Current Motif Discovery Tools and their Limitations
|
|
|
- Ashley Neal
- 10 years ago
- Views:
Transcription
1 Current Motif Discovery Tools and their Limitations Philipp Bucher SIB / CIG Workshop 3 October 2006
2 Trendy Concepts and Hypotheses Transcription regulatory elements act in a context-dependent manner. The autonomous functional unit is a regulatory region consisting of several transcription factor binding sites. Transcription regulatory regions are recognized by large protein complexes consisting of several DNA binding and non-binding transcription factors The regulation of transcription initiation takes place at different levels: DNA methylation, chromatin remodeling, pre-initiation complex assembly, re-initiation at assembled complexes. Some of the epigenetic regulatory states are inherited through mitosis. Transcription regulatory regions occur everywhere in the genome: in promoters, introns, downstream regions, probably also in coding regions. They may act over very long distances in linear DNA sequence space. Experimental Techniques For Studying Gene Regulatory Elements Promoter mapping experiments: nuclease protection and primer extension analysis. New technologies: RACE, 5 SAGE, CAGE: Reverse genetics: Introduction of mutations into native regulatory regions and study of their effects in experimental gene expression systems (e.g. transfected cells, transgenic organisms) In vitro protein binding experiments: DNA footprinting, electrophoretic mobility shift assays, SELEX experiments In vivo DNA and chromatin structure analysis: DNA methylation, DNAse I sensitivity assay, in vivo footprinting, chromatin IP etc. New technologies: ChIP-chip. Global gene expression profiling of cells, tissues or organisms with transregulatory defects
3 Limitations of Experimental Approaches Transcription regulatory events are not directly observable. Most data or open to different interpretations, for instance: Expression conditions in a reverse genetics experiment (e.g. DNA and protein concentrations) may not resemble physiological conditions. A cis-regulatory element binding a particular protein in vitro may not bind the same protein in vivo. Point mutations leading to lower transcription rates my be explained by: (i) the destruction of an activator element, (ii) the accidental creation of a repressor element. Some data require advanced computational tools in order to be converted into a testable hypothesis. Known hard problems are: The derivation of a transcription factor binding site predictor from a set of example sequences The extraction of a regulatory network from a set of gene expression profiles Computational Approaches to Gene Regulatory elements Commonly addressed problems and corresponding bottlenecks: Finding a common sequence motif in a set of sequences known to contain a binding site to the same transcription factor or to confer the same regulatory property to an adjacent gene. Bottleneck: appropriate data sets, computer algorithms. New perspective: ChIP-chip data. Identification of sequence motifs that are over-represented at a particular distance from transcription initiation sites. Bottleneck: large sets of experimentally mapped promoters. Hope comes from mass mass genome annotation (MGA) data (CAGE, etc.). Identification of transcription factor binding sites and other sequence elements in DNA regulatory sequences. Bottleneck: accurate and reliable motif descriptions. Development of promoter prediction algorithms. Current bottleneck: large sets of experimentally mapped promoters. Perspective: MGA data. Identification and interpretation of conserved non-coding sequence regions between orthologous genes of related organisms. Current bottleneck: concepts and models of gene regulatory regions.
4 Transcription Factor Binding Sites: Features and Facts Degenerate sequence motifs Typical length: 6-20 bp Low information content: 8-12 bits (1 site per bp) Quantitative recognition mechanism: measurable affinity of different sites may vary over three orders of magnitude Regulatory function often depends on cooperative interactions with neighboring sites Representation of sequence motifs, domains, and families
5 Weight matrices Position specific scoring matrices A weight matrix or position-specific scoring matrix (PSSM) is a table of numbers containing scores for each residue at each position of a fixed-length (gap-free) motif. There are two types of numerical representations: frequency matrix: reflects position-dependent frequencies of residues Scoring matrix: contains additive weights for computing a match score Weigh matrices or PSSMs are quantitative, fixed-length motif descriptors. Unlike regular expressions, they can distinguish between mild and severe mismatches. For qualitative definition of a match, a cut-off score needs to be defined. Title
6 It is not always easy to guess were the binding sites to a transcription factor are located in DNA sequences which are somewhat longer than the actual binding sites Algorithms for defining weight matrices Word counting algorithms (for ab initio discovery of consensus sequences) Chose word length, define number of allowed mismatches Count number of occurrences of each word in input sequences, most frequent words are motif candidates Iterative refinement algorithms: 1. Starting with a consensus sequence-like matrix (same score for all matches, same score for all mismatches) find best match(es) in each input sequences. 2. Compile new set of putative matches, derive frequency matrix, compute score, and repeat step 1 with new matrix 3. Iterate step 1 and 2 until the matrix does not change anymore.
