DNA sequencing via transverse transport: possibilities and fundamental issues
|
|
- Estella Shaw
- 8 years ago
- Views:
Transcription
1 DNA sequencing via transverse transport: possibilities and fundamental issues Massimiliano Di Ventra Department of Physics, University of California, San Diego M. Zwolak and M. Di Ventra, Physical approaches to DNA sequencing and detection, Rev. Mod. Phys. 80, 141 (2008). Group Matt Krems Yoni Dubi H. Appel S. La Fontaine Former Members Johan Lagerqvist (London) Mike Zwolak (LANL) Yuriy Pershin (USC) Roberto D Agosta (Spain) Neil Bushong (NC) Na Sai (U. Texas, Austin) Tony Schindler (UNM) John Gamble (Wooster) Yu-Chang Chen (Chiao Tung U.) Zhongqin Yang (Fudan Univ.) Mairbek Chshiev (UA)
2 Outline Sequencing via transverse transport Quantum transport + Molecular Dynamics
3 A primer on DNA Backbone Adenine Thymine Cytosine Guanine Humans ~ 3 Billion base pairs
4 Idea: ionic current in nanopores Driven by biased electrodes, DNA can be analyzed as it translocates a nanopore Kasianowicz et al Proc. Natl. Acad. Sci Pore α-hemolysin nanopore Mathe, et al. PNAS 2005
5 Idea: Transverse Transport e - E r STM Formed Nanoelectrodes 2-nm width A C T G Microchannels Voltage Biased translocaton DNA AFM Formed Channel (1-5-nm width and length) -A-C-T-G- FIB Milled Channels (10-50-nm width) Microchannels E r (a) Ramsey et al., unpublished M. Zwolak and M. Di Ventra, Nano Lett. 5, 421 (2005)
6 Transverse Transport G I ( E) = E H DNA 1 Σ t Σ 2e = det t b E h ( E) [ f ( E) f ( )] Use ratio of currents as a measure of their difference b M. Zwolak and M. Di Ventra, Nano Lett. 5, 421 (2005)
7 Transverse Transport (static) Electrode Surface Single Nucleotides 10 3 T I A /I X 10 2 C G Voltage (V) M. Zwolak and M. Di Ventra, Nano Lett. 5, 421 (2005)
8 Transverse Transport (static) Single Nucleotides 10 3 T I A /I X 10 2 C G Voltage (V) M. Zwolak and M. Di Ventra, Nano Lett. 5, 421 (2005)
9 Transverse Transport (static) (static) Nearest neighbors Electrode size ~ 1 nm
10 Transverse Transport (static)
11 Transverse Transport (static) (static) What about variations of orientation?
12 Transverse Transport (static) (static) Consider 6 different changes: Electrode Surface Translations: x y z Rotations: x y z
13 Transverse Transport (static) (static) Variations of orientation Electrode Surface I A /I X T G C
14 Noise Thermal noise: i th k = 4 T f R V= 1 V; I= 1 na; f= 10 khz i th = 0.4 pa B Electronic Noise Shot noise: i shot < i th 1/f noise: operate at f > 0 Structural noise
15 Experimental Pores Use 4 probes to collect more info (not necessary though) 5 µm Fujimori, et al. Nanotech nm
16 Molecular Dynamics Thousands of atoms Full quantum mechanical treatment not possible NAMD, UIUC
17 Molecular Dynamics Inner diameter 12.5 Å Outer diameter 25 Å Potassium chloride concentration 1M Room Temperature E Top view 12.5 Å 25 Å pore
18 Molecular Dynamics Adenine
19 Molecular Dynamics Adenine E r Field effects: Bending Stretching
20 Transverse Transport (dynamics) J. Lagerqvist, M. Zwolak, and M. Di Ventra, Nano Letters 2006
21 Transverse Transport (dynamics)
22 Transverse Transport (dynamics) 15 bases
23 Transverse Transport (dynamics)
24 Driving electric field As the field strength increases, the minimum diameter can be decreased r r Decreasing field, bases bend less E << E E r E r 0.2x electric field
25 Controlling the dynamics E r J. Lagerqvist, M. Zwolak, and M. Di Ventra, Nano Letters 2006
26 Current Distributions Accuracy 99.9 % 10 7 measurements/ s Genome seq. time < 7 hours No parallelization Error J. Lagerqvist, M. Zwolak, and M. Di Ventra, Nano Letters 2006 N n PX X n= 1 = 1 P = N N N N { I } X = A, T, C, G 4 n n n n PA + PT + PC + n= 1 n= 1 n= 1 n= 1 P n G
27 1 Volt, 12.5 Å spacing Current distributions Lagerqvist et al., Nano Lett. 2006
28 1 Volt, 12.5 Å spacing Current distributions Large bias, risk of electrolysis even though not obvious at nano scale Lagerqvist et al., Nano Lett. 2006
29 Current distributions 1 V 0.1 V Lagerqvist et al., Nano Lett Lagerqvist et al., BioPhys. J. 2007
30 Stabilizing field Adenine, 15 Å spacing Stabilizing field helps increase the conductance Lagerqvist et al., BJ 2007
31 Finite bandwidth 0.1 V Lagerqvist et al., BJ 2007
32 Finite bandwidth Average: 0.1 V 100 / 1,000 / 10^7 times Sample at: 10 GHz / 1 GHz / 100 khz Lagerqvist et al., BJ 2007
33 Effect of probes and environment 1) Electrical probes help distinguish bases due to averaging over configurations 0.1 V 2) Water is not the main source of noise 3) Main sources of noise: thermal and ion fluctuations May lead to decoherence Without water With water
34 Conclusion: Sequencing protocol 1) Bases can be distinguished statistically if some control is exerted: transverse field. 2) Need to slow down DNA translocation so that more measurements per base can be performed. r E r << E 3) Need to calibrate the device with polybase strands. Re-calibration is probably necessary at intervals of time due to possible atomic rearrangements of the nanopore/electrodes.
35 References 1) M. Zwolak and M. Di Ventra, Physical approaches to DNA sequencing and detection, Rev. Mod. Phys. 80, 141 (2008). 2) J. Lagerqvist, M. Zwolak, and M. Di Ventra, Influence of the environment and probes on rapid DNA sequencing via transverse electronic transport, Biophys. J. 93, 2384 (2007). 3) J. Lagerqvist, M. Zwolak, and M. Di Ventra, Comment on Characterization of tunneling conductance across DNA bases, Phys. Rev. E 76, (2007). 4) J. Lagerqvist, M. Zwolak, and M. Di Ventra, Fast DNA sequencing via transverse electronic transport, 6, 779 (2006). 5) M. Zwolak and M. Di Ventra, Electronic signature of DNA nucleotides via transverse transport, Nano Lett. 5, 421 (2005). Thanks
Influence of the Environment and Probes on Rapid DNA Sequencing via Transverse Electronic Transport
2384 Biophysical Journal Volume 93 October 2007 2384 2390 Influence of the Environment and Probes on Rapid DNA Sequencing via Transverse Electronic Transport Johan Lagerqvist,* Michael Zwolak, y and Massimiliano
More informationDNA Sequencing via Quantum Mechanics and Machine Learning
International Journal of Computational Science 1992-6669 Global Information Publisher 20xx, Vol. x, No. x, xx-xx DNA Sequencing via Quantum Mechanics and Machine Learning Henry Yuen 1, Fuyuki Shimojo 1,2,
More informationHigh flexibility of DNA on short length scales probed by atomic force microscopy
High flexibility of DNA on short length scales probed by atomic force microscopy Wiggins P. A. et al. Nature Nanotechnology (2006) presented by Anja Schwäger 23.01.2008 Outline Theory/Background Elasticity
More informationATOMS AND BONDS. Bonds
ATOMS AND BONDS Atoms of elements are the simplest units of organization in the natural world. Atoms consist of protons (positive charge), neutrons (neutral charge) and electrons (negative charge). The
More informationA METHOD OF PRECISE CALIBRATION FOR PIEZOELECTRICAL ACTUATORS
Uludağ Üniversitesi Mühendislik-Mimarlık Fakültesi Dergisi, Cilt 9, Sayı, 24 A METHOD OF PRECISE CALIBRATION FOR PIEZOELECTRICAL ACTUATORS Timur CANEL * Yüksel BEKTÖRE ** Abstract: Piezoelectrical actuators
More informationColloquium: Physical approaches to DNA sequencing and detection
Colloquium: Physical approaches to DA sequencing and detection Michael Zwolak* Physics Department, California Institute of Technology, Pasadena, California 91125, USA and Theoretical Division MS-B213,
More informationLecture Overview. Hydrogen Bonds. Special Properties of Water Molecules. Universal Solvent. ph Scale Illustrated. special properties of water
Lecture Overview special properties of water > water as a solvent > ph molecules of the cell > properties of carbon > carbohydrates > lipids > proteins > nucleic acids Hydrogen Bonds polarity of water
More informationK'NEX DNA Models. Developed by Dr. Gary Benson Department of Biomathematical Sciences Mount Sinai School of Medicine
KNEX DNA Models Introduction Page 1 of 11 All photos by Kevin Kelliher. To download an Acrobat pdf version of this website Click here. K'NEX DNA Models Developed by Dr. Gary Benson Department of Biomathematical
More informationDNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
More informationChapter 11: Molecular Structure of DNA and RNA
Chapter 11: Molecular Structure of DNA and RNA Student Learning Objectives Upon completion of this chapter you should be able to: 1. Understand the major experiments that led to the discovery of DNA as
More informationThe search process for small targets in cellular microdomains! Jürgen Reingruber
The search process for small targets in cellular microdomains! Jürgen Reingruber Department of Computational Biology Ecole Normale Supérieure Paris, France Outline 1. Search processes in cellular biology
More informationSTRUCTURES OF NUCLEIC ACIDS
CHAPTER 2 STRUCTURES OF NUCLEIC ACIDS What is the chemical structure of a deoxyribonucleic acid (DNA) molecule? DNA is a polymer of deoxyribonucleotides. All nucleic acids consist of nucleotides as building
More information2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
More informationIN current film media, the increase in areal density has
IEEE TRANSACTIONS ON MAGNETICS, VOL. 44, NO. 1, JANUARY 2008 193 A New Read Channel Model for Patterned Media Storage Seyhan Karakulak, Paul H. Siegel, Fellow, IEEE, Jack K. Wolf, Life Fellow, IEEE, and
More informationSingle pore membranes for protein channels
Single pore membranes for protein channels Simon Cabello, Sébastien Balme, Lara Tauk, Philippe Déjardin(P884) Institut Européen des Membranes, Montpellier, FR Armagan Kocer, Department of Biochemistry,
More informationDNA Worksheet BIOL 1107L DNA
Worksheet BIOL 1107L Name Day/Time Refer to Chapter 5 and Chapter 16 (Figs. 16.5, 16.7, 16.8 and figure embedded in text on p. 310) in your textbook, Biology, 9th Ed, for information on and its structure
More informationInternational Language Character Code
, pp.161-166 http://dx.doi.org/10.14257/astl.2015.81.33 International Language Character Code with DNA Molecules Wei Wang, Zhengxu Zhao, Qian Xu School of Information Science and Technology, Shijiazhuang
More informationDNA. Discovery of the DNA double helix
DNA Replication DNA Discovery of the DNA double helix A. 1950 s B. Rosalind Franklin - X-ray photo of DNA. C. Watson and Crick - described the DNA molecule from Franklin s X-ray. What is DNA? Question:
More informationNovel inkjettable copper ink utilizing processing temperatures under 100 degrees C without the need of inert atmosphere
Novel inkjettable copper ink utilizing processing temperatures under 100 degrees C without the need of inert atmosphere Printed Electronics Europe April 7-8, 2009 Dresden, Germany Dr. Zvi Yaniv Applied
More informationDNA is found in all organisms from the smallest bacteria to humans. DNA has the same composition and structure in all organisms!
Biological Sciences Initiative HHMI DNA omponents and Structure Introduction Nucleic acids are molecules that are essential to, and characteristic of, life on Earth. There are two basic types of nucleic
More informationThe Next Generation of Cable Technology. A technology primer from NORDX/CDT By, Eric d Allmen
A technology primer from NORDX/CDT By, Eric d Allmen Foreword The Telecommunications Industry Association (TIA) and the International Standards Organization (ISO/IEC) are actively engaged in the development
More informationSignal to Noise Instrumental Excel Assignment
Signal to Noise Instrumental Excel Assignment Instrumental methods, as all techniques involved in physical measurements, are limited by both the precision and accuracy. The precision and accuracy of a
More informationBiomolecular Modelling
Biomolecular Modelling Carmen Domene Physical & Theoretical Chemistry Laboratory University of Oxford, UK THANKS Dr Joachim Hein Dr Iain Bethune Dr Eilidh Grant & Qi Huangfu 2 EPSRC Grant, Simulations
More informationLecture 6 Scanning Tunneling Microscopy (STM) General components of STM; Tunneling current; Feedback system; Tip --- the probe.
Lecture 6 Scanning Tunneling Microscopy (STM) General components of STM; Tunneling current; Feedback system; Tip --- the probe. Brief Overview of STM Inventors of STM The Nobel Prize in Physics 1986 Nobel
More information1. What is a nanopore? Can you think of any naturally existing nanopores? What are their functions?
Ben Snyder Bioanalytical Chemistry Drossman POGIL - Nanopore DNA sequencing Model 1 A Look at α-hemolysin 1. What is a nanopore? Can you think of any naturally existing nanopores? What are their functions?
More informationControlling Gold Nanoparticles with Atomic Precision: Synthesis and Structure Determination
Controlling Gold Nanoparticles with Atomic Precision: Synthesis and Structure Determination Huifeng Qian Department of Chemistry, Carnegie Mellon University, USA Advisor: Prof. Rongchao Jin Background
More informationSupporting information
Supporting information Ultrafast room-temperature NH 3 sensing with positively-gated reduced graphene oxide field-effect transistors Ganhua Lu 1, Kehan Yu 1, Leonidas E. Ocola 2, and Junhong Chen 1 * 1
More informationTHERMAL ANEMOMETRY ELECTRONICS, SOFTWARE AND ACCESSORIES
TSI and TSI logo are registered trademarks of TSI Incorporated. SmartTune is a trademark of TSI Incorporated. THERMAL ANEMOMETRY ELECTRONICS, SOFTWARE AND ACCESSORIES IFA 300 Constant Temperature Anemometry
More informationMeasurement of the gravitational constant G by atom interferometry
Measurement of the gravitational constant G by atom interferometry Fiodor Sorrentino Dipartimento di Fisica & LENS, Università di Firenze & INFN MAGIA Misura Accurata di G mediante Interferometria Atomica
More informationPIN CONFIGURATION FEATURES ORDERING INFORMATION ABSOLUTE MAXIMUM RATINGS. D, F, N Packages
DESCRIPTION The µa71 is a high performance operational amplifier with high open-loop gain, internal compensation, high common mode range and exceptional temperature stability. The µa71 is short-circuit-protected
More informationPolar Covalent Bonds and Hydrogen Bonds
Lesson 6.1: Polar Covalent Bonds and Hydrogen Bonds The last section of code will add hydrogen bonding functionality between molecules. To do so, we have to understand the chemistry of polar covalent bonds
More informationMolecular Spectroscopy
Molecular Spectroscopy UV-Vis Spectroscopy Absorption Characteristics of Some Common Chromophores UV-Vis Spectroscopy Absorption Characteristics of Aromatic Compounds UV-Vis Spectroscopy Effect of extended
More informationS ometime in the next decade, DNA sequencing
Nanopores and nucleic acids: prospects for ultrarapid sequencing David W. Deamer and Mark Akeson FOCUS DNA and RNA molecules can be detected as they are driven through a nanopore by an applied electric
More informationCONCEPT OF DETERMINISTIC ION IMPLANTATION AT THE NANOSCALE
CONCEPT OF DETERMINISTIC ION IMPLANTATION AT THE NANOSCALE Daniel Spemann Jan Meijer 1, Jürgen W. Gerlach, Paul Räcke 1, Susann Liedtke, Stephan Rauschenbach 2, Bernd Rauschenbach 1 University of Leipzig,
More informationTo be able to describe polypeptide synthesis including transcription and splicing
Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain
More informationDemonstration of sub-4 nm nanoimprint lithography using a template fabricated by helium ion beam lithography
Demonstration of sub-4 nm nanoimprint lithography using a template fabricated by helium ion beam lithography Wen-Di Li*, Wei Wu** and R. Stanley Williams Hewlett-Packard Labs *Current address: University
More information2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
More informationProteins and Nucleic Acids
Proteins and Nucleic Acids Chapter 5 Macromolecules: Proteins Proteins Most structurally & functionally diverse group of biomolecules. : o Involved in almost everything o Enzymes o Structure (keratin,
More informationTOF FUNDAMENTALS TUTORIAL
TOF FUNDAMENTALS TUTORIAL Presented By: JORDAN TOF PRODUCTS, INC. 990 Golden Gate Terrace Grass Valley, CA 95945 530-272-4580 / 530-272-2955 [fax] www.rmjordan.com [web] info@rmjordan.com [e-mail] This
More informationCopyright 2007 Casa Software Ltd. www.casaxps.com. ToF Mass Calibration
ToF Mass Calibration Essentially, the relationship between the mass m of an ion and the time taken for the ion of a given charge to travel a fixed distance is quadratic in the flight time t. For an ideal
More informationBasic Concepts of DNA, Proteins, Genes and Genomes
Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate
More informationFiber optic communication
Fiber optic communication Fiber optic communication Outline Introduction Properties of single- and multi-mode fiber Optical fiber manufacture Optical network concepts Robert R. McLeod, University of Colorado
More information5.5. San Diego (8/22/03 10/4/04)
NSF UV SPECTRORADIOMETER NETWORK 23-24 OPERATIONS REPORT 5.5. San Diego (8/22/3 1/4/4) The 23-24 season at San Diego includes the period 8/22/3 1/4/4. In contrast to other network sites, San Diego serves
More informationAnswer: 2. Uracil. Answer: 2. hydrogen bonds. Adenine, Cytosine and Guanine are found in both RNA and DNA.
