An Overview of DNA Sequencing

Size: px
Start display at page:

Download "An Overview of DNA Sequencing"

Transcription

1 An Overview of DNA Sequencing

2 Prokaryotic DNA Plasmid

3 Eukaryotic DNA

4 DNA Structure The two strands of a DNA molecule are held together by weak bonds (hydrogen bonds) between the nitrogenous bases, which are paired in the interior of the double helix. The two strands of DNA are antiparallel; they run in opposite directions. The carbon atoms of the deoxyribose sugars are numbered for orientation.

5 Sequencing DNA The goal of sequencing DNA is to tell the order of the bases, or nucleotides, that form the inside of the double-helix molecule. We can do this in one of two ways: Directed Sequencing Shotgun Sequencing

6 Directed Sequencing=Primer Walking Start with genome, gene, clone, PCR product Design a primer and sequence a certain segment of the genome, usually the beginning. From that sequence, design the next primer and sequence the next segment of the genome. Continue designing primers and sequencing until the genome is completed..

7 Shotgun Sequencing Start with a whole genome or a large piece of the DNA (a BAC). Shear the DNA into many different, random segments. Sequence each of the random segments. Then, put the pieces back together again in their original order.

8 Theory Behind Shotgun Sequencing Haemophilus influenzae 1.83 Mb base Coverage unsequenced (%) 1X 37% 2X 13% 5X 0.67% 6X X 0.09% Gaps Sequences For 1.83 Mb genome, 6X coverage is Mb of sequence, or 22,000 sequencing reactions, clones ( kb insert), 500 bp average read.

9 BAC based Projects BACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces of DNA that are 50 to 300 kilobases. To make copies of the DNA we insert the BAC into an E. coli cell. transform in E. coli and process each BAC as individual projects chromosome break into large pieces clone into BAC vector

10 Shotgun vs. Directed: Which is the better, more efficient method? With directed, sequences are done in order and there s no puzzle to put back together. Minimal computing power is required. Primers must be continually designed and purchased. If an area is difficult to sequence, you could get stuck. Shotgun sequencing takes less time; all the sequences can be done at about the same time. Minimal cost But, the pieces have to be assembled, a time-consuming process requiring extensive computational power.

11 Whole Genome Shotgun Sequencing 1.Library construction 2. Random Sequencing Phase 3. Closure Phase a. isolate DNA a. sequence DNA (15,000 sequences/ Mb) a. assemble sequences b. close gaps b. fragment DNA c. clone DNA GGG ACTGTTC... c. edit d. annotation 4. COMPLETE GENOME SEQUENCE

12 Library Construction Construct shotgun libraries of the genome or target DNA; sizes of inserts are varied; could be small (2-3 kb), medium (8-12 kb), or fosmid (30-40 kb) Start with multiple copies of purified DNA Shear the DNA using mechanical force, breaking it into smaller pieces DNA fragments are cloned into a plasmid vector to replicate the DNA; these fragments are called inserts

13 Library Construction Insert fragment DNA into a vector such as pbr322 Transform into E. coli cells and, using an antibiotic, select for cells that have a plasmid. The plasmids carry antibiotic resistant genes. When plated in the presence of an antibiotic, the cells without a plasmid die.

14 Isolation of the plasmid DNA Template Preparation Transformed E.coli is plated onto an agar plate. Every E. coli colony will contain plasmids with the same insert. Colonies are picked & transferred to liquid media where they multiply; use 384 well high throughput plates Plasmids are isolated and suspended in a buffer.

15 Template Production Laboratory Current Capacity: 22,000,000 plasmids/year

16 Sanger Sequencing Utilize dideoxy sequencing method of chain termination (Sanger) Each plasmid is reacted with a forward and reverse primer (2 reactions for each piece of DNA). Done in high throughput manner in 384 well plates

17 Sequencing reactions -Initial dideoxy sequencing involved use of radioactive datp and 4 separate reactions (ddatp, ddttp, ddctp, ddgtp) & separation on 4 separate lanes on an acrylamide gel with detection through autoradiogram -New techologies use 4 fluorescently labeled bases and separation on capillaries and detection through a CCD camera

18 DNA sequencing

19 R primer binds, synthesis Plasmid Structure Antibiotic resistance F primer binds, synthesis

20 Sequencing Machines The DNA fragments are loaded into capillaries in the sequencing machines. Polymer in the capillaries provides a matrix for separating the DNA fragments based on size. Separation of the fragments through a matrix is called electrophoresis.