7 Motif discovery algorithms details. Computation of log-odds scores from base counts: w bi ( n = log bi + 1) /( N e b i + 4) n bi denotes the number of bases b at position i, N i the total number of bases at position i, and e b the expected fraction of bases b, usually estimated from the base composition of the input sequences. Variants of the iterative alignment procedure: Expectation-Maximization: Instead of picking the best motif of within a sequence, compute motif probability scores for each subsequence and take weighted average over subsequences (useful in case of two equally good motif occurrences) Gibbs-sampling: Instead of taking the best motif per sequence, choose randomly one of the most probable, according to probability distribution (may overcome local optimum problem) Motif discovery a multiple local alignment problem The motif discovery problem may be viewed as a multiple local alignment problem: For a given set of input sequences: Find one or several un-gapped multiple alignments (sets of fixed-length sequences) minimizing the entropy function. Constraints about motif occurrences: Each motif must occur exactly once, at most once, or one or several times per sequence.
8 Limitations of Motif Discovery Algorithms A recent papers show that computational motif discovery is disappointingly ineffective:
9 Bad Performance indices used by Tompa et. al Bad Performance of Motif Discovery algorithms on Eukaryotic Benchmark Data Sets (Results from Tompa et. al. 2005)
10 Similar results are obtained with prokaryotic benchmark datasets Modeling of a Transcription Factor Binding Site from High Throughput SELEX Data Using a Hidden Markov Modeling Approach Emmanuelle Roulet, Nicolas Mermod (Center for biotechnology UNIL- EPFL, Lausanne, Switzerland) Anamaria A Camargo, Andrew JG Simpson (Ludwig Institute of Cancer Research, Sao Paulo, Brazil) Philipp Bucher (Swiss Institute for Experimental Cancer Research and Swiss Institute of Bioinformatics, Epalinges s/lausanne, Switzerland) Nat. Biotechnol. 20, (2002)
11 Motivation and Goals of the Project Motivation: Accurate and reliable computational tools to predict transcription factor binding sites are still not available. Potential reasons: 1. Lack of adequate experimental data 2. Lack of adequate computational models 3. Lack of an adequate method to estimate the parameters of a computational model from the experimental data Goal: To develop a combined computational-experimental protocol to derive an accurate predictive model of the sequence specificity of a DNA-binding protein Potential benefits: 1. Being able to predict transcription factor binding in genome sequences. 2. Insights into molecular mechanisms of sequence-specific protein-dna interactions 3. Ability to rationally design gene control regions of desired properties for biotechnological applications Our Approach to the Problem of Characterizing the Sequence-Specificity of a DNA Binding Transcription Factor 1. Choice of a quantitative predictive model for representing the binding specificity. Our choice: a profile-hmm 2. Choice of an experimental method to generate data for estimating the model parameters. Our choice: a SELEX experiment 3. Choice of a machine learning algorithm to estimate the model parameters from the data. Our choice: the Baum-Welch HMM training algorithm 4. Validation of the approach and optimization of the experimental parameters by a computer simulation of step 2 and 3 5. Adjustment of experimental protocol to produce the necessary data as suggested by the computer simulation 6. Generation of the experimental data 7. Building a binding site model from the data 8. A posteriori validation of the model by cross-validation and comparison with independent experimental results
12 Old CTF/NFI Binding Site Profile Example: TGGGCATATAGCCAC Score: = 88 Random sequence library 5 TCCATCTCTTCTGTATGTCGAGATCTA.N(25).TAGATCTCCTAACCGACTCCGTTAATT-3 Primer 1 Second strand synthesis by pcr Bgl II Bgl II 5 TCCATCTCTTCTGTATGTCGAGATCTA.N(25).TAGATCTCCTAACCGACTCCGTTAATT-3 3 AGGTAGAGAAGACATACAGATCTAGAT.N(25).ATCTAGAGGATTGGCTGAGGCAATTAA-5 Selection of binding sequences (gel shift) Primer 2 Amplification Selection cycles Digestion Bgl II 5 GATCTA..N(25)..TA AT..N(25)..TACTAG-3 Concatemerization and cloning 5 -GATCTA N(25) TAGATCTA N(25) TAGATCTA N(25) TA AT N(25) ATCTAGAT N(25) ATCTAGAT N(25) ATCTAG-3 site 1 site 2 site 3 HTS sequencing
