Data Analysis for Ion Torrent Sequencing

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Data Analysis for Ion Torrent Sequencing"

Transcription

1 IFU022 v Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan Niel Belgium Revision date: August 21, 2014 Page 1 of 9

2 TABLE OF CONTENTS 1. KITS AND INTENDED USE PRINCIPLE OF THE METHOD MATERIALS AND EQUIPMENT REQUIRED BUT NOT PROVIDED FILES PROVIDED GENERAL CONSIDERATIONS DATA FILES STRUCTURE OF THE SEQUENCING READS DEMULTIPLEXING OF THE SEQUENCING READS TRIMMING OF THE SEQUENCING READS ALIGNMENT TO THE REFERENCE SEQUENCE VARIANT CALLING MINIMAL COVERAGE QUALITY SCORES CNV ANALYSIS SPECIFIC INSTRUCTIONS TORRENT SUITE TM SOFTWARE DROPGEN INSTRUCTIONS LIST OF ABBREVIATIONS... 9 Revision date: August 21, 2014 Page 2 of 9

3 1. KITS AND INTENDED USE The combined use of Multiplicom s MASTR (Multiplex Amplification of Specific Targets for Resequencing) kits with one or more of Multiplicom s molecular identifier (MID) kit(s) or Short Read Amplification kit enables the preparation of libraries for sequencing the gene(s) of interest using massively parallel sequencing (MPS) instruments. A list of available MASTR assays and Complementary MASTR products can be found on Multiplicom s website ( under Products section. These MASTR assays are for Research Use Only, unless otherwise stated, enabling the identification or confirmation of the presence or absence of mutations and/or copy number variations (CNV) in target regions. 2. PRINCIPLE OF THE METHOD Multiplicom s MASTR assays enable multiplex PCR amplification of all required target regions of the gene(s) of interest in a limited number of PCR reactions. The recommended amount of DNA for each multiplex PCR reaction is between 20 and 50 ng of purified genomic DNA for the germline MASTRs and somatic MASTRs for DNA derived from fresh frozen tissue (FFT), or a minimum of 20 ng for DNA derived from FFPE (formalin fixed paraffin embedded) material for somatic MASTRs. Next, the resulting amplicons are barcoded, pooled and sequenced using a MPS instrument according to the manufacturer s instructions. The resulting sequence read pairs are subsequently analyzed to identify variant positions compared with the reference sequence of the targeted gene(s). Comparing those variants with public and/or private databases and analyzing the predicted change on the protein level will allow the identification of mutations associated with health and disease. Moreover, a number of MASTR assays enable CNV analysis directly from MPS data. MASTR assays serve as front end amplification for sequence analysis on all commercially available bench top MPS instruments. The technology is based on target amplification. The principle of the MASTR assays relies on two key technologies: multiplex PCR amplification and Massively Parallel Sequencing (the detection method). In the first step, all target regions of the gene of interest are amplified in separate multiplex PCR amplification reactions (number of multiplex reactions is defined per MASTR assay) per individual, using a hot start DNA polymerase (Figure 1). The resulting amplicons of each multiplex are diluted 2,000 fold. Figure 1. First step: multiplex PCR Revision date: August 21, 2014 Page 3 of 9

4 For detailed workflow of this first step, please refer to the Instructions for Use Part I Multiplex PCR with amplicon specific primers: MASTR assays (IFU016). In the second step, a second round of PCR is performed enabling tagging of all the amplicons to incorporate MID and A and P1 adaptors required for Ion Torrent Sequencing (Figure 2). Figure 2. Second step: Universal PCR (example for Ion Torrent systems) The resulting tagged amplicons are mixed per individual applying a predefined assay specific mixing scheme. Each amplicon library is subsequently purified from small residual DNA fragments and the DNA concentration determined. For the detailed workflow of the second Universal PCR and subsequent mixing, purification and pooling steps please refer to the IFU Part II MID for Ion PGM TM System (IFU241 or IFU242). Next, these purified and individually tagged amplicon libraries are pooled equimolar, resulting in an amplicon pool or sequencing sample, which is then further processed with the Ion PGM TM Template OT2 400 Kit resulting in a template that is sequenced on an MPS Instrument according to the manufacturer s instructions. The positions of the Ion Torrent sequencing primers are indicated in Figure 3. Figure 3. Third step: Sequencing run. Revision date: August 21, 2014 Page 4 of 9