21 Sequence Production Laboratory Current Capacity: 40,000,000 sequences/year

22 Data Collection A laser excites the fluorescent dyes. A camera detects the fluorescence. Data collection software collects the data. Capillary array view

23 Sequencing Machine Output AACTCATCGAATCCGTACGGG AACTCATCGAATCCGTACGG AACTCATCGAATCCGTACG AACTCATCGAATCCGTAC AACTCATCGAATCCGTA AACTCATCGAATCCGT AACTCATCGAATCCG AACTCATCGAATCC AACTCATCGAATC AACTCATCGAAT AACTCATCGAA AACTCATCGA AACTCATCG AACTCATC AACTCAT AACTCA AACTC AACT AAC AA A This is a diagram of just one lane. Reading from the bottom, where the fragment is only one base long, the fluorescent dye is an A. This is the first base in the sequence. Fluorescent Sequencing Gel Four colors, one lane per sample Fluorescent Sequencing Gel Each fragment differs by one nucleotide

24 Data Analysis An chromatogram is produced and the bases are called Software assign a quality value to each base Phred & TraceTuner Read DNA sequencer traces Call bases Assign base quality values Write basecalls and quality values to output files.

25 Assemble Fragments SEQUENCER OUTPUT AGCTAGGCTC ASSEMBLE FRAGMENTS CTAGCTAGCTAGGCTC AGCTCGCTAGCTA TAGCTAGC GCTAGCTAGCT AGCTAGC GCTAGCTAGC AGCTCGCTA TAGCTAGCTA CTCGCTAGCTAG AGCTCGCTAGCTAGCTAGCTAGCTAGGCTC GCTAGCTAGC AGCTCGCTAGCTA TAGCTAGC TAGCTAGCTA AGCTCGCTA GCTAGCTAGCT CTCGCTAGCTAG AGCTAGC CTAGCTAGCTAGGCTC AGCTAGGCTC CLOSURE & ANNOTATION

26 FRAGMENTS FROM SEQUENCING PROCESS CONSENSUS SEQUENCE

27 Closure Assemble the sequence files, relate them to each other, and close gaps Involves many computational programs to identify overlapping sequences, linkages between sequences Back to the lab for hard to close gaps

28 Complicating Factors A procedure that works well in one species may not produce the same results in even a closely related species. Each genome is uniquely different in its size and how it sequences and assembles New technologies must be developed to tackle the unique characteristics and properties of difficult genomes

29 Whole Genome Shotgun Sequencing: Modifying for Eukaryotes Not restricted to bacterial organisms Sequence eukaryotes: whole genome draft sequence; same approach as with bacteria chromosome by chromosome; sequence genome using large insert bacterial artificial chromosome (BAC) clones anchored to the chromosomes combination of whole genome and chromosome by chromosome

30 Whole Genome Draft Sequencing 1.Library construction 2. Random Sequencing Phase 3. Closure Phase a. isolate DNA a. sequence DNA (15,000 sequences/ Mb) a. assemble sequences b. close gaps b. fragment DNA c. clone DNA GGG ACTGTTC... c. edit d. annotation 4. COMPLETE GENOME SEQUENCE

31 Whole Genome Draft Sequencing 1.Library construction 2. Random Sequencing Phase 3. Closure Phase a. isolate DNA b. fragment DNA c. clone DNA a. sequence DNA (15,000 sequences/ Mb) GGG ACTGTTC... a. assemble sequences b. close gaps c. edit Advantages: Saves time and money (~50 %) Disadvantages: Incomplete sequence, contains errors d. annotation 4. COMPLETE GENOME SEQUENCE

32 454 Genome Sequencing System Library prep, amplification and sequencing: 2-4 days Single sample preparation from bacterial to human genomic DNA Single amplification per genome with no cloning or cloning artifacts Picoliter volume molecular biology 100 Mb per run (4-5 hr); less than $ 20,000 per run Read lengths bases Massively parallel imaging, fluidics and data analysis Requires high genome coverage for good assembly Error rate of 1-2%

33 454-Pyrosequencing Construct Single stranded adaptor liagated DNA Perform emulsion PCR Depositing DNA Beads into the PicoTiter Plate Sequencing by Synthesis: Simultaneous sequencing of the entire genome in hundreds of thousands of picoliter-size wells Pyrophosphate signal generation

34 Expressed Sequence Tags (ESTs): Sampling the Transcriptome and Genic Regions What is an EST? single pass sequence from cdna specific tissue, stage, environment, etc. cdna library in E.coli pick individual clones template prep T7 Insert in pbluescript T3 Multiple tissues, states.. with enough sequences, can ask quantitative questions

35 Uses of EST sequencing: -Gene discovery -Digital northerns/insights into transcriptome -Genome analyses, especially annotation of genomic DNA Issues with EST sequencing: -Inherent low quality due to single pass nature -Not 100 % full length cdna clones -Redundant sequencing of abundant transcripts Address through clustering/ assembly to build consensus sequences = Gene Index, Unigene Set, Transcript Assembly

36 EST Clustering All ESTs and mrnas from an organism Cluster and Assemble Set of clustered, assembled sequences= contigs, Transcript Assembly, Tentative Consensus, Unigene Sequences which do not cluster or assemble=singletons, singlets Single pass transcript Longer, more accurate sequence of the transcript

37 Web Links for Animation on Genome Sequencing Synthesis%20Demo&Cap=&PageName=solexa%20technolo gy&pageurl=203&media=1

38 From Fragments to Finished Genome Overview of Sequencing, Assembly, and Closure Processes

39

40 Genome Sequencing Process Library Construction Clone Picking Template Preparation Sequencing Reactions Electrophoresis and Base Calling rdna Molecules Genome Closure Order Contigs Close Gaps Identify Repeats Finish the Genome Annotation Genome Assembly

41 Sequence Requirements 1. Free vector should be at low or undetectable level. 2. No chimeric clones. Chimeras occur two or more random fragments from separate parts of the genome recombine and end up next to each other. 3. The majority of the inserts should be of relatively uniform size. 4. Libraries need to be random and cover the whole genome.

42 Basecalling & Quality Assignments Phred & TraceTuner Read DNA sequencer traces Call bases Assign base quality values Warner Brothers, Inc. Write basecalls and quality values to output files.

43 What are phred quality values? The quality value q assigned to a base call is defined as: q = - 10 x log 10 (p) where p is the estimated error probability for that base-call.

44 OR A base-call having a probability of 1/1000 of being incorrect is assigned a quality value of 30. Probability Quality Value 1/ /10 10

45

46 Assembling the fragments

47 Merging two sequences overlap (19 bases) overhang (6 bases) AGCCTAGACCTACAGGATGCGCGGACACGTAGCCAGGAC CAGTACTTGGATGCGCTGACACGTAGCTTATCCGGT overhang % identity = 18/19 % = 94.7% overlap - region of similarity between regions overhang - un-aligned ends of the sequences The assembler screens merges based on: length of overlap % identity in overlap region maximum overhang size.

48 TIGR Assembler Greedy Build a rough map of fragment overlaps Pick the largest scoring overlap Merge the two fragments Repeat until no more merges can be done

49 Forward-reverse constraints The sequenced ends are facing towards each other The distance between the two fragments is known (within certain experimental error) clone length F R sequenced ends

50 Scaffolding Given a set of non-overlapping contigs order and orient them along a chromosome II I III IV III II IV I

51 Clone-mates Insert F R I II R F Vector I II R F II I F R

52 Linking information Overlaps Mate-pair links Similarity links Physical markers Gene synteny reference genome physical map

53 Grouping the contigs

54 Assembly gaps physical gap group A group B sequencing gaps sequencing gap - we know the order and orientation of the contigs and have at least one clone spanning the gap physical gap - no information known about the adjacent contigs, nor about the DNA spanning the gap

55 Unifying view of assembly Assembly Scaffolding

56 Why Completeness is Important Improves characterization of genome features Gene order, replication origins Better comparative genomics Genome duplications, inversions Determination of presence and absence of particular genes and features is less subjective Missing sequence might be important (e.g., centromere) Allows researchers to focus on biology not sequencing Facilitates large scale correlation studies Controls for contamination

57 What Is Closure? Obtaining sequence that was not obtained during random sequencing which resulted in: Sequencing Gaps Physical Ends Confirming the integrity of assemblies Repeats and misassemblies Verification of Clone Coverage Confirming the base sequence of the consensus Editing Verification of Sequence Coverage

58 Sequence Validation: Sequence coverage 1X 2X 3X Sequence coverage rule: Every base in an assembly must be covered by at least two sequences of high quality. Why? Validating sequence coverage provides a high degree of confidence in the consensus base calls.

