Next Generation Sequencing: Technology, Mapping, and Analysis

Save this PDF as:

Size: px
Start display at page:

Download "Next Generation Sequencing: Technology, Mapping, and Analysis"


1 Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University


3 The Human Genome Project took 10 years and cost roughly $3,000,000,000 by 2001.

4 The Human Genome Project took 10 years and cost roughly $3,000,000,000 by But, we had only one, maybe two, versions of the human genome, therefore, little data for a comprehensive, systematic study of human genetic diversity.

5 The Human Genome Project took 10 years and cost roughly $3,000,000,000 by But, we had only one, maybe two, versions of the human genome, therefore, little data for a comprehensive, systematic study of human genetic diversity. My lab has data from 2 whole human genomes, stored on a hard drive. Each cost roughly $40,000 (in 2010). Today (2013) sequencing a genome costs $5000 $10,000.

6 Outline Next Generation Sequencing Technologies Algorithms for Mapping Reads Detecting Structural Variants Visualization Software

7 Why Sequence DNA? DNA is the molecule of genetic inheritance. Sequencing data provide a fundamental basis for understanding the biology of an organism. The data allow comprehensive comparisons of organisms on a genomic level to find regions of similarity, difference, and functional significance.

8 Why Sequence DNA? The data allow us to understand Human variation on a molecular level, for example, the genetic differences between tumor and normal tissue. This will hopefully lead to more specific medical treatments (personalized medicine).

9 Current Experimental Methods That Use Sequencing RNA Seq Measurement of gene expression in a tissue by counting the number of RNA fragments sequenced from each gene. Also used for alternative splicing detection. ChIP Seq (Chromatin Immunoprecipitation) Identification of protein binding sites on DNA by determining where DNA fragments bound to a specific protein map onto the genome.

10 Current Experimental Methods That Use Sequencing Genome sequencing allows us to detect SNPs (single nucleotide polymorphisms) and structural variations among individuals: within a population, from different populations

11 Next Generation Sequencing Technologies Current Illumina Genome Analyzer Roche 454 Applied Biosystems Solid Future Ion Torrent Pacific Biosciences RS

12 Sanger Sequencing

13 Sanger vs NGS technology Next-generation DNA sequencing by Jay Shendure and Hanlee Ji, Nature Biotechnology 26, (2008), doi: /nbt1486

14 Sanger vs NGS technology $/.50 per kilobase Next-generation DNA sequencing by Jay Shendure and Hanlee Ji, Nature Biotechnology 26, (2008), doi: /nbt1486 $/ 1.50 per megabase

15 Emulsion and bridge amplification Next-generation DNA sequencing by Jay Shendure and Hanlee Ji, Nature Biotechnology 26, (2008), doi: /nbt1486

16 Illumina sequencing technology

17 Illumina sequencing technology

18 Illumina sequencing technology

19 Video of Illumina Sequencing

20 SOLiD and 454 technologies Sequencing technologies the next generation by Michael L. Metzker Nature Reviews Genetics 11, 31-46, doi: /nrg2626

21 Most Common Error Types: 454 vs Illumina Roche/454 Illumina/Solexa Lower overall error

22 Next Generation Sequencing Data These technologies generate millions to billions of short DNA reads sampled from a whole DNA genome, targeted genetic regions, or transcribed RNA. Length: nt (Illumina) nt (454)


24 Mapping Reads the Problem Given 100+ million reads from an experiment, for each: 1. find the genomic coordinates, chromosome and first base, where it has the best match in a reference genome, either with the forward or reverse strand. 2. best match means zero or a small number of differences with the reference. 3. differences include mismatches and indels. 4. determine if it has multiple matches or none at all.

25 Algorithms for Read Mapping

26 Structural Variants Structural variants are any rearrangements of the genome relative to a reference. They include: insertions/deletions inversions translocations tandem repeat variations Many can be detected with paired end or mate pair reads.