5 3. MATERIALS AND EQUIPMENT REQUIRED BUT NOT PROVIDED Equipment Analysis software for read counts and variant calling of the MPS data Recommendations/Comments Several software packages are commercially available. 4. FILES PROVIDED Table 1. Explanation of files supplied for data analysis File description MID sequences* (IFU333) PCR specific primers BED file Type and content General.pdf file listing the sequences of the MIDs present in the MID for Ion PGM TM System kits: for demultiplexing of reads (Section 5.3) MASTR specific.txt file listing the primers used for the amplification of the different amplicons: for sequence trimming (Section 5.4) MASTR specific.txt file listing the amplicon positions in Homo sapiens hg19 (MASTR specific primers are trimmed off): target info for data analysis in general format (Section 5.5) All files listed above can be downloaded from All documents mentioned above can be downloaded from using the KEY CODE printed on the box label of the specific MASTR kit (or MID for Ion PGM TM System kit*). 5. GENERAL CONSIDERATIONS 5.1. Data files For Ion Torrent sequencing, the Torrent Suite TM Software generates for each MID an SFF (Standard Flowgram Format) file or a FASTQ file containing all filter passed sequencing reads generated during the run Structure of the sequencing reads The structure of the sequencing reads is depicted in Figure 3: the reads start with the MID, followed by the universal tag sequence (Tag1 or Tag2), the PCR specific primer (Forward or Reverse) and the amplified region. Depending on the size of the amplified region and the length of the read, this sequence of the amplified region is further followed by the other PCR specific primer, universal tag and P1 adaptor Demultiplexing of the sequencing reads The MID sequences at the beginning and/or at the end of the reads are used to demultiplex the sequencing reads: to attribute the reads to one of the analysed samples or a no match residual category. Depending on the software tool used, the default being the Torrent Suite TM Software the number of allowed mismatches between the observed MID sequence and the expected MID sequences is an input parameter for the demultiplexing step. We advise to allow maximally 2 (tolerant) mismatches. Reducing the allowable mismatches reduces the risk for barcode misassignment; however, the number of reads assigned to a barcode will be reduced concomittantly. Revision date: August 21, 2014 Page 5 of 9

6 5.4. Trimming of the sequencing reads The PCR specific primer part in the sequencing reads is by definition equal to the genomic reference sequence and thus independent of the individual sample that is sequenced. As depicted in Figure 4, when 2 amplicons overlap, failure to trim the PCR primer sequences from the reads can result in skewed variant allele frequencies. Since virtually all MASTR assays contain overlapping amplicons, primer trimming is a mandatory step in the data analysis. The sequences of PCR primers (Figure 4a Forward2 and Reverse2) should be removed from those reads generated directly with them (Figure 4a Amplicon2 reads), and should not be removed from reads generated with other PCR primers (ie, from overlapping amplicons; Figure 4a Amplicon1 reads). This discrimination can be made based on the fact that the sequences of the PCR primers are flanked by the universal tags (Tag1, AAGACTCGGCAGCATCTCCA, or Tag2, GCGATCGTCACTGTTCTCCA), while the same sequences in the overlapping amplicons are not. Figure 4. PCR Primer trimming. a) Illustration before PCR primer trimming: alignment of Amplicon1 and Amplicon2 reads with Forward and Reverse primers. b) Illustration after PCR primer trimming. Remark: During design, great care was taken to select primer binding sites avoiding regions with variants. In addition, a periodic review is performed to identify newly reported variants in those regions and to test their impact on amplification. It can however not be excluded that a variant in a binding site of a primer may be present in a sample, which may lead to the amplification of only one of the alleles, masking the presence of a clinically relevant mutation in the amplicon. If such a case is suspected, calculation of the dosage quotient of each amplicon can be used for confirmation (as desctibed in Section 5.7). For further support, contact customer services at 5.5. Alignment to the reference sequence The sequence reads can be aligned to the targeted regions or to the entire human genomic sequence. To facilitate the transfer of assay specific information to the different analysis software packages, a BED file with the trimmed amplicon positions on hg19 is available for download at our website Variant calling Different parameters can be analyzed to discriminate true positive variants from false positive or background signals. Below, you find a non exhaustive list of parameters whose effect on the sensitivity and specificity of variant calling might be evaluated: Minimal coverage The coverage, or number of aligned reads, at the site of the variant has to reach a given threshold for confident variant detection. The minimal coverage recommended by Multiplicom for MASTRs in combination with an Ion PGM System is 100 reads for each position at the region of interest (50 reads per allele) for SNV analysis and 300 reads per amplicon for CNV analysis. It is advised that target regions that do not reach this minimal coverage are eliminated from the list of analysed target regions in the final variant calling report. Revision date: August 21, 2014 Page 6 of 9