13
14
15 Quality Assessment of the New Model: Comparison of Predicted Binding Scores with in vitro measured Binding Constants Data from Meisterernst et al. (1988). Nucl. Acids Res. 16,
Interaktionen von Nukleinsäuren und Proteinen
Sonja Prohaska Computational EvoDevo Universitaet Leipzig June 9, 2015 DNA is never naked in a cell DNA is usually in association with proteins. In all domains of life there are small, basic chromosomal
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
How many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
Genetomic Promototypes
Genetomic Promototypes Mirkó Palla and Dana Pe er Department of Mechanical Engineering Clarkson University Potsdam, New York and Department of Genetics Harvard Medical School 77 Avenue Louis Pasteur Boston,
Integrating DNA Motif Discovery and Genome-Wide Expression Analysis. Erin M. Conlon
Integrating DNA Motif Discovery and Genome-Wide Expression Analysis Department of Mathematics and Statistics University of Massachusetts Amherst Statistics in Functional Genomics Workshop Ascona, Switzerland
T cell Epitope Prediction
Institute for Immunology and Informatics T cell Epitope Prediction EpiMatrix Eric Gustafson January 6, 2011 Overview Gathering raw data Popular sources Data Management Conservation Analysis Multiple Alignments
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh
MORPHEUS. http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix.
MORPHEUS http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix. Reference: MORPHEUS, a Webtool for Transcripton Factor Binding Analysis Using
A Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
LabGenius. Technical design notes. The world s most advanced synthetic DNA libraries. [email protected] V1.5 NOV 15
LabGenius The world s most advanced synthetic DNA libraries Technical design notes [email protected] V1.5 NOV 15 Introduction OUR APPROACH LabGenius is a gene synthesis company focussed on the design and manufacture
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
Forensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
RT 2 Profiler PCR Array: Web-Based Data Analysis Tutorial
RT 2 Profiler PCR Array: Web-Based Data Analysis Tutorial Samuel J. Rulli, Jr., Ph.D. qpcr-applications Scientist [email protected] Pathway Focused Research from Sample Prep to Data Analysis! -2-
Focusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
Activity 7.21 Transcription factors
Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation
FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem
FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem Elsa Bernard Laurent Jacob Julien Mairal Jean-Philippe Vert September 24, 2013 Abstract FlipFlop implements a fast method for de novo transcript
Next Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University [email protected] http://tandem.bu.edu/ The Human Genome Project took
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
BBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS
BBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS 1. The Technology Strategy sets out six areas where technological developments are required to push the frontiers of knowledge
Data Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
Introduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 [email protected]
Protein Protein Interaction Networks
Functional Pattern Mining from Genome Scale Protein Protein Interaction Networks Young-Rae Cho, Ph.D. Assistant Professor Department of Computer Science Baylor University it My Definition of Bioinformatics
Bioinformatics Grid - Enabled Tools For Biologists.
Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
Comparing Methods for Identifying Transcription Factor Target Genes
Comparing Methods for Identifying Transcription Factor Target Genes Alena van Bömmel (R 3.3.73) Matthew Huska (R 3.3.18) Max Planck Institute for Molecular Genetics Folie 1 Transcriptional Regulation TF
Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: [email protected].