27 Paired-Ends and Mate-Pairs Accurate whole human genome sequencing using reversible terminator chemistry, David Bentley et al., Nature 456, 53-59, doi: /nature07517

28 Mate-pairs vs paired-ends Detection of large indels requires large insert sizes. Current Illumina technology allows for paired-end insert sizes very close to 250 bp, which, depending on coverage, allows for detection of small and medium-size indels only. Mate-pair libraries allow for generation of large inserts at the expense of more insert-size variability.

29 Normally Mapped Reads 1 2 paired reads sequenced fragment (insert) Subject A B C Reference 1 2 A B C mapped reads Apparent insert size in the normally expected range.

30 Deletion 1 2 paired reads sequenced fragment (insert) Subject A C Reference 1 2 A B C mapped reads

31 Deletion 1 2 Subject A C 1 2 Reference A B C Apparent insert size longer than expected indicating deletion of B.

32 Insertion 1 2 Subject A B C 1 2 Reference A C

33 Insertion 1 2 Subject A B C 1 2 Reference A C Apparent insert size shorter than expected indicating insertion of B.

34 Distribution to determine unusually long or short apparent insert length Insertions Deletions

35 Singletons A singleton is a read which maps, but whose pair does not map. Possible causes: 1. Split read 2. Novel insertion

36 Singleton Split Read 1 2 Subject A C Reference A B C Parts of read 2 map to two locations. It is split. Some mapping programs cannot detect the split mapping.

37 Singleton Split Read 1 2 Subject A C 1 Reference A B C Only one read mapped Parts of read 2 map to two locations. It is split. Some mapping programs cannot detect the split mapping.

38 Homozygous deletion Bentley, et al, Nature 456, (6 November 2008) doi: /nature07517 ;

39 Bentley, et al, Nature 456, (6 November 2008) doi: /nature07517 ; Gap Heterozygous deletion No gap

40 Inversion 1 3 prime 5 prime Reference A B C D E F G H 5 prime 3 prime

41 Inversion 2 B C D E F G 3 prime 5 prime Reference A H 5 prime 3 prime

42 Inversion 3 B C D E F G 3 prime 5 prime Reference A H 5 prime 3 prime

43 Inversion 4 3 prime B C D E F G 5 prime Reference A H 5 prime 3 prime

44 Inversion 5 B C D E F G 3 prime 5 prime Reference A H 5 prime 3 prime

45 Inversion 6 G F E D C B 3 prime 5 prime Reference A H 5 prime 3 prime

46 Inversion 7 Subject 3 prime A G F E D C B 5 prime H 5 prime 3 prime

47 Inversion Subject A G F E D C B H Reference A B C D E F G H

48 Inversion Subject A G F E D C B H Reference A B C D E F G H Paired reads map in the same direction and are farther apart than expected

49 Inversion Subject A G F E D C B H Reference A B C D E F G H Paired reads map in the same direction and are farther apart than expected

50 Inversion Subject A G F E D C B H Reference A B C D E F G H A split read will generally go undetected.

51 Inversion Subject A G F E D C B H 2 1 Reference A B C D E F G H An insert entirely contained in the inversion will look normal, although the positions are swapped.

52 Bentley, et al, Nature 456, (6 November 2008) doi: /nature07517 ; Homozygous inversion Red is pair mapped in the same direction

53 Breakpoints of an Inversion No normally mapped reads span the breakpoints.

54 Tandem Repeat Variants or VNTRs (Variable Number of Tandem Repeats)

55 Tandem Repeat tcgctggtcata cgt cgt cgt cgt cgt tacaaacgtcttccgt

56 Tandem Repeat tcgctggtcata cgt cgt cgt cgt cgt tacaaacgtcttccgt left flank sequence tandem array of copies right flank sequence

57 Tandem Repeat left flank sequence tandem array of copies right flank sequence consensus sequence multiple alignment


59 Tandem Repeat Variants Tandem Repeat polymorphisms occur as differences in: copy number individual copy motifs (SNPs/indels) order of motifs in the tandem array

60 Why are Tandem Repeat Variants Important? They are associated with human disease: Triple repeat diseases Fragile X mental retardation Myotonic dystrophy Huntington s disease Friedreich s ataxia Epilepsy Diabetes Ovarian cancer They co occur with transcription factor binding sites and so may be involved in gene regulation.