7 In case of an amplicon library derived from a tumor tissue sample (FFPE or FFT) deeper sequencing might be needed to obtain the required minimal coverage of 50 reads per affected allele. Examples are when the sample contains clonal populations of tumor cells and/or has a lower percentage of tumor cells. In these cases the minimal numbers of reads should be recalculated accordingly (eg, 2 fold higher to identify positions with a variant allele frequency (VAF) of 25%, or for a sample with 50% tumor tissue content) Quality scores The quality of the aligned bases at the position of the potential variant has an effect on the confidence in the variant call. This quality is generally influenced by the position in the read (the overall quality decreases along the reads) and the genomic context (eg, homopolymer stretches have a negative impact on the quality of the following bases). This leads to two derived parameters: Presence in forward and reverse reads Since the quality decreases along the reads and forward and reverse reads start at opposite positions on an amplicon, the quality of the forward reads is highest where the quality of the reverse reads is the lowest (and vice versa). If all target positions are covered by both forward and reverse reads, the presence of a variant in both forward and reverse reads is a good predictor for a true positive variant call. Changes in/around homopolymeric stretches In view of the inherent difficulties of the Ion Torrent sequencing technology to call the actual length of homopolymer stretches, special care has to be taken when calling variants in or flanking a homopolymeric stretch. Based on our experience, homopolymeric stretches with a length of 4 bp or more require special care. Remark: for specific MASTR assays, we offer a complementary homopolymer (HP) kit. For an overview of all available HP kits, please refer to the Products section on Multiplicom s website ( CNV analysis CNV analysis is possible for a selected number of MASTR assays. These MASTR assays contain a separate set of control amplicons for each plex (located on chromosomes different from the target genes), which are amplified, tagged and sequenced in parallel with the targeted region. Only MASTRs listing such control amplicons on their GS Reference Pattern are suited for CNV analysis. Remark: Excel template sheets are available upon request (at for the specific MASTR assays enabling CNV analysis. To use these sheets, the read counts (number of reads) of all amplicons in all samples should be extracted from the sequencing data. For CNV analysis using MPS data, read count comparison between target and control amplicons is performed to calculate the Dosage Quotient (DQ) as described: Read count of the amplicon of interest is divided by the sum of read counts of control amplicons of that plex (in other words: normalize on sum of control amplicons) = normalized read count The average of the normalized read counts of that amplicon for all samples is calculated = reference normalized read count The normalized read count is divided by the reference normalized read count = DQ When the DQ 1.3, the corresponding genomic fragment is considered to be present in 3 copies (duplication of one allele); when the DQ 0.7, the genomic fragment is considered to be present in only 1 copy (deletion of one allele). Revision date: August 21, 2014 Page 7 of 9

8 Remarks: (1) CNV analysis calculations always need to be made within a plex. (2) For the proper calculation of the reference normalized read count (in the calculation of the DQ as described above), the set of samples should meet the following requirements: o When using a set of known samples as references (no CNVs), the libraries of these samples should be constructed together with the unknown samples. o When using the other unknown samples of your run as references, only a 40% of samples from the total set is allowed to have a CNV. (3) Since polymorphisms in primer sites may lead to amplification of only one of the alleles, resulting in a false positive DQ 0.5, a detected CNV is only considered to be valid when 2 adjacent amplicons show a significantly altered DQ and/or when confirmed by an independent method. (4) Compared to variant analysis deeper sequencing is required for CNV analysis. For the precise list of amplicons that will be amplified using a certain PCR Mix, refer to the MASTR specific GS Reference Pattern, which can be obtained from using the KEY CODE printed on the box label of the used MASTR kit. 6. SPECIFIC INSTRUCTIONS Data analysis can be performed using a variety of analysis software packages. Below we provide some specific instructions for the use of the Torrent Suite TM software of Life Technologies (Section 6.1), and the dropgen application of the Integrated Clinical NGS Dry Lab Service of Sophia Genetics 6.2) Torrent Suite TM software Life Technologies advises to align the generated sequences using the Torrent Suite Software and analyse the generated BAM files with the Torrent Variant Caller. One step in this process is the definition of the target regions. For this, the BED file mentioned in Table 1 should be used. More detailed information on these software solutions can be found on the Ion Community website ( dropgen instructions The dropgen application should be used according to manufacturer s instructions. To access and use Sophia Genetics' service, laboratories shall request the creation of an account on the dropgen application by contacting Sophia Genetics directly: Revision date: August 21, 2014 Page 8 of 9

9 7. LIST OF ABBREVIATIONS CNV: DNA: FFPE: IFU: MASTR: MID: MPS: PCR: Plex: ROI: SFF: TTC: VAF: Copy Number Variant Deoxyribonucleic acid formalin fixed paraffin embedded Instructions For Use Multiplex Amplification of Specific Target for Resequencing Molecular Identifiers Massively Parallel Sequencing Polymerase Chain Reaction Set of MASTR derived amplicons Region of Interest Standard Flowgram Format Tumor Tissue Content Variant Allele Frequency Revision date: August 21, 2014 Page 9 of 9

Ion Torrent Amplicon Sequencing

Ion Torrent Amplicon Sequencing APPLICATION NOTE Amplicon Sequencing Ion Torrent Amplicon Sequencing Introduction The ability to sequence a genome or a portion of a genome has enabled researchers to begin to understand how the genetic

More information

BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls?

BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? Giovanni Luca Scaglione, PhD ------------------------ Laboratory of Clinical Molecular Diagnostics and Personalized Medicine, Institute

More information

Introduction to next-generation sequencing data

Introduction to next-generation sequencing data Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS

More information

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long

More information

SEQUENCING. From Sample to Sequence-Ready

SEQUENCING. From Sample to Sequence-Ready SEQUENCING From Sample to Sequence-Ready ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES, NOT ONCE, BUT EVERY TIME The highest-quality amplicons more sensitive, accurate, and specific Full support for all major

More information

PreciseTM Whitepaper

PreciseTM Whitepaper Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis

More information

Introduction to NGS data analysis

Introduction to NGS data analysis Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

TruSeq Custom Amplicon v1.5

TruSeq Custom Amplicon v1.5 Data Sheet: Targeted Resequencing TruSeq Custom Amplicon v1.5 A new and improved amplicon sequencing solution for interrogating custom regions of interest. Highlights Figure 1: TruSeq Custom Amplicon Workflow

More information

454 Sequencing System Guidelines for Amplicon Experimental Design

454 Sequencing System Guidelines for Amplicon Experimental Design 454 Sequencing System Guidelines for Amplicon Experimental Design July 2011 Instrument / Kit GS Junior / Junior GS FLX+ / XL+ GS FLX+ / XLR70 GS FLX / XLR70 For life science research only. Not for use

More information

INTRODUCTION TO NGS VARIANT CALLING ANALYSIS

INTRODUCTION TO NGS VARIANT CALLING ANALYSIS Hospital Universitari Vall d Hebron Institut de Recerca - VHIR Institut d Investigació Sanitària de l Instituto de Salud Carlos III (ISCIII) INTRODUCTION TO NGS VARIANT CALLING ANALYSIS Bioinformàtica

More information

Targeted. sequencing solutions. Accurate, scalable, fast TARGETED

Targeted. sequencing solutions. Accurate, scalable, fast TARGETED Targeted TARGETED Sequencing sequencing solutions Accurate, scalable, fast Sequencing for every lab, every budget, every application Ion Torrent semiconductor sequencing Ion Torrent technology has pioneered

More information

Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation

Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation PN 100-9879 A1 TECHNICAL NOTE Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation Introduction Cancer is a dynamic evolutionary process of which intratumor genetic and phenotypic

More information

Overview. KAPAHiFi HotStart is the engineered KAPAHiFi DNA Polymerase with an antibody-based hot start technology and improved buffer system.

Overview. KAPAHiFi HotStart is the engineered KAPAHiFi DNA Polymerase with an antibody-based hot start technology and improved buffer system. Overview KAPAHiFi HotStart is the engineered KAPAHiFi DNA Polymerase with an antibody-based hot start technology and improved buffer system. KAPAHiFi HotStart exhibits: World leading fidelity confirmed

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977

More information

3. comparison with proteins of known function

3. comparison with proteins of known function Lectures 26 and 27 recombinant DNA technology I. oal of genetics A. historically - easy to isolate total DNA - difficult to isolate individual gene B. recombinant DNA technology C. why get the gene? 1.

More information

Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office

Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office 2013 Laboratory Accreditation Program Audioconferences and Webinars Implementing Next Generation Sequencing (NGS) as a Clinical Tool in the Laboratory Nazneen Aziz, PhD Director, Molecular Medicine Transformation

More information

Application Guide... 2

Application Guide... 2 Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied

More information

Ion Torrent Systems Research Applications and Developments for PGM and Proton Sequencers

Ion Torrent Systems Research Applications and Developments for PGM and Proton Sequencers Ion Torrent Systems Research Applications and Developments for PGM and Proton Sequencers Mathieu Larivière Life Technologies Field Application Scientist Next Generation Sequencing 1 Introduction to PGM

More information

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research March 17, 2011 Rendez-Vous Séquençage Presentation Overview Core Technology Review Sequence Enrichment Application

More information

Guideline for the submission of DNA sequences and associated annotations within the framework of Directive 2001/18/EC and Regulation (EC) No 1829/2003

Guideline for the submission of DNA sequences and associated annotations within the framework of Directive 2001/18/EC and Regulation (EC) No 1829/2003 Guideline for the submission of DNA sequences and associated annotations within the framework of Directive 2001/18/EC and Regulation (EC) No 1829/2003 European Reference Laboratory for Genetically Modified