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: [email protected] What is Gene Expression & Gene Regulation? 1. Gene Expression
Chapter 18 Regulation of Gene Expression
Chapter 18 Regulation of Gene Expression 18.1. Gene Regulation Is Necessary By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection
Real-time PCR: Understanding C t
APPLICATION NOTE Real-Time PCR Real-time PCR: Understanding C t Real-time PCR, also called quantitative PCR or qpcr, can provide a simple and elegant method for determining the amount of a target sequence
Bio-Informatics Lectures. A Short Introduction
Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively
Next Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
GenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
Essentials of Real Time PCR. About Sequence Detection Chemistries
Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected
The world of non-coding RNA. Espen Enerly
The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often
Complex multicellular organisms are produced by cells that switch genes on and off during development.
Home Control of Gene Expression Gene Regulation Is Necessary? By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring
Interaktionen von RNAs und Proteinen
Sonja Prohaska Computational EvoDevo Universitaet Leipzig June 9, 2015 Studying RNA-protein interactions Given: target protein known to bind to RNA problem: find binding partners and binding sites experimental
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
Core Facility Genomics
Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray
Faculty of Medicine. Settore disciplinare: BIO/10. functional domains. Monica Soldi. IFOM-IEO Campus, Milan. Matricola n. R08407
PhD degree in Molecular Medicine European School of Molecular Medicine (SEMM), University of Milan and University of Naples Federico II Faculty of Medicine Settore disciplinare: BIO/10 Establishment and
Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.
Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.
BIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16
Course Director: Dr. Barry Grant (DCM&B, [email protected]) Description: This is a three module course covering (1) Foundations of Bioinformatics, (2) Statistics in Bioinformatics, and (3) Systems
Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University
Genotyping by sequencing and data analysis Ross Whetten North Carolina State University Stein (2010) Genome Biology 11:207 More New Technology on the Horizon Genotyping By Sequencing Timeline 2007 Complexity
Biological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
A Brief Introduction on DNase-Seq Data Aanalysis
A Brief Introduction on DNase-Seq Data Aanalysis Hashem Koohy, Thomas Down, Mikhail Spivakov and Tim Hubbard Spivakov s and Fraser s Lab September 13, 2014 1 Introduction DNaseI is an enzyme which cuts
Control of Gene Expression
Home Gene Regulation Is Necessary? Control of Gene Expression By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring
Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes
Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes 2.1 Introduction Large-scale insertional mutagenesis screening in
Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
MicroRNA formation. 4th International Symposium on Non-Surgical Contraceptive Methods of Pet Population Control
MicroRNA formation mirna s are processed from several precursor stages Mammalian genomes seem to have 100 s of mirna s Nucleotides in positions 2-8 of an mirna are considered the mirna seed 5 Methyl-G
Hidden Markov Models in Bioinformatics. By Máthé Zoltán Kőrösi Zoltán 2006
Hidden Markov Models in Bioinformatics By Máthé Zoltán Kőrösi Zoltán 2006 Outline Markov Chain HMM (Hidden Markov Model) Hidden Markov Models in Bioinformatics Gene Finding Gene Finding Model Viterbi algorithm
Control of Gene Expression
Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure
13.4 Gene Regulation and Expression
13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.
MUTATION, DNA REPAIR AND CANCER
MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful
Answer Key Problem Set 5
7.03 Fall 2003 1 of 6 1. a) Genetic properties of gln2- and gln 3-: Answer Key Problem Set 5 Both are uninducible, as they give decreased glutamine synthetase (GS) activity. Both are recessive, as mating
Mir-X mirna First-Strand Synthesis Kit User Manual
User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.
Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics
Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics Christopher Benner, PhD Director, Integrative Genomics and Bioinformatics Core (IGC) idash Webinar,
Bioinformatics Unit Department of Biological Services. Get to know us
Bioinformatics Unit Department of Biological Services Get to know us Domains of Activity IT & programming Microarray analysis Sequence analysis Bioinformatics Team Biostatistical support NGS data analysis
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
GENE REGULATION. Teacher Packet
AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures
When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want
1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very
Guide for Bioinformatics Project Module 3
Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first
Comparative genomic hybridization Because arrays are more than just a tool for expression analysis
Microarray Data Analysis Workshop MedVetNet Workshop, DTU 2008 Comparative genomic hybridization Because arrays are more than just a tool for expression analysis Carsten Friis ( with several slides from
European Medicines Agency
European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
Introduction To Epigenetic Regulation: How Can The Epigenomics Core Services Help Your Research? Maria (Ken) Figueroa, M.D. Core Scientific Director
Introduction To Epigenetic Regulation: How Can The Epigenomics Core Services Help Your Research? Maria (Ken) Figueroa, M.D. Core Scientific Director Gene expression depends upon multiple factors Gene Transcription
Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes
Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes Outlines Brief introduction of OriGene s mission on gene-centric product solution. TrueMAB monoclonal antibody
Becker Muscular Dystrophy
Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency
Probabilistic methods for post-genomic data integration
Probabilistic methods for post-genomic data integration Dirk Husmeier Biomathematics & Statistics Scotland (BioSS) JMB, The King s Buildings, Edinburgh EH9 3JZ United Kingdom http://wwwbiossacuk/ dirk
Algorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Susan Carson Heather B. Miller D.Scott Witherow ELSEVIER AMSTERDAM BOSTON HEIDELBERG LONDON NEW YORK OXFORD PARIS SAN DIEGO SAN
Core Bioinformatics. Degree Type Year Semester. 4313473 Bioinformàtica/Bioinformatics OB 0 1
Core Bioinformatics 2014/2015 Code: 42397 ECTS Credits: 12 Degree Type Year Semester 4313473 Bioinformàtica/Bioinformatics OB 0 1 Contact Name: Sònia Casillas Viladerrams Email: [email protected]
Site-Directed Nucleases and Cisgenesis Maria Fedorova, Ph.D.
Site-Directed Nucleases and Cisgenesis Maria Fedorova, Ph.D. Regulatory Strategy Lead Enabling Technologies DuPont-Pioneer, USA 1 New Plant Breeding Techniques 2007 New Techniques Working Group established
An Introduction to the Use of Bayesian Network to Analyze Gene Expression Data
n Introduction to the Use of ayesian Network to nalyze Gene Expression Data Cristina Manfredotti Dipartimento di Informatica, Sistemistica e Comunicazione (D.I.S.Co. Università degli Studi Milano-icocca
RNA Viruses. A Practical Approac h. Alan J. Cann
RNA Viruses A Practical Approac h Alan J. Cann List of protocols page xiii Abbreviations xvii Investigation of RNA virus genome structure 1 A j. Easton, A.C. Marriott and C.R. Pringl e 1 Introduction-the
SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications
Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each
Introduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS
BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:
Cancer SBL101. James Gomes School of Biological Sciences Indian Institute of Technology Delhi
Cancer SBL101 James Gomes School of Biological Sciences Indian Institute of Technology Delhi All Figures in this Lecture are taken from 1. Molecular biology of the cell / Bruce Alberts et al., 5th ed.
Pairwise Sequence Alignment
Pairwise Sequence Alignment [email protected] SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What
Searching Nucleotide Databases
Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames
ChIP TROUBLESHOOTING TIPS
ChIP TROUBLESHOOTING TIPS Creative Diagnostics Abstract ChIP dissects the spatial and temporal dynamics of the interactions between chromatin and its associated factors CD Creative Diagnostics info@creative-
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID papillary renal cell carcinoma (translocation-associated) PRCC Human This gene
BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls?
BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? Giovanni Luca Scaglione, PhD ------------------------ Laboratory of Clinical Molecular Diagnostics and Personalized Medicine, Institute
Biotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
Chapter 6 DNA Replication
Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore
An Overview of DNA Sequencing
An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure
Web-Based Genomic Information Integration with Gene Ontology
Web-Based Genomic Information Integration with Gene Ontology Kai Xu 1 IMAGEN group, National ICT Australia, Sydney, Australia, [email protected] Abstract. Despite the dramatic growth of online genomic
New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.
New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System
restriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)
Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur
