation

Basic Principles of Transcription and Translation The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific traits by dictating the synthesis of

More information

Lezioni Dipartimento di Oncologia Farmacologia Molecolare. RNA interference. Giovanna Damia 29 maggio 2006

Lezioni Dipartimento di Oncologia Farmacologia Molecolare. RNA interference. Giovanna Damia 29 maggio 2006 Lezioni Dipartimento di Oncologia Farmacologia Molecolare RNA interference Giovanna Damia 29 maggio 2006 RNA INTERFERENCE Sequence-specific gene suppression by dsrnas Gene silencing by dsrna: C. elegans

More information

srnas of Plants Small, Non-coding RNAs of Plants microrna ( mirnas small interfering RNA ( sirnas Plant mirnas MIR

srnas of Plants Small, Non-coding RNAs of Plants microrna ( mirnas small interfering RNA ( sirnas Plant mirnas MIR srnas of Plants Small, Non-coding RNAs of Plants Regulatory RNAs that act through gene silencing Two classes of small RNAs (srnas) o microrna (mirnas) Encoded by genes in the genome o small interfering

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

Chapter 17: From Gene to Protein

Chapter 17: From Gene to Protein Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master

More information

Control of Gene Expression

Control of Gene Expression Home Gene Regulation Is Necessary? Control of Gene Expression By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring

More information

Complementary Base Pairs: A and T. DNA contains complementary base pairs in which adenine is always linked by two hydrogen bonds to thymine (A T).

Complementary Base Pairs: A and T. DNA contains complementary base pairs in which adenine is always linked by two hydrogen bonds to thymine (A T). Complementary Base Pairs: A and T DNA contains complementary base pairs in which adenine is always linked by two hydrogen bonds to thymine (A T). Complementary Base Pairs: G and C DNA contains complementary

More information

Post-transcriptional control of gene expression

Post-transcriptional control of gene expression Post-transcriptional control of gene expression Possible post-transcriptional controls on gene expression Only a few of these controls are likely to be important for any one gene Mecanismo de processamento

More information

Complex multicellular organisms are produced by cells that switch genes on and off during development.

Complex multicellular organisms are produced by cells that switch genes on and off during development. Home Control of Gene Expression Gene Regulation Is Necessary? By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring

More information

Alternative Splicing in Higher Plants. Just Adding to Proteomic Diversity or an Additional Layer of Regulation?

Alternative Splicing in Higher Plants. Just Adding to Proteomic Diversity or an Additional Layer of Regulation? in Higher Plants Just Adding to Proteomic Diversity or an Additional Layer of Regulation? Alternative splicing is nearly ubiquitous in eukaryotes It has been found in plants, flies, worms, mammals, etc.

More information

AP Biology Review Packet 4: Viruses, Bacteria and Expression & DNA Technology

AP Biology Review Packet 4: Viruses, Bacteria and Expression & DNA Technology AP Biology Review Packet 4: Viruses, Bacteria and Expression & DNA Technology 3A1- DNA, and in some cases RNA, is the primary source of heritable information. 3B1- Gene Regulation results in differential

More information

Dicer Substrate RNAi Design

Dicer Substrate RNAi Design INTEGRATED DNA TECHNOLOGIES, INC. Dicer Substrate RNAi Design How to design and order 27-mer Dicer-substrate Duplex RNAs for use as RNA interference reagents The following document provides a summary of

More information

Control of Gene Expression

Control of Gene Expression Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure

More information

mirnaselect pep-mir Cloning and Expression Vector

mirnaselect pep-mir Cloning and Expression Vector Product Data Sheet mirnaselect pep-mir Cloning and Expression Vector CATALOG NUMBER: MIR-EXP-C STORAGE: -80ºC QUANTITY: 2 vectors; each contains 100 µl of bacterial glycerol stock Components 1. mirnaselect

More information

From Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

From Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp

More information

From DNA to Protein. Chapter 14

From DNA to Protein. Chapter 14 From DNA to Protein Chapter 14 Impacts, Issues: Ricin and your Ribosomes Ricin is toxic because it inactivates ribosomes, the organelles which assemble amino acids into proteins, critical to life processes

More information

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional

More information

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication Ch. 12: DNA and RNA 12.1 DNA A. To understand genetics, biologists had to learn the chemical makeup of the gene Genes are made of DNA DNA stores and transmits the genetic information from one generation

More information

Human Genome Complexity, Viruses & Genetic Variability

Human Genome Complexity, Viruses & Genetic Variability Human Genome Complexity, Viruses & Genetic Variability (Learning Objectives) Learn the types of DNA sequences present in the Human Genome other than genes coding for functional proteins. Review what you

More information

Profiling of non-coding RNA classes Gunter Meister

Profiling of non-coding RNA classes Gunter Meister Profiling of non-coding RNA classes Gunter Meister RNA Biology Regensburg University Universitätsstrasse 31 93053 Regensburg Overview Classes of non-coding RNAs Profiling strategies Validation Protein-RNA

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

OUTCOMES. PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation OVERVIEW ANIMATION CONTEXT RIBONUCLEIC ACID (RNA)

OUTCOMES. PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation OVERVIEW ANIMATION CONTEXT RIBONUCLEIC ACID (RNA) OUTCOMES PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation 3.5.1 Compare the structure of RNA and DNA. 3.5.2 Outline DNA transcription in terms of the formation of an RNA strand

More information

Chapter 10: Protein Synthesis. Biology

Chapter 10: Protein Synthesis. Biology Chapter 10: Protein Synthesis Biology Let s Review What are proteins? Chains of amino acids Some are enzymes Some are structural components of cells and tissues More Review What are ribosomes? Cell structures

More information

NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document.

NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document. Chapter 8 Study Guide What is the study of genetics, and what topics does it focus on? What is a genome? NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document. Describe

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams. Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.

More information

GENE REGULATION. Teacher Packet

GENE REGULATION. Teacher Packet AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures

More information

Yang-Ming University, 2009 microrna Biology and Application

Yang-Ming University, 2009 microrna Biology and Application Yang-Ming University, 2009 microrna Biology and Application 3/03 microrna biogenesis and functions Woan-Yuh Tarn 3/10 micrornas and development Woan- Yuh Tarn 3/17 micrornas and nervous system Jeng-Ya

More information

Genomics and Biotechnology

Genomics and Biotechnology Genomics and Biotechnology DNA structure Replication Gene expression Genome size Genome structure: Coding sequences Transposable elements Genome technologies: sequencing PCR DNA fingerprinting EST databases

More information

Cells and Their Housekeeping Functions Nucleus and Other Organelles

Cells and Their Housekeeping Functions Nucleus and Other Organelles Cells and Their Housekeeping Functions Nucleus and Other Organelles Shu-Ping Lin, Ph.D. Institute of Biomedical Engineering E-mail: splin@dragon.nchu.edu.tw Website: http://web.nchu.edu.tw/pweb/users/splin/

More information

The genetic code consists of a sequence of three letter "words" (called 'codons'), written one after another along the length of the DNA strand.

The genetic code consists of a sequence of three letter words (called 'codons'), written one after another along the length of the DNA strand. Review Questions Translation (protein synthesis) 1. What is the genetic code? The genetic code consists of a sequence of three letter "words" (called 'codons'), written one after another along the length

More information

Ingenious Genes Curriculum Links for AQA AS (7401) and A-Level Biology (7402)

Ingenious Genes Curriculum Links for AQA AS (7401) and A-Level Biology (7402) Ingenious Genes Curriculum Links for AQA AS (7401) and A-Level Biology (7402) 3.1.1 Monomers and Polymers 3.1.4 Proteins 3.1.5 Nucleic acids are important information-carrying molecules 3.2.1 Cell structure

More information

Gene Expression: From Gene to Protein

Gene Expression: From Gene to Protein What is a Gene? Beadle and Tatum Experiment (1941) Gene Expression: From Gene to Protein Neurospora crassa Strain Wild type (control) Mold growth arge mutant argf mutant No growth Growth on MM + Nothing

More information

CHAPTER 40 The Mechanism of Protein Synthesis

CHAPTER 40 The Mechanism of Protein Synthesis CHAPTER 40 The Mechanism of Protein Synthesis Problems: 2,3,6,7,9,13,14,15,18,19,20 Initiation: Locating the start codon. Elongation: Reading the codons (5 3 ) and synthesizing protein amino carboxyl.