59 In this example there is an obvious discrepancy between the base calls of several of the underlying clones in this region. Sequence editor

60 Causes for gaps Non-random shotgun library Toxicity of genes or promoters in E. coli Genomic DNA difficult to clone (capsular polysaccharides) Unstable regions (low complexity) Sequencing problems Hard stops Secondary structures Very high or low GC content Small unit tandem repeats Loss of signal Homopolymeric tracts Very high or low GC content

61 Closure Challenges: Sequencing Through Secondary Structures

62 Hairpin structure

63 Homopolymeric tracts

64

65 Solutions Apply different sequencing chemistries Big-Dye terminator (default) Dye-primer dgtp mix (GC rich regions) Denature structures - Additives Betaine DMSO Break structure Restriction digest Transposon insertion Micro-libraries

66 Repetitive Areas Repetitive areas are regions of high similarity within the genome/bac. Sequences in these areas may be misassembled by the Assembler. Verification of the sequence of repetitive areas: A. Identify potential repetitive areas, using repeatfinder and other tools. B. Classify repeats based on length, copy number, % similarity, structure and complexity. C. If repeats are misassembled, transpose spanning clones or obtain PCR products and sequence to verify assembly.

67 Mis-assembled repeat Clones link different repeat flanks

68 Resolved Repeat Unique flank order is correct Use linking information across the repeat (large insert clones or PCR) Consensus sequence is correct Use linked clones that have one mate in the repeat and the other anchored in unique sequence Transposon mediated libraries

69 Fasta Format > GDRFE25TF CATTGAACACTAGGAGCCATAGAC (up to 60 bases per line) GTTCAACCGTTTAAGGCAAAACTTA AATTTTGGGCAGACTCTAGATCATG GGTAATACATACTCTGGGATTACGA

70 > GDRFE25TF CATTGAACACTAGGAGCCATAGACT (up to 60 bases per line) GTTCAACCGTTTAAGGCAAAACTTA AATTTTGGGCAGACTCTAGATCATG GGTAATACATACTCTGGGATTACGA > GDRFE45TF ACTGGTTCACATGGAGGGATAGTAC (up to 60 bases per line) GACACTCCGTAGCTGGCAATCCTTA GGCTCTCAATCGAGACTCTAGTTAC TCCAATATGGGCTCATGGAACAAGA > GDRFE67TF CATTGAACACTAGGAGCCATAGATC (up to 60 bases per line) AATGTGGCGTAGCTGCCACTTGGTA TACCGTCAATCGTATTGTCTAGTTAC GGGAGATAATATGGGCTCATATGGT > Multifasta Format

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites.

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites. 1. A recombinant DNA molecules is one that is a. produced through the process of crossing over that occurs in meiosis b. constructed from DNA from different sources c. constructed from novel combinations

More information

Introduction to next-generation sequencing data

Introduction to next-generation sequencing data Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS

More information

restriction enzymes 350 Home R. Ward: Spring 2001

restriction enzymes 350 Home R. Ward: Spring 2001 restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually

More information

Genome Sequence Quality. When looking at sequence: Caveat emptor

Genome Sequence Quality. When looking at sequence: Caveat emptor When looking at sequence: Caveat emptor Caveat emptor A phrase in Latin. It is a commonly cited axiom or principle in commerce that the buyer alone is responsible for assessing the quality of a purchase

More information

DNA Sequencing Dr. Serageldeen A. A. Sultan

DNA Sequencing Dr. Serageldeen A. A. Sultan DNA Sequencing Dr. Serageldeen A. A. Sultan PhD in Molecular virology Yamaguchi University, Japan (2010) Lecturer of virology Dept. of Microbiology SVU, Qena, Egypt seaas@lycos.com What is DNA sequencing?

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977

More information

eculab MolecuLab 45 DNA Sequencing - A Classroom Exercise Student Manual 950 Walnut Ridge Drive Hartland, WI 53029-9388 USA

eculab MolecuLab 45 DNA Sequencing - A Classroom Exercise Student Manual 950 Walnut Ridge Drive Hartland, WI 53029-9388 USA Mo eculab DNA Sequencing - A Classroom Exercise Student Manual 950 Walnut Ridge Drive Hartland, WI 53029-9388 USA Revision 11/2011 Student Manual BACKGROUND DNA sequencing technology was developed in the

More information

PLNT2530 Unit 6e DNA Sequencing

PLNT2530 Unit 6e DNA Sequencing PLNT2530 Unit 6e DNA Sequencing Unless otherwise cited or referenced, all content of this presenataion is licensed under the Creative Commons License Attribution Share-Alike 2.5 Canada 1 High-throughput

More information

DNA Sequence Analysis

DNA Sequence Analysis DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide

More information

Sanger Sequencing. Troubleshooting Guide. Failed sequence

Sanger Sequencing. Troubleshooting Guide. Failed sequence Sanger Sequencing Troubleshooting Guide Below are examples of the main problems experienced in ABI Sanger sequencing. Possible causes for failure and their solutions are listed below each example. The

More information

BIOTECHNOLOGY. What can we do with DNA?

BIOTECHNOLOGY. What can we do with DNA? BIOTECHNOLOGY What can we do with DNA? Biotechnology Manipulation of biological organisms or their components for research and industrial purpose Usually manipulate DNA itself How to study individual gene?

More information

Chapter 20: Biotechnology: DNA Technology & Genomics

Chapter 20: Biotechnology: DNA Technology & Genomics Biotechnology Chapter 20: Biotechnology: DNA Technology & Genomics The BIG Questions How can we use our knowledge of DNA to: o Diagnose disease or defect? o Cure disease or defect? o Change/improve organisms?

More information

Dye-Blob message: Example: Generally, this is due to incomplete excess dye removal of the cycle sequence reaction.

Dye-Blob message: Example: Generally, this is due to incomplete excess dye removal of the cycle sequence reaction. When sequence data is uploaded to ilab, an email is sent notifying the user that data is ready. The staff of the DNA facility has the ability to edit this message to include specific remarks about how

More information

1/12 Dideoxy DNA Sequencing

1/12 Dideoxy DNA Sequencing 1/12 Dideoxy DNA Sequencing Dideoxy DNA sequencing utilizes two steps: PCR (polymerase chain reaction) amplification of DNA using dideoxy nucleoside triphosphates (Figures 1 and 2)and denaturing polyacrylamide

More information

July 7th 2009 DNA sequencing

July 7th 2009 DNA sequencing July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer

More information

Description: Molecular Biology Services and DNA Sequencing

Description: Molecular Biology Services and DNA Sequencing Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter

More information

Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne

Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne Sanger Sequencing and Quality Assurance Zbigniew Rudzki Department of Pathology University of Melbourne Sanger DNA sequencing The era of DNA sequencing essentially started with the publication of the enzymatic

More information

How is genome sequencing done?

How is genome sequencing done? How is genome sequencing done? Using 454 Sequencing on the Genome Sequencer FLX System, DNA from a genome is converted into sequence data through four primary steps: Step One DNA sample preparation; Step

More information

Biotechnology and Recombinant DNA

Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Recombinant DNA procedures - an overview Biotechnology: The use of microorganisms, cells, or cell components to make a product. Foods, antibiotics, vitamins, enzymes Recombinant

More information

DNA Sequencing Troubleshooting Guide

DNA Sequencing Troubleshooting Guide DNA Sequencing Troubleshooting Guide Successful DNA Sequencing Read Peaks are well formed and separated with good quality scores. There is a small area at the beginning of the run before the chemistry

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

PCR Polymerase Chain Reaction

PCR Polymerase Chain Reaction Biological Sciences Initiative HHMI PCR Polymerase Chain Reaction PCR is an extremely powerful technique used to amplify any specific piece of DNA of interest. The DNA of interest is selectively amplified

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the

More information

Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website

Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website Biomolecular Core Facility AI Dupont Hospital for Children, Rockland Center One, Room 214 Core: (302) 651-6712, Office: (302) 651-6707, mbcore@nemours.org Katia Sol-Church, Ph.D., Director Jennifer Frenck

More information

DNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE

DNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE DNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE We recommend for the sequence visualization the use of software that allows the examination of raw data in order to determine quantitatively how good has

More information

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Chapter 9 Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Q&A Interferons are species specific, so that interferons to be used in humans must be produced in human cells. Can you think

More information

Biotechnology: DNA Technology & Genomics

Biotechnology: DNA Technology & Genomics Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What

More information

- In 1976 1977, Allan Maxam and walter Gilbert devised the first method for sequencing DNA fragments containing up to ~ 500 nucleotides.

- In 1976 1977, Allan Maxam and walter Gilbert devised the first method for sequencing DNA fragments containing up to ~ 500 nucleotides. DNA Sequencing - DNA sequencing includes several methods and technologies that are used for determining the order of the nucleotide bases adenine, guanine, cytosine, and thymine in a molecule of DNA. -

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing DNA sequence represents a single format onto which a broad range of biological phenomena can be projected for high-throughput data collection Over the past three years, massively

More information

The Techniques of Molecular Biology: Forensic DNA Fingerprinting

The Techniques of Molecular Biology: Forensic DNA Fingerprinting Revised Fall 2011 The Techniques of Molecular Biology: Forensic DNA Fingerprinting The techniques of molecular biology are used to manipulate the structure and function of molecules such as DNA and proteins

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period Chapter 20: Biotechnology The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

AP BIOLOGY 2007 SCORING GUIDELINES

AP BIOLOGY 2007 SCORING GUIDELINES AP BIOLOGY 2007 SCORING GUIDELINES Question 4 A bacterial plasmid is 100 kb in length. The plasmid DNA was digested to completion with two restriction enzymes in three separate treatments: EcoRI, HaeIII,