More information

Genome Sequencer System. Amplicon Sequencing. Application Note No. 5 / February 2007. www.roche-applied-science.com

Genome Sequencer System. Amplicon Sequencing. Application Note No. 5 / February 2007. www.roche-applied-science.com Genome Sequencer System Application Note No. 5 / February 2007 Amplicon Sequencing www.roche-applied-science.com 1 Amplicon Sequencing Corresponding author: Tom Jarvie, 454 Life Sciences Corporation, Branford,

More information

Single-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples

Single-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples DATA Sheet Single-Cell DNA Sequencing with the C 1 Single-Cell Auto Prep System Reveal hidden populations and genetic diversity within complex samples Single-cell sensitivity Discover and detect SNPs,

More information

HTG EdgeSeq System Workflow Overview

HTG EdgeSeq System Workflow Overview HTG EdgeSeq System Workflow Overview The HTG EdgeSeq system is an automated chemistry and workflow solution based on HTG Molecular Diagnostics (HTG) extraction-free sample preparation technology and quantitative

More information

Illumina Library Preparation Overview

Illumina Library Preparation Overview Illumina Library Preparation Overview 2013 Illumina, Inc. All rights reserved. Illumina, IlluminaDx, BaseSpace, BeadArray, BeadXpress, cbot, CSPro, DASL, DesignStudio, Eco, GAIIx, Genetic Energy, Genome

More information

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR Roche Applied Science Technical Note No. LC 18/2004 Purpose of this Note Assay Formats for Use in Real-Time PCR The LightCycler Instrument uses several detection channels to monitor the amplification of

More information

Next generation DNA sequencing technologies. theory & prac-ce

Next generation DNA sequencing technologies. theory & prac-ce Next generation DNA sequencing technologies theory & prac-ce Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing

More information

Massively Parallel Sequencingintegrating. sequencer into your forensic laboratory. Dr SallyAnn Harbison March 2015

Massively Parallel Sequencingintegrating. sequencer into your forensic laboratory. Dr SallyAnn Harbison March 2015 Massively Parallel Sequencingintegrating the Ion PGM sequencer into your forensic laboratory. Dr SallyAnn Harbison March 2015 Its not all about the science- its also about the people. What is it that

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID papillary renal cell carcinoma (translocation-associated) PRCC Human This gene

More information

Next Generation Sequencing: Technology, Mapping, and Analysis

Next Generation Sequencing: Technology, Mapping, and Analysis Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

Essentials of Real Time PCR. About Sequence Detection Chemistries

Essentials of Real Time PCR. About Sequence Detection Chemistries Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected

More information

Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing

Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAAC GTGCAC GTGAAC Wouter Coppieters Head of the genomics core facility GIGA center, University of Liège Bioruptor NGS: Unbiased DNA

More information

Focusing on results not data comprehensive data analysis for targeted next generation sequencing

Focusing on results not data comprehensive data analysis for targeted next generation sequencing Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes

More information

DNA and Forensic Science

DNA and Forensic Science DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief

More information

Ankyrin 3 Genetic Association Studies of Bipolar Disorders

Ankyrin 3 Genetic Association Studies of Bipolar Disorders Ankyrin 3 Genetic Association Studies of Bipolar Disorders Wade Berrettini, MD, PhD The Karl E. Rickels Professor of Psychiatry and Director of the Center for Neurobiology and Behavior, Department of Psychiatry

More information

How is genome sequencing done?

How is genome sequencing done? How is genome sequencing done? Using 454 Sequencing on the Genome Sequencer FLX System, DNA from a genome is converted into sequence data through four primary steps: Step One DNA sample preparation; Step

More information

ONE WORKFLOW. ONE PARTNER. ACTIONABLE INSIGHTS. Sample to Insight

ONE WORKFLOW. ONE PARTNER. ACTIONABLE INSIGHTS. Sample to Insight ONE WORKFLOW. ONE PARTNER. ACTIONABLE INSIGHTS. Sample to Insight (NGS) Nucleic Acid More actionable data and insights in one go. More confidence at one glance. A small step for you, a giant leap for your

More information

Next Generation Sequencing I: Technologies. Jim Noonan Department of Genetics

Next Generation Sequencing I: Technologies. Jim Noonan Department of Genetics Next Generation Sequencing I: Technologies Jim Noonan Department of Genetics Sequence as the readout for biological processes Determining the biological state of cells, tissues and organisms requires the