61 Why is detecting variants difficult? Read mapping in the presence of large indels (copy number difference) is computationally costly.

62 Why is detecting variants difficult? Read mapping in the presence of large indels (copy number difference) is computationally costly. Motif differences (indels and SNPs) and motif order differences are additional complications for both seed indexing and BWT/Suffix Array matching approaches.

63 Why is detecting variants difficult? Read mapping in the presence of large indels (copy number difference) is computationally costly. Motif differences (indels and SNPs) and motif order differences are additional complications for both seed indexing and BWT/Suffix Array matching approaches. Mapping and indel detection is typically oblivious to sequence annotation.

64 Outline of Strategy 1. Detect repeats in the subject and in the human reference using TRF software. 2. Map read TRs to reference TRs using: indexing of reference patterns fast bit wise edit distance with threshold profile alignment of TR arrays flanking sequence alignment (bit wise) 3. Compare copy number of reference TRs with those of mapped read TRs and identify variants

65 Subject data comes from the Watson genome. 454 technology: 74 million reads, avg. length 261 nt. avg. coverage ~6

66 Reference tandem repeats come from the Tandem Repeats Database (TRDB).

67 Reference tandem repeats come from the Tandem Repeats Database (TRDB) ,671

68 VNTR 1 copy shorter (heterozygous?)

69 VNTR 2 copies shorter

70 VNTR 1 copy longer

71 VNTR 2 alleles observed

72 VNTR 2 copies shorter

73 VNTR and SNP alleles

74 VNTR internal motif duplicated and flanking SNPs

75 VNTR Results Watson Genome

76 Khoisan Genome African Hunter Gatherer Culture nominal 12.3 coverage

77 Acknowledgments Yevgeniy Gelfand Yozen Hernandez Joshua Loving

78 Thank you!

New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova

New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova New generation sequencing: current limits and future perspectives Giorgio Valle CRIBI Università di Padova Around 2004 the Race for the 1000$ Genome started A few questions... When? How? Why? Standard

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977

More information

Introduction to NGS data analysis

Introduction to NGS data analysis Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High

More information

Next Gen Sequencing Summary of the short course Next Gen Sequencing at Avans hogeschool, Breda. 24/04/2013 Next gen Sequencing technologies

Next Gen Sequencing Summary of the short course Next Gen Sequencing at Avans hogeschool, Breda. 24/04/2013 Next gen Sequencing technologies Next Gen Sequencing Summary of the short course Next Gen Sequencing at Avans hogeschool, Breda 24/04/2013 Next gen Sequencing technologies 1 2nd Gen Sequencing Summary of the short course Next Gen Sequencing

More information

Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe

Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. To published results faster With proven scalability To the forefront of discovery To limitless applications

More information

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing

More information

An example of bioinformatics application on plant breeding projects in Rijk Zwaan

An example of bioinformatics application on plant breeding projects in Rijk Zwaan An example of bioinformatics application on plant breeding projects in Rijk Zwaan Xiangyu Rao 17-08-2012 Introduction of RZ Rijk Zwaan is active worldwide as a vegetable breeding company that focuses on

More information

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1 CAP 5510-8 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Genomic Mapping & Mapping Databases High resolution, genome-wide maps of DNA markers. Integrated maps, genome catalogs and comprehensive

More information

Next Generation Sequencing I: Technologies. Jim Noonan Department of Genetics

Next Generation Sequencing I: Technologies. Jim Noonan Department of Genetics Next Generation Sequencing I: Technologies Jim Noonan Department of Genetics Sequence as the readout for biological processes Determining the biological state of cells, tissues and organisms requires the

More information

Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling

Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling Lectures 1 and 8 15 February 7, 2013 This is a review of the material from lectures 1 and 8 14. Note that the material from lecture 15 is not relevant for the final exam. Today we will go over the material

More information

Computational Genomics. Next generation sequencing (NGS)