Answer: 2. Uracil Adenine, Cytosine and Guanine are found in both RNA and DNA. Thymine is found only in DNA; Uracil takes its (Thymine) place in RNA molecules. Answer: 2. hydrogen bonds The complementary
More informationLab # 12: DNA and RNA
115 116 Concepts to be explored: Structure of DNA Nucleotides Amino Acids Proteins Genetic Code Mutation RNA Transcription to RNA Translation to a Protein Figure 12. 1: DNA double helix Introduction Long
More informationZETA POTENTIAL ANALYSIS OF NANOPARTICLES
ZETA POTENTIAL ANALYSIS OF NANOPARTICLES SEPTEMBER 2012, V 1.1 4878 RONSON CT STE K SAN DIEGO, CA 92111 858-565 - 4227 NANOCOMPOSIX.COM Note to the Reader: We at nanocomposix have published this document
More informationFluids Confined in Carbon Nanotubes
Fluids Confined in Carbon Nanotubes Constantine M. Megaridis Micro/Nanoscale Fluid Transport Laboratory Mechanical and Industrial Engineering University of Illinois at Chicago 1 Background and Societal
More informationMicro-Nano Materials Characterization and Inspection
Basic 10 Micro-Nano Materials Characterization and Inspection - Evaluation of Electrical l Properties- Prof. Yang Ju Dept. of Mechanical Science and Engineering Nagoya University, Japan Outline 1. The
More informationNetPrimer Manual. PREMIER Biosoft International. 3786 Corina Way, Palo Alto, CA 94303-4504 Tel: 650-856-2703 FAX: 650-618-1773
NetPrimer Manual PREMIER Biosoft International 3786 Corina Way, Palo Alto, CA 94303-4504 Tel: 650-856-2703 FAX: 650-618-1773 E-mail: sales@premierbiosoft.com 1 Copyright 2009 by PREMIER Biosoft International.
More informationThe Nucleus: DNA, Chromatin And Chromosomes
The Nucleus: DNA, Chromatin And Chromosomes Professor Alfred Cuschieri Department of Anatomy, University of Malta. Objectives By the end of this unit the student should be able to: 1. List the major structural
More informationA Tutorial in Genetic Sequence Classification Tools and Techniques
A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University jakemdrew@gmail.com www.jakemdrew.com Sequence Characters IUPAC nucleotide
More informationThe Focused Ion Beam Scanning Electron Microscope: A tool for sample preparation, two and three dimensional imaging. Jacob R.
The Focused Ion Beam Scanning Electron Microscope: A tool for sample preparation, two and three dimensional imaging Jacob R. Bowen Contents Components of a FIB-SEM Ion interactions Deposition & patterns
More informationCHAPTER 6 INSTRUMENTATION AND MEASUREMENTS 6.1 MEASUREMENTS
CHAPTER 6 INSTRUMENTATION AND MEASUREMENTS 6.1 MEASUREMENTS Atmospheric electricity is a field that is very easy to get into because it does not require a large capital investment for measuring equipment.