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just

More information

Next Generation Sequencing: Data analysis for genetic profiling

Next Generation Sequencing: Data analysis for genetic profiling Next Generation Sequencing: Data analysis for genetic profiling Raed Samara, Ph.D. Global Product Manager Raed.Samara@QIAGEN.com Legal Disclaimer QIAGEN products shown here are intended for molecular biology

More information

360 Master Mix. , and a supplementary 360 GC Enhancer.

360 Master Mix. , and a supplementary 360 GC Enhancer. Product Bulletin AmpliTaq Gold 360 Master Mix and 360 DNA Polymerase AmpliTaq Gold 360 Master Mix AmpliTaq Gold 360 DNA Polymerase 360 Coverage for a Full Range of Targets AmpliTaq Gold 360 Master Mix

More information

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1 CAP 5510-8 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Genomic Mapping & Mapping Databases High resolution, genome-wide maps of DNA markers. Integrated maps, genome catalogs and comprehensive

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples

Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples Sudhir K. Sinha, Ph.D.*, Anne H. Montgomery, M.S., Gina Pineda, M.S., and Hiromi Brown, Ph.D.

More information

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) Polymerase Chain Reaction (PCR) Paul C Winter, Belfast City Hospital, Belfast, UK The polymerase chain reaction is a technique that allows DNA molecules of interest (usually gene sequences) to be copied

More information

Assuring the Quality of Next-Generation Sequencing in Clinical Laboratory Practice. Supplementary Guidelines

Assuring the Quality of Next-Generation Sequencing in Clinical Laboratory Practice. Supplementary Guidelines Assuring the Quality of Next-Generation Sequencing in Clinical Laboratory Practice Next-generation Sequencing: Standardization of Clinical Testing (Nex-StoCT) Workgroup Principles and Guidelines Supplementary

More information

MUTATION, DNA REPAIR AND CANCER

MUTATION, DNA REPAIR AND CANCER MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful

More information

14/12/2012. HLA typing - problem #1. Applications for NGS. HLA typing - problem #1 HLA typing - problem #2

14/12/2012. HLA typing - problem #1. Applications for NGS. HLA typing - problem #1 HLA typing - problem #2 www.medical-genetics.de Routine HLA typing by Next Generation Sequencing Kaimo Hirv Center for Human Genetics and Laboratory Medicine Dr. Klein & Dr. Rost Lochhamer Str. 9 D-8 Martinsried Tel: 0800-GENETIK

More information

SybGREEN qpcr Primers and Standards

SybGREEN qpcr Primers and Standards SybGREEN qpcr Primers and Standards Tools for RT-PCR Application Guide Table of Contents Package Contents and Storage Conditions... 1 Introduction... 3 SybGREEN qpcr Primer Pairs... 3 Gene Specific qpcr

More information

Next Gen Sequencing Summary of the short course Next Gen Sequencing at Avans hogeschool, Breda. 24/04/2013 Next gen Sequencing technologies

Next Gen Sequencing Summary of the short course Next Gen Sequencing at Avans hogeschool, Breda. 24/04/2013 Next gen Sequencing technologies Next Gen Sequencing Summary of the short course Next Gen Sequencing at Avans hogeschool, Breda 24/04/2013 Next gen Sequencing technologies 1 2nd Gen Sequencing Summary of the short course Next Gen Sequencing

More information

SOLUTIONS FOR NEXT-GENERATION SEQUENCING

SOLUTIONS FOR NEXT-GENERATION SEQUENCING SOLUTIONS FOR NEXT-GENERATION SEQUENCING GENOMICS CELL BIOLOGY PROTEOMICS AUTOMATION enabling next-generation research From Samples To Publication, Millennium Science Enables Your Next-Gen Sequencing Workflow

More information

Lecture 10. mrna: Transcription Translation Start Translation Stop Transcription Start (AUG) (UAG, UAA, or UGA) Terminator S-D Sequence

Lecture 10. mrna: Transcription Translation Start Translation Stop Transcription Start (AUG) (UAG, UAA, or UGA) Terminator S-D Sequence Lecture 10 Analysis of Gene Sequences Anatomy of a bacterial gene: Promoter Coding Sequence (no stop codons) mrna: Transcription Translation Start Translation Stop Transcription Start (AUG) (UAG, UAA,

More information

PNA BRAF Mutation Detection Kit

PNA BRAF Mutation Detection Kit - PNA BRAF Mutation Detection Kit Catalog Number KA2102 50 tests/kit Version: 01 Intended for research use only www.abnova.com Introduction and Background Intended use The PNA BRAF Mutation Detection Kit

More information

FOR REFERENCE PURPOSES

FOR REFERENCE PURPOSES BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information

Lab 1: Who s Your Daddy? (AKA DNA Purification and PCR)