Computational Genomics. Next generation sequencing (NGS) Computational Genomics Next generation sequencing (NGS) Sequencing technology defies Moore s law Nature Methods 2011 Log 10 (price) Sequencing the Human Genome 2001: Human Genome Project 2.7G$, 11 years

More information


INTRODUCTION TO NGS VARIANT CALLING ANALYSIS Hospital Universitari Vall d Hebron Institut de Recerca - VHIR Institut d Investigació Sanitària de l Instituto de Salud Carlos III (ISCIII) INTRODUCTION TO NGS VARIANT CALLING ANALYSIS Bioinformàtica

More information

Focusing on results not data comprehensive data analysis for targeted next generation sequencing

Focusing on results not data comprehensive data analysis for targeted next generation sequencing Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes

More information

Next generation DNA sequencing technologies. theory & prac-ce

Next generation DNA sequencing technologies. theory & prac-ce Next generation DNA sequencing technologies theory & prac-ce Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing

More information

Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office

Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office 2013 Laboratory Accreditation Program Audioconferences and Webinars Implementing Next Generation Sequencing (NGS) as a Clinical Tool in the Laboratory Nazneen Aziz, PhD Director, Molecular Medicine Transformation

More information

Introduction to next-generation sequencing data

Introduction to next-generation sequencing data Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast Outline History of DNA sequencing NGS

More information

DNA Sequencing & The Human Genome Project

DNA Sequencing & The Human Genome Project DNA Sequencing & The Human Genome Project An Endeavor Revolutionizing Modern Biology Jutta Marzillier, Ph.D Lehigh University Biological Sciences November 13 th, 2013 Guess, who turned 60 earlier this

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Gene mutation and molecular medicine Chapter 15

Gene mutation and molecular medicine Chapter 15 Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to

More information

Data Analysis for Ion Torrent Sequencing

Data Analysis for Ion Torrent Sequencing IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

School of Nursing. Presented by Yvette Conley, PhD

School of Nursing. Presented by Yvette Conley, PhD Presented by Yvette Conley, PhD What we will cover during this webcast: Briefly discuss the approaches introduced in the paper: Genome Sequencing Genome Wide Association Studies Epigenomics Gene Expression

More information

PLNT2530 Unit 6e DNA Sequencing

PLNT2530 Unit 6e DNA Sequencing PLNT2530 Unit 6e DNA Sequencing Unless otherwise cited or referenced, all content of this presenataion is licensed under the Creative Commons License Attribution Share-Alike 2.5 Canada 1 High-throughput

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Matthew D. Clark PhD Group leader Genomics, The Genome Analysis Centre Norwich, UK Costs & disrup,ve technologies 454 & polony Solexa & SOLiD End of the gold rush? GAII HiSeq

More information


G E N OM I C S S E RV I C ES GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E

More information

Nature of Genetic Material. Nature of Genetic Material

Nature of Genetic Material. Nature of Genetic Material Core Category Nature of Genetic Material Nature of Genetic Material Core Concepts in Genetics (in bold)/example Learning Objectives How is DNA organized? Describe the types of DNA regions that do not encode

More information

Fishing for variants in the deep end of the gene pool: OGT s custom bait designs

Fishing for variants in the deep end of the gene pool: OGT s custom bait designs Fishing for variants in the deep end of the gene pool: OGT s custom bait designs Jolyon Holdstock, Simon Hughes and Daniel Swan Abstract Oxford Gene Technology (OGT) has extensive expertise in probe design

More information

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each

More information


COURSE OF BIOINFORMATICS COURSE OF BIOINFORMATICS a.a. 2015-2016 Bioinformatic Analysis of Next Generation Sequencing Data What is massively parallel sequencing? Next-generation sequencing (NGS), also known as high-throughput

More information

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer From the Dolan DNA Learning Center Cold

More information

mygenomatix - secure cloud for NGS analysis

mygenomatix - secure cloud for NGS analysis mygenomatix Speed. Quality. Results. mygenomatix - secure cloud for NGS analysis background information & contents 2011 Genomatix Software GmbH Bayerstr. 85a 80335 Munich Germany