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

Concepts and methods in sequencing and genome assembly

Concepts and methods in sequencing and genome assembly BCM-2004 Concepts and methods in sequencing and genome assembly B. Franz LANG, Département de Biochimie Bureau: H307-15 Courrier électronique: Franz.Lang@Umontreal.ca Outline 1. Concepts in DNA and RNA

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise: HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone

More information

Introduction. Preparation of Template DNA

Introduction. Preparation of Template DNA Procedures and Recommendations for DNA Sequencing at the Plant-Microbe Genomics Facility Ohio State University Biological Sciences Building Room 420, 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204;

More information

CUSTOM DNA SEQUENCING SERVICES

CUSTOM DNA SEQUENCING SERVICES CUSTOM DNA SEQUENCING SERVICES Satisfied Customers are our Driving Force We never stop exceeding your Expectations Value Read Service Single read sequencing of plasmid inserts or PCR products in tube and

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

Biotechnology Test Test

Biotechnology Test Test Log In Sign Up Biotechnology Test Test 15 Matching Questions Regenerate Test 1. Plasmid 2. PCR Process 3. humulin 4. pluripotent 5. polymerase chain reaction (PCR) a b Is much smaller than the human genome,

More information

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS

More information

The Biotechnology Education Company

The Biotechnology Education Company EDVTEK P.. Box 1232 West Bethesda, MD 20827-1232 The Biotechnology 106 EDV-Kit # Principles of DNA Sequencing Experiment bjective: The objective of this experiment is to develop an understanding of DNA

More information

STANDARD 2 Students will demonstrate appropriate safety procedures and equipment use in the laboratory.

STANDARD 2 Students will demonstrate appropriate safety procedures and equipment use in the laboratory. BIOTECHNOLOGY Levels: 11-12 Units of Credit: 1.0 CIP Code: 51.1201 Prerequisite: Biology or Chemistry Skill Certificates: #708 COURSE DESCRIPTION is an exploratory course designed to create an awareness

More information

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot Recombinant technology Gene analysis Sequencing PCR RNA Northern-blot RT PCR Protein Western-blot Sequencing Southern-blot in situ hybridization in situ hybridization Function analysis Histochemical analysis

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

Expression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu

Expression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu Expression and Purification of Recombinant Protein in bacteria and Yeast Presented By: Puspa pandey, Mohit sachdeva & Ming yu DNA Vectors Molecular carriers which carry fragments of DNA into host cell.

More information

DNA Sequencing Overview

DNA Sequencing Overview DNA Sequencing Overview DNA sequencing involves the determination of the sequence of nucleotides in a sample of DNA. It is presently conducted using a modified PCR reaction where both normal and labeled

More information

Next Generation Sequencing: Technology, Mapping, and Analysis

Next Generation Sequencing: Technology, Mapping, and Analysis Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took

More information

Welcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation.

Welcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation. Introduction to SMRTbell Template Preparation 100 338 500 01 1. SMRTbell Template Preparation 1.1 Introduction to SMRTbell Template Preparation Welcome to Pacific Biosciences' Introduction to SMRTbell

More information

Name Class Date. KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. frameshift mutation

Name Class Date. KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. frameshift mutation Unit 7 Study Guide Section 8.7: Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. VOCABULARY mutation point mutation frameshift mutation mutagen MAIN IDEA: Some mutations

More information

Troubleshooting Sequencing Data

Troubleshooting Sequencing Data Troubleshooting Sequencing Data Troubleshooting Sequencing Data No recognizable sequence (see page 7-10) Insufficient Quantitate the DNA. Increase the amount of DNA in the sequencing reactions. See page

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

Genetics Module B, Anchor 3

Genetics Module B, Anchor 3 Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for

More information

DNA Replication Activity Guide

DNA Replication Activity Guide DNA Replication Activity Guide Teacher Key Deoxyribonucleic Acid (DNA) Exploring DNA 1. List at least three reasons why a cell must undergo division. Answers may vary but may include: growth, repair, reproduction,

More information

Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes

Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes 2.1 Introduction Large-scale insertional mutagenesis screening in

More information

Recombinant DNA and Biotechnology

Recombinant DNA and Biotechnology Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study

More information

Recombinant DNA Unit Exam

Recombinant DNA Unit Exam Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium

More information

AP BIOLOGY 2009 SCORING GUIDELINES (Form B)

AP BIOLOGY 2009 SCORING GUIDELINES (Form B) AP BIOLOGY 2009 SCORING GUIDELINES (Form B) Question 1 Describe how a plasmid can be genetically modified to include a piece of foreign DNA that alters the phenotype of bacterial cells transformed with