More informationAgilent 4339B/4349B High Resistance Meters
Agilent 4339B/4349B High Resistance Meters Technical Overview Within Budget Without Compromise Introducing the Agilent Technologies 4339B and 4349B High Resistance Meters Used for Making Ultra- High Resistance
More informationMATH 10: Elementary Statistics and Probability Chapter 5: Continuous Random Variables
MATH 10: Elementary Statistics and Probability Chapter 5: Continuous Random Variables Tony Pourmohamad Department of Mathematics De Anza College Spring 2015 Objectives By the end of this set of slides,
More informationPIEZOELECTRIC FILMS TECHNICAL INFORMATION
PIEZOELECTRIC FILMS TECHNICAL INFORMATION 1 Table of Contents 1. PIEZOELECTRIC AND PYROELECTRIC EFFECTS 3 2. PIEZOELECTRIC FILMS 3 3. CHARACTERISTICS PROPERTIES OF PIEZOELECTRIC FILMS 3 4. PROPERTIES OF
More informationModeling DNA Replication and Protein Synthesis
Skills Practice Lab Modeling DNA Replication and Protein Synthesis OBJECTIVES Construct and analyze a model of DNA. Use a model to simulate the process of replication. Use a model to simulate the process
More informationMATCH Commun. Math. Comput. Chem. 61 (2009) 781-788
MATCH Communications in Mathematical and in Computer Chemistry MATCH Commun. Math. Comput. Chem. 61 (2009) 781-788 ISSN 0340-6253 Three distances for rapid similarity analysis of DNA sequences Wei Chen,
More informationAgilent N8973A, N8974A, N8975A NFA Series Noise Figure Analyzers. Data Sheet
Agilent N8973A, N8974A, N8975A NFA Series Noise Figure Analyzers Data Sheet Specifications Specifications are only valid for the stated operating frequency, and apply over 0 C to +55 C unless otherwise
More information3. What would you predict for the intensity and binding energy for the 3p orbital for that of sulfur?
PSI AP Chemistry Periodic Trends MC Review Name Periodic Law and the Quantum Model Use the PES spectrum of Phosphorus below to answer questions 1-3. 1. Which peak corresponds to the 1s orbital? (A) 1.06
More information- particle with kinetic energy E strikes a barrier with height U 0 > E and width L. - classically the particle cannot overcome the barrier
Tunnel Effect: - particle with kinetic energy E strikes a barrier with height U 0 > E and width L - classically the particle cannot overcome the barrier - quantum mechanically the particle can penetrated
More informationCurrent Probes. User Manual
Current Probes User Manual ETS-Lindgren L.P. reserves the right to make changes to any product described herein in order to improve function, design, or for any other reason. Nothing contained herein shall
More informationSPACE CHARGE ACCUMULATION UNDER THE EFFECTS OF TEMPERATURE GRADIENT ON SOLID DIELECTRIC DC CABLE
ISBN 978--658-9 Proceedings of the 6 th International Symposium on High Voltage Engineering Copyright c 9 SAIEE, Innes House, Johannesburg SPACE CHARGE ACCUMULATION UNDER THE EFFECTS OF TEMPERATURE GRADIENT
More informationAnalyzing A DNA Sequence Chromatogram
LESSON 9 HANDOUT Analyzing A DNA Sequence Chromatogram Student Researcher Background: DNA Analysis and FinchTV DNA sequence data can be used to answer many types of questions. Because DNA sequences differ
More informationRESULTS OF ICARUS 9 EXPERIMENTS RUN AT IMRA EUROPE
Roulette, T., J. Roulette, and S. Pons. Results of ICARUS 9 Experiments Run at IMRA Europe. in Sixth International Conference on Cold Fusion, Progress in New Hydrogen Energy. 1996. Lake Toya, Hokkaido,
More informationApplication Note. Determination of Nitrite and Nitrate in Fruit Juices by UV Detection. Summary. Introduction. Experimental Sample Preparation
Application Note Determination of Nitrite and Nitrate in Fruit Juices by UV Detection Category Food Matrix Fruit Juice Method HPLC Keywords Ion pair chromatography, fruit juice, inorganic anions AZURA
More informationSCANNING PROBE MICROSCOPY NANOS-E3 SCHOOL 29/09/2015 An introduction to surface microscopy probes
SCANNING PROBE MICROSCOPY NANOS-E3 SCHOOL 29/09/2015 An introduction to surface microscopy probes SPM is ubiquitous in modern research Physics Nanotechnology/chemistry Nature Nanotechnology 10, 156 160
More informationNext Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