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

Targeted. sequencing solutions. Accurate, scalable, fast TARGETED

Targeted. sequencing solutions. Accurate, scalable, fast TARGETED Targeted TARGETED Sequencing sequencing solutions Accurate, scalable, fast Sequencing for every lab, every budget, every application Ion Torrent semiconductor sequencing Ion Torrent technology has pioneered

More information

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University Egypt Interpretation of sequence results An overview on

More information

Genomes and SNPs in Malaria and Sickle Cell Anemia

Genomes and SNPs in Malaria and Sickle Cell Anemia Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing

More information

Ion Torrent Amplicon Sequencing

Ion Torrent Amplicon Sequencing APPLICATION NOTE Amplicon Sequencing Ion Torrent Amplicon Sequencing Introduction The ability to sequence a genome or a portion of a genome has enabled researchers to begin to understand how the genetic

More information

Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment

Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249

More information

14.3 Studying the Human Genome

14.3 Studying the Human Genome 14.3 Studying the Human Genome Lesson Objectives Summarize the methods of DNA analysis. State the goals of the Human Genome Project and explain what we have learned so far. Lesson Summary Manipulating

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

Genetic diagnostics the gateway to personalized medicine

Genetic diagnostics the gateway to personalized medicine Micronova 20.11.2012 Genetic diagnostics the gateway to personalized medicine Kristiina Assoc. professor, Director of Genetic Department HUSLAB, Helsinki University Central Hospital The Human Genome Packed

More information

escience and Post-Genome Biomedical Research

escience and Post-Genome Biomedical Research escience and Post-Genome Biomedical Research Thomas L. Casavant, Adam P. DeLuca Departments of Biomedical Engineering, Electrical Engineering and Ophthalmology Coordinated Laboratory for Computational

More information

Organization and analysis of NGS variations. Alireza Hadj Khodabakhshi Research Investigator

Organization and analysis of NGS variations. Alireza Hadj Khodabakhshi Research Investigator Organization and analysis of NGS variations. Alireza Hadj Khodabakhshi Research Investigator Why is the NGS data processing a big challenge? Computation cannot keep up with the Biology. Source: illumina

More information

Towards Integrating the Detection of Genetic Variants into an In-Memory Database

Towards Integrating the Detection of Genetic Variants into an In-Memory Database Towards Integrating the Detection of Genetic Variants into an 2nd International Workshop on Big Data in Bioinformatics and Healthcare Oct 27, 2014 Motivation Genome Data Analysis Process DNA Sample Base

More information

Automated DNA sequencing 20/12/2009. Next Generation Sequencing

Automated DNA sequencing 20/12/2009. Next Generation Sequencing DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing

More information

Biological Sciences Initiative. Human Genome

Biological Sciences Initiative. Human Genome Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.

More information

Lecture 3: Mutations

Lecture 3: Mutations Lecture 3: Mutations Recall that the flow of information within a cell involves the transcription of DNA to mrna and the translation of mrna to protein. Recall also, that the flow of information between

More information

Analysis of gene expression data. Ulf Leser and Philippe Thomas

Analysis of gene expression data. Ulf Leser and Philippe Thomas Analysis of gene expression data Ulf Leser and Philippe Thomas This Lecture Protein synthesis Microarray Idea Technologies Applications Problems Quality control Normalization Analysis next week! Ulf Leser:

More information

Core Facility Genomics

Core Facility Genomics Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray

More information

Lecture 38: DNA Fingerprinting

Lecture 38: DNA Fingerprinting Lecture 38: DNA Fingerprinting (DNA technology) The most awesome and powerful tool acquired by man since the splitting of atoms - The Time Magazine (USA) Conventional fingerprint of an individual comes

More information

Personal Genome Sequencing with Complete Genomics Technology. Maido Remm

Personal Genome Sequencing with Complete Genomics Technology. Maido Remm Personal Genome Sequencing with Complete Genomics Technology Maido Remm 11 th Oct 2010 Three related papers 1. Describing the Complete Genomics technology Drmanac et al., Science 1 January 2010: Vol. 327.

More information

12/6/12. Dr. Sanjeeva Srivastava. IIT Bombay 2. Genomics Transcriptomics Why proteomics? Proteomics Course NPTEL

12/6/12. Dr. Sanjeeva Srivastava. IIT Bombay 2. Genomics Transcriptomics Why proteomics? Proteomics Course NPTEL Dr. Sanjeeva Srivastava IIT Bombay Genomics Transcriptomics Why proteomics? IIT Bombay 2 1 IIT Bombay 3 Genome: The entire sequence of an organism s hereditary information, including both coding and non-coding

More information

Next Generation Sequencing for Invertebrate Virus Discovery

Next Generation Sequencing for Invertebrate Virus Discovery Next Generation Sequencing for Invertebrate Virus Discovery -a practical approach Sijun Liu & Bryony C. Bonning Iowa State University, USA 8-14-2013 SIP Pittsburgh Outline Introduction: Why use NGS? Traditional

More information

Next Gen Sequencing Technologies. 454 SOLiD Illumina (Used to be Solexa)

Next Gen Sequencing Technologies. 454 SOLiD Illumina (Used to be Solexa) Next Gen Sequencing Technologies 454 SOLiD Illumina (Used to be Solexa) Sequencing by synthesis (SBS): 454 pyrosequencing Metzker, Nat. Rev Genetics. 2010 Margulies et al. 2005, Nature 400-500bp reads,

More information

Lecture 5 Mutation and Genetic Variation

Lecture 5 Mutation and Genetic Variation 1 Lecture 5 Mutation and Genetic Variation I. Review of DNA structure and function you should already know this. A. The Central Dogma DNA mrna Protein where the mistakes are made. 1. Some definitions based

More information

Innovations in Molecular Epidemiology

Innovations in Molecular Epidemiology Innovations in Molecular Epidemiology Molecular Epidemiology Measure current rates of active transmission Determine whether recurrent tuberculosis is attributable to exogenous reinfection Determine whether

More information


MUTATION, DNA REPAIR AND CANCER MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful

More information

Single-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples

Single-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples DATA Sheet Single-Cell DNA Sequencing with the C 1 Single-Cell Auto Prep System Reveal hidden populations and genetic diversity within complex samples Single-cell sensitivity Discover and detect SNPs,

More information

DNA Insertions and Deletions in the Human Genome. Philipp W. Messer

DNA Insertions and Deletions in the Human Genome. Philipp W. Messer DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Molecular Methods Sylvain Forêt March 2010 1 Introduction 2 Sanger 3 Illumina 4 454 5 SOLiD 6 Summary The Genomic Age Recent landmarks

More information

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication Ch. 12: DNA and RNA 12.1 DNA A. To understand genetics, biologists had to learn the chemical makeup of the gene Genes are made of DNA DNA stores and transmits the genetic information from one generation

More information

Next generation sequencing (NGS)

Next generation sequencing (NGS) Next generation sequencing (NGS) Vijayachitra Modhukur BIIT 1 Bioinformatics course 11/13/12 Sequencing 2 Bioinformatics course 11/13/12 Microarrays vs NGS Sequences do not need to be known

More information

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,

More information

Assuring the Quality of Next-Generation Sequencing in Clinical Laboratory Practice. Supplementary Guidelines

Assuring the Quality of Next-Generation Sequencing in Clinical Laboratory Practice. Supplementary Guidelines Assuring the Quality of Next-Generation Sequencing in Clinical Laboratory Practice Next-generation Sequencing: Standardization of Clinical Testing (Nex-StoCT) Workgroup Principles and Guidelines Supplementary

More information

SNP Essentials The same SNP story

SNP Essentials The same SNP story HOW SNPS HELP RESEARCHERS FIND THE GENETIC CAUSES OF DISEASE SNP Essentials One of the findings of the Human Genome Project is that the DNA of any two people, all 3.1 billion molecules of it, is more than

More information

Human Genome Organization: An Update. Genome Organization: An Update

Human Genome Organization: An Update. Genome Organization: An Update Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion

More information

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur

More information

1 Mutation and Genetic Change

1 Mutation and Genetic Change CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds

More information

The Human Genome Project

The Human Genome Project The Human Genome Project Brief History of the Human Genome Project Physical Chromosome Maps Genetic (or Linkage) Maps DNA Markers Sequencing and Annotating Genomic DNA What Have We learned from the HGP?