More information

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,

More information

A Brief Guide to Interpreting the DNA Sequencing Electropherogram Version 3.0

A Brief Guide to Interpreting the DNA Sequencing Electropherogram Version 3.0 A Brief Guide to Interpreting the DNA Sequencing Electropherogram Version 3.0 Plant-Microbe Genomics Facility The Ohio State University 484 W.12 th Ave., Columbus, OH 43210 Ph: 614/247-6204 FAX: 614/247-8696

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov

More information

Gene Cloning and DNA Analysis: An Introduction

Gene Cloning and DNA Analysis: An Introduction Gene Cloning and DNA Analysis: An Introduction Brown, Terry A. ISBN-13: 9781405111218 Table of Contents PART 1 THE BASIC PRINCIPLES OF GENE CLONING AND DNA ANALYSIS. Chapter 1 Why Gene Cloning and DNA

More information

DNA Sequencing & The Human Genome Project

DNA Sequencing & The Human Genome Project DNA Sequencing & The Human Genome Project An Endeavor Revolutionizing Modern Biology Jutta Marzillier, Ph.D Lehigh University Biological Sciences November 13 th, 2013 Guess, who turned 60 earlier this

More information

RESTRICTION DIGESTS Based on a handout originally available at

RESTRICTION DIGESTS Based on a handout originally available at RESTRICTION DIGESTS Based on a handout originally available at http://genome.wustl.edu/overview/rst_digest_handout_20050127/restrictiondigest_jan2005.html What is a restriction digests? Cloned DNA is cut

More information

Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.

Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question. Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists

More information

Procedures For DNA Sequencing

Procedures For DNA Sequencing Procedures For DNA Sequencing Plant-Microbe Genomics Facility (PMGF) Ohio State University 420 Biological Sciences Building 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204 FAX: 614/292-6337

More information

How Sequencing Experiments Fail

How Sequencing Experiments Fail How Sequencing Experiments Fail v1.0 Simon Andrews simon.andrews@babraham.ac.uk Classes of Failure Technical Tracking Library Contamination Biological Interpretation Something went wrong with a machine

More information

GFP Transformation Genetic Manipulations

GFP Transformation Genetic Manipulations MODULE 2 Objective 2.1 Lesson E GFP Transformation Genetic Manipulations Course Advanced Biotechnology Unit DNA Technology Essential Question How is foreign DNA genes taken up by organisms and expressed?

More information

European Medicines Agency

European Medicines Agency European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein

More information

DNA Core Facility: DNA Sequencing Guide

DNA Core Facility: DNA Sequencing Guide DNA Core Facility: DNA Sequencing Guide University of Missouri-Columbia 216 Life Sciences Center Columbia, MO 65211 http://biotech.missouri.edu/dnacore/ Table of Contents 1. Evaluating Sequencing Data..

More information

1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.

1. Molecular computation uses molecules to represent information and molecular processes to implement information processing. Chapter IV Molecular Computation These lecture notes are exclusively for the use of students in Prof. MacLennan s Unconventional Computation course. c 2013, B. J. MacLennan, EECS, University of Tennessee,

More information

Primer walking: Custom primers designed to be complementary to the known sequence can be used to extend the DNA sequence iteratively from the distal

Primer walking: Custom primers designed to be complementary to the known sequence can be used to extend the DNA sequence iteratively from the distal Primer walking: Custom primers designed to be complementary to the known sequence can be used to extend the DNA sequence iteratively from the distal ends of known regions into unknown regions of the same

More information

DNA & Protein Synthesis Exam

DNA & Protein Synthesis Exam DNA & Protein Synthesis Exam DO NOT WRITE ON EXAM EXAM # VER. B Multiple choice Directions: Answer the following questions based on the following diagram. (1pt. each) 5. The above nucleotide is purine

More information

DNA Sequencing Setup and Troubleshooting

DNA Sequencing Setup and Troubleshooting DNA Sequencing Setup and Troubleshooting Lara Cullen, PhD Scientific Applications Specialist Australia and New Zealand Reviewing Sequencing Data Review the Electropherogram Review the Raw Data (Signal

More information

Data Analysis for Ion Torrent Sequencing

Data Analysis for Ion Torrent Sequencing IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page

More information

Recipient Cell. DNA Foreign DNA. Recombinant DNA

Recipient Cell. DNA Foreign DNA. Recombinant DNA Module 4B Biotechnology In this module, we will examine some of the techniques scientists have developed to study and manipulate the DNA of living organisms. Objective # 7 Explain what genetic recombination