More informationFrom apertureless near-field optical microscopy to infrared near-field night vision
From apertureless near-field optical microscopy to infrared near-field night vision Yannick DE WILDE ESPCI Laboratoire d Optique Physique UPR A0005-CNRS, PARIS dewilde@optique.espci.fr From apertureless
More informationA Practical Guide to Free Energy Devices
A Practical Guide to Free Energy Devices Electrolysis Patents No 14: Last updated: 28th January 2006 Author: Patrick J. Kelly Please note that this is a re-worded excerpt from this patent. If the content
More informationGenetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
More informationNanofabrication using anodic alumina templates. IFIMUP and IN Institute of Nanoscience and Nanotechnology
Nanofabrication using anodic alumina templates João Pedro Araújo IFIMUP and IN Institute of Nanoscience and Nanotechnology Outline Template based nanofabrication Nanoporous alumina templates Template filling
More informationPractical Application of Industrial Fiber Optic Sensing Systems
Practical Application of Industrial Fiber Optic Sensing Systems John W. Berthold and David B. Needham Davidson Instruments, Inc. P.O. Box 130100, The Woodlands, TX 77393 ABSTRACT In this presentation,
More informationNanoceanal Spectroscopy of Vibrariums and Electariums
FEM-Simulationen von Feldverteilungen im elektrischen Rasterkraft-Mikroskop Falk Müller 100 nm 2,93 nm 0 nm Experimental set-up Results Results on gold Application on silicon Numerical umerical simulations
More informationScanning Near Field Optical Microscopy: Principle, Instrumentation and Applications
Scanning Near Field Optical Microscopy: Principle, Instrumentation and Applications Saulius Marcinkevičius Optics, ICT, KTH 1 Outline Optical near field. Principle of scanning near field optical microscope
More informationSTM and AFM Tutorial. Katie Mitchell January 20, 2010
STM and AFM Tutorial Katie Mitchell January 20, 2010 Overview Scanning Probe Microscopes Scanning Tunneling Microscopy (STM) Atomic Force Microscopy (AFM) Contact AFM Non-contact AFM RHK UHV350 AFM/STM
More informationExciton dissociation in solar cells:
Exciton dissociation in solar cells: Xiaoyang Zhu Department of Chemistry University of Minnesota, Minneapolis t (fs) 3h! E, k h! Pc Bi e - 1 Acknowledgement Organic semiconductors: Mutthias Muntwiler,
More informationActivitity (of a radioisotope): The number of nuclei in a sample undergoing radioactive decay in each second. It is commonly expressed in curies
Activitity (of a radioisotope): The number of nuclei in a sample undergoing radioactive decay in each second. It is commonly expressed in curies (Ci), where 1 Ci = 3.7x10 10 disintegrations per second.
More informationELECTRIC FIELD LINES AND EQUIPOTENTIAL SURFACES
ELECTRIC FIELD LINES AND EQUIPOTENTIAL SURFACES The purpose of this lab session is to experimentally investigate the relation between electric field lines of force and equipotential surfaces in two dimensions.
More informationQuantum Metrology Closing the Quantum Triangle
Quantum Metrology Closing the Quantum Triangle Quantum Triangle Heikki Seppä VTT Information Technology From Quantum Metrology into the Practical Applications MEG Printable Electronics Quantum Metrology
More informationFiber Optics: Engineering from Global to Nanometer Dimensions
Fiber Optics: Engineering from Global to Nanometer Dimensions Prof. Craig Armiento Fall 2003 1 Optical Fiber Communications What is it? Transmission of information using light over an optical fiber Why
More informationA LAMINAR FLOW ELEMENT WITH A LINEAR PRESSURE DROP VERSUS VOLUMETRIC FLOW. 1998 ASME Fluids Engineering Division Summer Meeting
TELEDYNE HASTINGS TECHNICAL PAPERS INSTRUMENTS A LAMINAR FLOW ELEMENT WITH A LINEAR PRESSURE DROP VERSUS VOLUMETRIC FLOW Proceedings of FEDSM 98: June -5, 998, Washington, DC FEDSM98 49 ABSTRACT The pressure
More information102 26-m Antenna Subnet Telecommunications Interfaces
DSMS Telecommunications Link Design Handbook 26-m Antenna Subnet Telecommunications Interfaces Effective November 30, 2000 Document Owner: Approved by: Released by: [Signature on file in TMOD Library]