More information

BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls?

BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? Giovanni Luca Scaglione, PhD ------------------------ Laboratory of Clinical Molecular Diagnostics and Personalized Medicine, Institute

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just

More information

Challenges associated with analysis and storage of NGS data

Challenges associated with analysis and storage of NGS data Challenges associated with analysis and storage of NGS data Gabriella Rustici Research and training coordinator Functional Genomics Group Next-generation sequencing Next-generation sequencing

More information

An Overview of DNA Sequencing

An Overview of DNA Sequencing An Overview of DNA Sequencing Prokaryotic DNA Plasmid Eukaryotic DNA DNA Structure

More information

Intro to Bioinformatics

Intro to Bioinformatics Intro to Bioinformatics Marylyn D Ritchie, PhD Professor, Biochemistry and Molecular Biology Director, Center for Systems Genomics The Pennsylvania State University Sarah A Pendergrass, PhD Research Associate

More information

Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data

Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data The Illumina TopHat Alignment and Cufflinks Assembly and Differential Expression apps make RNA data analysis accessible to any user, regardless

More information

Analysis of NGS Data

Analysis of NGS Data Analysis of NGS Data Introduction and Basics Folie: 1 Overview of Analysis Workflow Images Basecalling Sequences denovo - Sequencing Assembly Annotation Resequencing Alignments Comparison to reference

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708

More information

Module 1. Sequence Formats and Retrieval. Charles Steward

Module 1. Sequence Formats and Retrieval. Charles Steward The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.

More information

DNA Sequencing: The Past, the Present and the Future

DNA Sequencing: The Past, the Present and the Future STARS Mini-Symposium 9/12/2016 DNA Sequencing: The Past, the Present and the Future Ralf Kittler, Ph.D. McDermott Center for Human Growth and Development Outline DNA sequencing

More information


SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE AP Biology Date SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE LEARNING OBJECTIVES Students will gain an appreciation of the physical effects of sickle cell anemia, its prevalence in the population,

More information

Sequencing and microarrays for genome analysis: complementary rather than competing?

Sequencing and microarrays for genome analysis: complementary rather than competing? Sequencing and microarrays for genome analysis: complementary rather than competing? Simon Hughes, Richard Capper, Sandra Lam and Nicole Sparkes Introduction The human genome is comprised of more than

More information

Bio-Informatics Lectures. A Short Introduction

Bio-Informatics Lectures. A Short Introduction Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively

More information

Simplifying Data Interpretation with Nexus Copy Number

Simplifying Data Interpretation with Nexus Copy Number Simplifying Data Interpretation with Nexus Copy Number A WHITE PAPER FROM BIODISCOVERY, INC. Rapid technological advancements, such as high-density acgh and SNP arrays as well as next-generation sequencing

More information

Name Class Date. KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. frameshift mutation

Name Class Date. KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. frameshift mutation Unit 7 Study Guide Section 8.7: Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. VOCABULARY mutation point mutation frameshift mutation mutagen MAIN IDEA: Some mutations

More information

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research March 17, 2011 Rendez-Vous Séquençage Presentation Overview Core Technology Review Sequence Enrichment Application

More information

Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms

Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Introduction Mate pair sequencing enables the generation of libraries with insert sizes in the range of several kilobases (Kb).

More information

Cancer Genomics: What Does It Mean for You?