Lab 1: Who s Your Daddy? (AKA DNA Purification and PCR) Lab 1: Who s Your Daddy? (AKA DNA Purification and PCR) Goals of the lab: 1. To understand how DNA s chemical properties can be exploited for purification 2. To learn practical applications of DNA purification

More information

Validation parameters: An introduction to measures of

Validation parameters: An introduction to measures of Validation parameters: An introduction to measures of test accuracy Types of tests All tests are fundamentally quantitative Sometimes we use the quantitative result directly However, it is often necessary

More information

Overview of Next Generation Sequencing platform technologies

Overview of Next Generation Sequencing platform technologies Overview of Next Generation Sequencing platform technologies Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Outline 1. Technologies

More information

BacReady TM Multiplex PCR System

BacReady TM Multiplex PCR System BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental

More information

Chapter 10 Manipulating Genes

Chapter 10 Manipulating Genes How DNA Molecules Are Analyzed Chapter 10 Manipulating Genes Until the development of recombinant DNA techniques, crucial clues for understanding how cell works remained lock in the genome. Important advances

More information

Methylation Analysis Using Methylation-Sensitive HRM and DNA Sequencing

Methylation Analysis Using Methylation-Sensitive HRM and DNA Sequencing APPLICATION NOTE Methylation Analysis Using Methylation-Sensitive HRM and DNA Sequencing Methylation Analysis Using Methylation Sensitive HRM and DNA Sequencing Abstract DNA methylation is a key epigenetic

More information

Chapter 6 DNA Replication

Chapter 6 DNA Replication Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites.

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites. 1. A recombinant DNA molecules is one that is a. produced through the process of crossing over that occurs in meiosis b. constructed from DNA from different sources c. constructed from novel combinations

More information

July 7th 2009 DNA sequencing

July 7th 2009 DNA sequencing July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer

More information

Core Facility Genomics

Core Facility Genomics Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray

More information

Gene Expression Assays

Gene Expression Assays APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency

More information

Real-time quantitative RT -PCR (Taqman)

Real-time quantitative RT -PCR (Taqman) Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR

More information

DNA Sequence Analysis

DNA Sequence Analysis DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide

More information

PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR. Results Interpretation Guide

PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR. Results Interpretation Guide PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR Results Interpretation Guide Pathogen Detection Systems by Real Time PCR Microbial offers real time PCR based systems for the detection of pathogenic bacteria

More information

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each

More information

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Molecular Methods Sylvain Forêt March 2010 http://dayhoff.anu.edu.au/~sf/next_gen_seq 1 Introduction 2 Sanger 3 Illumina 4 454 5 SOLiD 6 Summary The Genomic Age Recent landmarks

More information

Lecture 38: DNA Fingerprinting

Lecture 38: DNA Fingerprinting Lecture 38: DNA Fingerprinting (DNA technology) The most awesome and powerful tool acquired by man since the splitting of atoms - The Time Magazine (USA) Conventional fingerprint of an individual comes

More information

Paper Clip PCR PURPOSE

Paper Clip PCR PURPOSE Paper Clip PCR PURPOSE The purpose of this activity is to reinforce basic DNA concepts and to introduce students to the technique of PCR and its many uses. Part one of the activity uses a virtual PCR animation

More information

Oncology Insights Enabled by Knowledge Base-Guided Panel Design and the Seamless Workflow of the GeneReader NGS System

Oncology Insights Enabled by Knowledge Base-Guided Panel Design and the Seamless Workflow of the GeneReader NGS System White Paper Oncology Insights Enabled by Knowledge Base-Guided Panel Design and the Seamless Workflow of the GeneReader NGS System Abstract: This paper describes QIAGEN s philosophy and process for developing

More information

510K Summary. This summary of 510(k) safety and effectiveness information is being submitted in accordance with the requirements of 21 CFR 807.92.

510K Summary. This summary of 510(k) safety and effectiveness information is being submitted in accordance with the requirements of 21 CFR 807.92. 510K Summary This summary of 510(k) safety and effectiveness information is being submitted in accordance with the requirements of 21 CFR 807.92. Submitter: Contact: One Lambda, Incorporated 21001 Kittridge

More information

Introduction to Illumina Next Generation Sequencing Technology

Introduction to Illumina Next Generation Sequencing Technology The Nancy and Stephen Grand Israel National Center for Personalized Medicine (G-INCPM) Introduction to Illumina Next Generation Sequencing Technology Shmulik Motola, PhD March 2016 DNA Sequencing a process

More information

Delivering the power of the world s most successful genomics platform

Delivering the power of the world s most successful genomics platform Delivering the power of the world s most successful genomics platform NextCODE Health is bringing the full power of the world s largest and most successful genomics platform to everyday clinical care NextCODE

More information

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità Identification and characterization of Verocytotoxin-producing Escherichia coli (VTEC) by Real Time PCR amplification of the main virulence genes and the genes associated with the serogroups mainly associated

More information

Practice guidelines for Targeted Next Generation Sequencing Analysis and Interpretation.