More informationA PC-BASED TIME INTERVAL COUNTER WITH 200 PS RESOLUTION
35'th Annual Precise Time and Time Interval (PTTI) Systems and Applications Meeting San Diego, December 2-4, 2003 A PC-BASED TIME INTERVAL COUNTER WITH 200 PS RESOLUTION Józef Kalisz and Ryszard Szplet
More informationStructure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
More informationCT Traceability - Prof. Wim Dewulf, Group T - KU Leuven
CT Traceability - Calibration and Accuracy Prof. Wim Dewulf, Group T - KU Leuven Outline Introduction: terminology and procedures Voxel size calibration Edge offset calibration Conclusions Outline Introduction:
More informationCalculating Nucleic Acid or Protein Concentration Using the GloMax Multi+ Microplate Instrument
Calculating Nucleic Acid or Protein Concentration Using the GloMax Multi+ Microplate Instrument Technical Note INTRODUCTION Direct measurements of nucleic acid samples at OD 260 or protein samples at OD
More informationINTRODUCTION TO SCANNING TUNNELING MICROSCOPY
INTRODUCTION TO SCANNING TUNNELING MICROSCOPY SECOND EDITION C. JULIAN CHEN Department of Applied Physics and Applied Mathematics, Columbia University, New York OXJORD UNIVERSITY PRESS Contents Preface
More informationhij GCSE Additional Science Chemistry 2 Higher Tier Chemistry 2H SPECIMEN MARK SCHEME Version 1.0
hij GCSE Additional Science Chemistry 2 Higher Tier Chemistry 2H SPECIMEN MARK SCHEME Version.0 Copyright 20 AQA and its licensors. All rights reserved. The Assessment and Qualifications Alliance (AQA)
More informationInjection moulding and modelling on a micro scale
Injection moulding and modelling on a micro scale Technology Update Injection moulding and welding of plastics 11 November 2014 Research Projects (National / European) Micro/Nano/Multimaterial Manufacturing
More informationName Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
More informationApplication Note 58 Crystal Considerations with Dallas Real Time Clocks
www.dalsemi.com Application Note 58 Crystal Considerations with Dallas Real Time Clocks Dallas Semiconductor offers a variety of real time clocks (RTCs). The majority of these are available either as integrated
More informationLaser-induced surface phonons and their excitation of nanostructures
CHINESE JOURNAL OF PHYSICS VOL. 49, NO. 1 FEBRUARY 2011 Laser-induced surface phonons and their excitation of nanostructures Markus Schmotz, 1, Dominik Gollmer, 1 Florian Habel, 1 Stephen Riedel, 1 and
More informationHybrid biological/artificial nanopore
Hybrid biological/artificial nanopore Sébastien Balme, Simon Cabello Aguilar, Mathilde Lepoitevin, Mikhael Bechelany Adib Abou Chaaya, Jean Marc Janot, Emmanuel Balanzat, Philippe Déjardin Sebastien.balme@univ-montp2.fr
More informationQuantum control of individual electron and nuclear spins in diamond lattice
Quantum control of individual electron and nuclear spins in diamond lattice Mikhail Lukin Physics Department, Harvard University Collaborators: L.Childress, M.Gurudev Dutt, J.Taylor, D.Chang, L.Jiang,A.Zibrov
More informationPreliminary MFM Quiz
Preliminary MFM Quiz 1. The major carrier of chemical energy in all cells is: A) adenosine monophosphate B) adenosine diphosphate C) adenosine trisphosphate D) guanosine trisphosphate E) carbamoyl phosphate
More informationFluid transport at the nano- and meso- scales
NanoSOFT Fluid transport at the nano- and meso- scales from fundamentals to applications in energy harvesting and desalination process Alessandro Siria Starting Grant 2014 Panel: PE 3, Condensed Matter
More informationNucleotides and Nucleic Acids
Nucleotides and Nucleic Acids Brief History 1 1869 - Miescher Isolated nuclein from soiled bandages 1902 - Garrod Studied rare genetic disorder: Alkaptonuria; concluded that specific gene is associated
More informationNanoscale Resolution Options for Optical Localization Techniques. C. Boit TU Berlin Chair of Semiconductor Devices
berlin Nanoscale Resolution Options for Optical Localization Techniques C. Boit TU Berlin Chair of Semiconductor Devices EUFANET Workshop on Optical Localization Techniques Toulouse, Jan 26, 2009 Jan 26,
More information