More information

BINF6201/8201. Basics of Molecular Biology

BINF6201/8201. Basics of Molecular Biology BINF6201/8201 Basics of Molecular Biology 08-26-2016 Linear structure of nucleic acids Ø Nucleic acids are polymers of nucleotides Ø Nucleic acids Deoxyribonucleic acids (DNA) Ribonucleic acids (RNA) Phosphate

More information

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Molecular Genetics. RNA, Transcription, & Protein Synthesis Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and

More information

RNA: Transcription and Processing

RNA: Transcription and Processing 8 RNA: Transcription and Processing WORKING WITH THE FIGURES 1. In Figure 8-3, why are the arrows for genes 1 and 2 pointing in opposite directions? The arrows for genes 1 and 2 indicate the direction

More information

The Small RNA World (TTPB5) Teaching Guide

The Small RNA World (TTPB5) Teaching Guide The Plant Cell, May 2013, www.plantcell.org 2013 American Society of Plant Biologists The Small RNA World (TTPB5) Teaching Guide Overview Small RNAs confer specificity to a set of pathways collectively

More information

OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation

OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation -Optimal strategies to a successful mirna research project Optimal strategies to a successful mirna research

More information

GENE EXPRESSION Transcription (Video)

GENE EXPRESSION Transcription (Video) GENE EXPRESSION Is the process by which information from a gene is used in the synthesis of a functional gene product. These products are often proteins, but in non-protein coding genes such as rrna genes

More information

Chapter 18 Regulation of Gene Expression

Chapter 18 Regulation of Gene Expression Chapter 18 Regulation of Gene Expression 18.1. Gene Regulation Is Necessary By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection

More information

NUCLEIC ACIDS. An INTRODUCTION. Two classes of Nucleic Acids

NUCLEIC ACIDS. An INTRODUCTION. Two classes of Nucleic Acids NUCLEIC ACIDS An INTRODUCTION Two classes of Nucleic Acids Deoxynucleic Acids (DNA) Hereditary molecule of all cellular life Stores genetic information (encodes) Transmits genetic information Information

More information

13.2 Ribosomes & Protein Synthesis

13.2 Ribosomes & Protein Synthesis 13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).

More information

Micro 611(Molecular Virology) Dr. Nagwa Mohamed Amin Aref

Micro 611(Molecular Virology) Dr. Nagwa Mohamed Amin Aref Lecture Gene Structure, Transcription, & Translation Micro 611(Molecular Virology) Presented by Dr. Nagwa Mohamed Amin Aref TYPICAL GENE STRUCTURE Promoter Coding Region +1 transcription PROKARYOTES COORDINATED

More information

What makes cells different from each other? How do cells respond to information from environment?

What makes cells different from each other? How do cells respond to information from environment? What makes cells different from each other? How do cells respond to information from environment? Regulation of: - Transcription - prokaryotes - eukaryotes - mrna splicing - mrna localisation and translation

More information

Genetics Notes C. Molecular Genetics

Genetics Notes C. Molecular Genetics Genetics Notes C Molecular Genetics Vocabulary central dogma of molecular biology Chargaff's rules messenger RNA (mrna) ribosomal RNA (rrna) transfer RNA (trna) Your DNA, or deoxyribonucleic acid, contains

More information

Lecture 5. GENETICS OF PROKARYOTES

Lecture 5. GENETICS OF PROKARYOTES Lecture 5. GENETICS OF PROKARYOTES 1. Basic concepts 2. The prokaryotic genome 3. The pan-genome 4. Genetic interchange and recombination 4.1. Recombination 4.2. Transformation 4.3. Conjugation 4.4. Transduction

More information

THE ENZYMES. Department of Microbiology, Immunology, and Molecular Genetics, Molecular Biology Institute University of California

THE ENZYMES. Department of Microbiology, Immunology, and Molecular Genetics, Molecular Biology Institute University of California VOLUME THIRTY TWO THE ENZYMES Eukaryotic RNases and their Partners in RNA Degradation and Biogenesis, Part B Edited by FENG GUO Department of Biological Chemistry, David Geffen School of Medicine, Molecular

More information

RNA & Protein Synthesis

RNA & Protein Synthesis RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis

More information

Chapter 12 - DNA Technology

Chapter 12 - DNA Technology Bio 100 DNA Technology 1 Chapter 12 - DNA Technology Among bacteria, there are 3 mechanisms for transferring genes from one cell to another cell: transformation, transduction, and conjugation 1. Transformation

More information

The Steps. 1. Transcription. 2. Transferal. 3. Translation

The Steps. 1. Transcription. 2. Transferal. 3. Translation Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order

More information

Recombinant DNA and Biotechnology

Recombinant DNA and Biotechnology Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study