Cancer Genomics: What Does It Mean for You? Cancer Genomics: What Does It Mean for You? The Connection Between Cancer and DNA One person dies from cancer each minute in the United States. That s 1,500 deaths each day. As the population ages, this

More information

History of DNA Sequencing & Current Applications

History of DNA Sequencing & Current Applications History of DNA Sequencing & Current Applications Christopher McLeod President & CEO, 454 Life Sciences, A Roche Company IMPORTANT NOTICE Intended Use Unless explicitly stated otherwise, all Roche Applied

More information

Molecular typing of VTEC: from PFGE to NGS-based phylogeny

Molecular typing of VTEC: from PFGE to NGS-based phylogeny Molecular typing of VTEC: from PFGE to NGS-based phylogeny Valeria Michelacci 10th Annual Workshop of the National Reference Laboratories for E. coli in the EU Rome, November 5 th 2015 Molecular typing

More information

8/7/2012. Experimental Design & Intro to NGS Data Analysis. Examples. Agenda. Shoe Example. Breast Cancer Example. Rat Example (Experimental Design)

8/7/2012. Experimental Design & Intro to NGS Data Analysis. Examples. Agenda. Shoe Example. Breast Cancer Example. Rat Example (Experimental Design) Experimental Design & Intro to NGS Data Analysis Ryan Peters Field Application Specialist Partek, Incorporated Agenda Experimental Design Examples ANOVA What assays are possible? NGS Analytical Process

More information

Structural Variations

Structural Variations Analysis of Structural Variants using 3 rd generation Sequencing Michael Schatz Analysis of Structural Variants using 3 rd generation Sequencing Michael Schatz January 12, 2016 Bioinformatics / PAG XXIV

More information

Bioinformatics in next generation sequencing projects

Bioinformatics in next generation sequencing projects Once sequenced the problem becomes computational Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet

More information

LifeScope Genomic Analysis Software 2.5

LifeScope Genomic Analysis Software 2.5 USER GUIDE LifeScope Genomic Analysis Software 2.5 Graphical User Interface DATA ANALYSIS METHODS AND INTERPRETATION Publication Part Number 4471877 Rev. A Revision Date November 2011 For Research Use

More information

Visualization with the Integrative Genomics Viewer (IGV)

Visualization with the Integrative Genomics Viewer (IGV) Ecole de Bioinformatique Aviesan - Integrative Genomics Viewer (IGV) 1 Visualization with the Integrative Genomics Viewer (IGV) Elodie Girard Institut Curie U900 Inserm Mines ParisTech Ecole de Bioinformatique

More information

SEQUENCING. From Sample to Sequence-Ready

SEQUENCING. From Sample to Sequence-Ready SEQUENCING From Sample to Sequence-Ready ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES, NOT ONCE, BUT EVERY TIME The highest-quality amplicons more sensitive, accurate, and specific Full support for all major

More information

3 rd Generation Sequencing Technologies. Roger E. Bumgarner

3 rd Generation Sequencing Technologies. Roger E. Bumgarner 3 rd Generation Sequencing Technologies Roger E. Bumgarner Brief review First generation sequencing technologies Sanger and Maxim Gilbert methods Used either chemical or enzymatic methods

More information



More information

RNAseq / ChipSeq / Methylseq and personalized genomics

RNAseq / ChipSeq / Methylseq and personalized genomics RNAseq / ChipSeq / Methylseq and personalized genomics 7711 Lecture Subhajyo) De, PhD Division of Biomedical Informa)cs and Personalized Biomedicine, Department of Medicine University of Colorado School

More information


SOLUTIONS FOR NEXT-GENERATION SEQUENCING SOLUTIONS FOR NEXT-GENERATION SEQUENCING GENOMICS CELL BIOLOGY PROTEOMICS AUTOMATION enabling next-generation research From Samples To Publication, Millennium Science Enables Your Next-Gen Sequencing Workflow

More information

Umm AL Qura University MUTATIONS. Dr Neda M Bogari

Umm AL Qura University MUTATIONS. Dr Neda M Bogari Umm AL Qura University MUTATIONS Dr Neda M Bogari CONTACTS From DNA to Mutations MUTATION Definition: Permanent change in nucleotide sequence. It can

More information