More information

New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova

New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova New generation sequencing: current limits and future perspectives Giorgio Valle CRIBI Università di Padova Around 2004 the Race for the 1000$ Genome started A few questions... When? How? Why? Standard

More information

Genomics Services @ GENterprise

Genomics Services @ GENterprise Genomics Services @ GENterprise since 1998 Mainz University spin-off privately financed 6-10 employees since 2006 Genomics Services @ GENterprise Sequencing Service (Sanger/3730, 454) Genome Projects (Bacteria,

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information

Universidade Estadual de Maringá

Universidade Estadual de Maringá Universidade Estadual de Maringá Disciplina: Biologia Molecular Sequenciamento de ácidos nucléicos Profa. Dra. Maria Aparecida Fernandez Maxan e Gilbert - quebra química Berg, Gilbert and Sanger dideoxinucleotideos

More information

Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms

Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Introduction Mate pair sequencing enables the generation of libraries with insert sizes in the range of several kilobases (Kb).

More information

Every time a cell divides the genome must be duplicated and passed on to the offspring. That is:

Every time a cell divides the genome must be duplicated and passed on to the offspring. That is: DNA Every time a cell divides the genome must be duplicated and passed on to the offspring. That is: Original molecule yields 2 molecules following DNA replication. Our topic in this section is how is

More information

Lecture 36: Basics of DNA Cloning-II

Lecture 36: Basics of DNA Cloning-II Lecture 36: Basics of DNA Cloning-II Note: Before starting this lecture students should have completed Lecture 35 Sequential steps involved in DNA cloning using plasmid DNA as vector: Molecular cloning

More information

Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing

Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAAC GTGCAC GTGAAC Wouter Coppieters Head of the genomics core facility GIGA center, University of Liège Bioruptor NGS: Unbiased DNA

More information

DNA Scissors: Introduction to Restriction Enzymes

DNA Scissors: Introduction to Restriction Enzymes DNA Scissors: Introduction to Restriction Enzymes Objectives At the end of this activity, students should be able to 1. Describe a typical restriction site as a 4- or 6-base- pair palindrome; 2. Describe

More information

Genome Sequencing. Phil McClean September, 2005

Genome Sequencing. Phil McClean September, 2005 Genome Sequencing Phil McClean September, 2005 The concept of genome sequencing is quite simple. Break your genome up into many different small fragments, clone those fragments into a cloning vector, isolate

More information

STRUCTURES OF NUCLEIC ACIDS

STRUCTURES OF NUCLEIC ACIDS CHAPTER 2 STRUCTURES OF NUCLEIC ACIDS What is the chemical structure of a deoxyribonucleic acid (DNA) molecule? DNA is a polymer of deoxyribonucleotides. All nucleic acids consist of nucleotides as building

More information

AP Biology Review Packet 4: Viruses, Bacteria and Expression & DNA Technology

AP Biology Review Packet 4: Viruses, Bacteria and Expression & DNA Technology AP Biology Review Packet 4: Viruses, Bacteria and Expression & DNA Technology 3A1- DNA, and in some cases RNA, is the primary source of heritable information. 3B1- Gene Regulation results in differential

More information

Reading DNA Sequences:

Reading DNA Sequences: Reading DNA Sequences: 18-th Century Mathematics for 21-st Century Technology Michael Waterman University of Southern California Tsinghua University DNA Genetic information of an organism Double helix,

More information

Sequencing a Genome: Inside the Washington University Genome Sequencing Center. Activity Supplement Paper PCR (DNA Amplification)

Sequencing a Genome: Inside the Washington University Genome Sequencing Center. Activity Supplement Paper PCR (DNA Amplification) Sequencing a Genome: Inside the Washington University Genome Sequencing Center Activity Supplement (DNA Amplification) Project Outline The multimedia project Sequencing a Genome: Inside the Washington

More information

Cloning of genes from genomic DNA: Part 3-Restriction Enzyme Digestion and Agarose Gel Electrophoresis

Cloning of genes from genomic DNA: Part 3-Restriction Enzyme Digestion and Agarose Gel Electrophoresis Cloning of genes from genomic DNA: Part 3-Restriction Enzyme Digestion and Agarose Gel Electrophoresis Continuing from our isolation of genomic DNA and PCR amplification of either the evenskipped gene

More information

Illumina Sequencing Technology

Illumina Sequencing Technology Illumina Sequencing Technology Highest data accuracy, simple workflow, and a broad range of applications. Introduction Figure 1: Illumina Flow Cell Illumina sequencing technology leverages clonal array

More information