More information

Complexity in life, multicellular organisms and micrornas

Complexity in life, multicellular organisms and micrornas Complexity in life, multicellular organisms and micrornas Ohad Manor Abstract In this work I would like to discuss the question of defining complexity, and to focus specifically on the question of defining

More information

To be able to describe polypeptide synthesis including transcription and splicing

To be able to describe polypeptide synthesis including transcription and splicing Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain

More information

RNA Structure and folding

RNA Structure and folding RNA Structure and folding Overview: The main functional biomolecules in cells are polymers DNA, RNA and proteins For RNA and Proteins, the specific sequence of the polymer dictates its final structure

More information

Regulation of Gene Expression

Regulation of Gene Expression Chapter 18 Regulation of Gene Expression PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from

More information

From DNA to Protein! (Transcription & Translation)! I. An Overview

From DNA to Protein! (Transcription & Translation)! I. An Overview Protein Synthesis! From DNA to Protein! (Transcription & Translation)! I. An Overview A. Certain sequences of nucleotides in DNA [called genes], can be expressed/used as a code to determine the sequence

More information

From DNA to RNA RNA is different from DNA in three (at least significant ways). 1. Ribose verses deoxyribose

From DNA to RNA RNA is different from DNA in three (at least significant ways). 1. Ribose verses deoxyribose Chapter 7 From DNA to a Protein: Two overriding processes: 1. Transcription (to write again) DNA- to RNA (note: no change in language, all nucleic acids.) Fig. 7.1 2. Translation: RNA- protein (change

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

micrornas Contents Introduction

micrornas Contents Introduction micrornas Contents Introduction... 1 Structure and Function of mirnas... 2 Plant mirnas... 4 mirna Biosynthesis... 5 Evolution of mirnas... 6 Conclusions... 9 References and Resources... 9 Introduction

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

The microrna world: small is mighty

The microrna world: small is mighty 534 The microrna world: small is mighty Peter Nelson 1, Marianthi Kiriakidou 1,2, Anup Sharma 1, Elsa Maniataki 1 and Zissimos Mourelatos 1 1 Department of Pathology, University of Pennsylvania School

More information

Genetics. Chapter 9. Chromosome. Genes Three categories. Flow of Genetics/Information The Central Dogma. DNA RNA Protein

Genetics. Chapter 9. Chromosome. Genes Three categories. Flow of Genetics/Information The Central Dogma. DNA RNA Protein Chapter 9 Topics - Genetics - Flow of Genetics/Information - Regulation - Mutation - Recombination gene transfer Genetics Genome - the sum total of genetic information in a organism Genotype - the A's,

More information

Transcription Study Guide

Transcription Study Guide Transcription Study Guide This study guide is a written version of the material you have seen presented in the transcription unit. The cell s DNA contains the instructions for carrying out the work of

More information

1 Mutation and Genetic Change

1 Mutation and Genetic Change CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds

More information

Introduction to Genome Annotation

Introduction to Genome Annotation Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT

More information

Tools and Techniques. Chapter 10. Genetic Engineering. Restriction endonuclease. 1. Enzymes

Tools and Techniques. Chapter 10. Genetic Engineering. Restriction endonuclease. 1. Enzymes Chapter 10. Genetic Engineering Tools and Techniques 1. Enzymes 2. 3. Nucleic acid hybridization 4. Synthesizing DNA 5. Polymerase Chain Reaction 1 2 1. Enzymes Restriction endonuclease Ligase Reverse

More information

Molecular Biology of The Cell - An Introduction

Molecular Biology of The Cell - An Introduction Molecular Biology of The Cell - An Introduction Nguyen Phuong Thao School of Biotechnology International University Contents Three Domain of Life The Cell Eukaryotic Cell Prokaryotic Cell The Genome The

More information

SAM Teacher s Guide DNA to Proteins

SAM Teacher s Guide DNA to Proteins SAM Teacher s Guide DNA to Proteins Note: Answers to activity and homework questions are only included in the Teacher Guides available after registering for the SAM activities, and not in this sample version.

More information

Inducing RNAi in Mammalian Cells

Inducing RNAi in Mammalian Cells Inducing RNAi in Mammalian Cells Ambion, Inc. www.ambion.com techserv@ambion.com sirna localized to the perinuclear space View at: www.ambion.com/techlib/presentations Important Applications of RNAi Ascertain

More information