Practice guidelines for Targeted Next Generation Sequencing Analysis and Interpretation. Practice guidelines for Targeted Next Generation Sequencing Analysis and Interpretation. Prepared and edited by Sian Ellard 1,2, Helen Lindsay 3, Nick Camm 3, Chris Watson 3, Steve Abbs 4, Yvonne Wallis

More information

Illumina TruSeq DNA Adapters De-Mystified James Schiemer

Illumina TruSeq DNA Adapters De-Mystified James Schiemer 1 of 5 Illumina TruSeq DNA Adapters De-Mystified James Schiemer The key to sequencing random fragments of DNA is by the addition of short nucleotide sequences which allow any DNA fragment to: 1) Bind to

More information

The author(s) shown below used Federal funds provided by the U.S. Department of Justice and prepared the following final report:

The author(s) shown below used Federal funds provided by the U.S. Department of Justice and prepared the following final report: The author(s) shown below used Federal funds provided by the U.S. Department of Justice and prepared the following final report: Document Title: Author(s): Resolution of DNA Mixtures and Analysis of Degraded

More information

Auth required. Mod. Y or N

Auth required. Mod. Y or N Appendix E -Genetic Testing CPT/ HCPCS Codes Description Auth required Y or N Mod Service Limits Age Limits Notes 83890 Molecular diagnostics: molecular isolation or extraction, each nucleic acid type

More information

MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS

MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS Richard L. Hodinka, Ph.D. University of South Carolina School of Medicine Greenville Greenville Health System, Greenville, SC hodinka@greenvillemed.sc.edu

More information

History of DNA Sequencing & Current Applications

History of DNA Sequencing & Current Applications History of DNA Sequencing & Current Applications Christopher McLeod President & CEO, 454 Life Sciences, A Roche Company IMPORTANT NOTICE Intended Use Unless explicitly stated otherwise, all Roche Applied

More information

Automated DNA sequencing 20/12/2009. Next Generation Sequencing

Automated DNA sequencing 20/12/2009. Next Generation Sequencing DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing

More information

Section 12 3 RNA and Protein Synthesis

Section 12 3 RNA and Protein Synthesis Name Class Date Section 12 3 RNA and Protein Synthesis (pages 300 306) Key Concepts What are the three main types of RNA? What is transcription? What is translation? The Structure of RNA (page 300) 1.

More information

DNA Sequencing Troubleshooting Guide

DNA Sequencing Troubleshooting Guide DNA Sequencing Troubleshooting Guide Successful DNA Sequencing Read Peaks are well formed and separated with good quality scores. There is a small area at the beginning of the run before the chemistry

More information

A great video with lots of visuals of plots and how the fluorescent probes work, reviewing this info, is at:

A great video with lots of visuals of plots and how the fluorescent probes work, reviewing this info, is at: REAL- TIME POLYMERASE CHAIN REACTION: This technology has all but replaced Northern blots for determining gene expression in tissues, cells, and organisms with more accuracy and more quantitative capabilities

More information

DNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE

DNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE DNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE We recommend for the sequence visualization the use of software that allows the examination of raw data in order to determine quantitatively how good has

More information

Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix

Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix CLONING & MAPPING DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix LIBRARY PREP FOR NET GEN SEQUENCING PROTEIN

More information

Extraction from Buccal Epithelial Cells

Extraction from Buccal Epithelial Cells Genomic DNA Extraction from Buccal Epithelial Cells The purpose of this lab is to collect a DNA sample from the cells that line the inside of your mouth and to use this sample to explore one of the most

More information

Multiplex your most important

Multiplex your most important Multiplex your most important genetic assays on one platform GenomeLab GeXP Genetic Analysis System Blood Banking Capillary Electrophoresis Centrifugation Flow Cytometry Genomics Lab Automation Lab Tools

More information

Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website

Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website Biomolecular Core Facility AI Dupont Hospital for Children, Rockland Center One, Room 214 Core: (302) 651-6712, Office: (302) 651-6707, mbcore@nemours.org Katia Sol-Church, Ph.D., Director Jennifer Frenck

More information

Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR

Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR BioTechniques 25:415-419 (September 1998) ABSTRACT The determination of unknown DNA sequences around

More information

Description: Molecular Biology Services and DNA Sequencing

Description: Molecular Biology Services and DNA Sequencing Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:

More information

GenScript BloodReady TM Multiplex PCR System

GenScript BloodReady TM Multiplex PCR System GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI

More information