Comparative Genomics. Bing Zhang. Department of Biomedical Informatics Vanderbilt University
|
|
- Raymond Melton
- 7 years ago
- Views:
Transcription
1 Comparative Genomics Bing Zhang Department of Biomedical Informatics Vanderbilt University
2 Genome and genome project Genome: the complete genetic material of an organism. E. coli genome: 4.7 million base pairs of DNA Human genome: 3 billion base pairs of DNA (~3G) Encodes heritable characteristics Genome project: scientific endeavors that ultimately aim to determine the complete genome sequence of an organism 2
3 Completely sequenced genomes Human genome project 3
4 A gene for truckers Genome function Microarray RNA-seq Proteomics Comparative genomics 4
5 Comparative genomics Comparative genomics Analysis and comparison of genomes from different species Underlying hypothesis Genomes under examination had a common ancestor and, therefore, every base pair in each organism can be explained as the combination of this original ancestral genome and the action of evolution Applications Relationship among species Functional sequences 5
6 Genome evolution and functional sequence Genome evolution Negative selection: the removal of deleterious mutations from a population (purifying selection) Positive selection: the retention of mutations that benefit an organism Genome function Functional sequences are subject to evolutionary selection, which can leave a signature in the aligned sequences neutral advantageous disadvantageous 6
7 Homolog, ortholog, paralog Contemporary org Speciation Speciation Intermediate org Gene duplication Homolog: two sequences that share a common evolutionary ancestry Ortholog: homologous sequences in different species that arose from a common ancestral gene during speciation. Orthologs often, but not always, have the same function. Paralog: homologous sequences that arose by gene duplication. Paralogous sequences provide useful insight to the way genomes evolve. Ancestral org 7
8 Detecting orthologous genes Best reciprocal Blast hit Lose of FOXJ2 in the fish lineage g1_a g1_b g1_a g1_b FOXJ2 g2_a g2_b g2_a g2_b Phylogenetic tree of the gene family Combine reciprocal best matches with surrounding genomic information, e.g. neighbor genes FOXJ3 FOXJ3 duplication in the fish lineage 8 Hubbard et al. NAR 35:D610, 2007
9 Synteny conservation Synteny: the occurrence of two or more gene loci on the same chromosome, regardless of whether or not they are genetically linked. Conserved synteny: preserved co-localization of genes on chromosomes of related species. Mouse Genome Sequencing Consortium. Nature 420:520,
10 Conserved Synteny Human Chr1 Chimpanzee (5 million years) Mouse (75-80 million years) Human-mouse: Conserved synteny at a higher degree than expected, with very little micro-rearrangement, and up to 95% conserved synteny. Human-fly: limited if any conserved syntenic stretches, possibly only those due to functional constraints, e.g. Hox cluster. 10
11 COG: Classify proteins encoded in complete genomes on the basis of the orthology concept COG (Clusters of Orthologous Groups of proteins): prokaryotes and unicellular eukaryotes KOG: eukaryotic orthologous groups Allows one to transfer functional information from experimentally characterized proteins to their orthologs from poorly studied organisms 11
12 KEGG: TCA cycle, E. coli TCA cycle, yeast TCA cycle, reference pathway TCA cycle, Dog 12
13 Evolution of orthologs: Ka/Ks Align the cdna sequences in accordance with their pairwise amino acid alignments Synonymous mutation: mutations that do not cause an amino acid replacement, e.g. AGG (Arginine) -> AGA (Arginine) Nonsynonymous mutation: mutations that result in amino acid replacements, e.g. AGG (Arginine) -> AGC (Serine) Ka/Ks ratio: Ratio between the rates of nonsynonymous mutations and synonymous mutations Indicator of selective pressure acting on a protein-coding gene Ortholog pairs generally have low values of Ka/Ks (<0.05) Proteins with Ka/Ks>1 are usually defined as being subject to positive selection 13
14 Positive selection Human-chimp comparison, positive selection Immune response Human-chimp-mouse comparison, positive selection in human lineage (Clark et al. Science 302:1960, 2003) Null hypothesis: all three branches have two classes of amino acid residues, those are neutrally evolving (Ka/Ks=1) and those that are under negative selection (Ka/Ks<1) Alternative hypothesis: human lineage have a subset of sites with accelerated amino acid substitution (Ka/Ks>1) 1,547 genes: Neurogenesis, Speech etc. 14
15 Proteins are not enough to explain the diversity Human-mouse (Mouse Genome Sequencing Consortium. Nature 420:520, 2002) 99% of the protein coding genes in mouse align with homologs in human 80% of the protein coding mouse genes have clear 1:1 human orthologs Yeast-worm-fly (Rubin et al. Science 287:2204, 2000) Non-redundant protein sets Yeast: 4,383 Worm: 9,453 Fly: 8,065 15
16 Whole genome alignment Needleman and Wunsch and Smith-Waterman are not appropriate Tools Can t handle rearranged sequences Time and memory usage expensive Local aligners: BLASTZ, BLAT Global aligners: AVID, LAGAN Three steps Seeding Extension/anchoring Gapped alignment Ureta-Vidal et al. Nat Rev Genet 4:251,
17 Pre-computed alignments UCSC genome browser: Ensembl: Phenylalanine hydroxylase (PAH): deficiency of this enzyme activity results in the autosomal recessive disorder phenylketonuria (PKU). 17 Miller et al. Genome Res 17:1797, 2007
18 Proportion of genome under purifying selection Not all the aligning DNA is functional, especially when the phylogenetic separation is not huge 40% of the human genome aligns with the mouse genome, including ancestral repeats (Presumed nonfunctional) Compare the quality of the alignments to those in the ancestral repeats (provides an estimation of the neutral rate of substitution) 5% of the human genome is under purifying selection: three times larger than the portion coding for proteins (Mouse Genome Sequencing Consortium. Nature 420:520, 2002) Sequences involved in regulation of gene expression Noncoding RNA 18
19 Composition of conserved sequence elements The proportion of conserved sequences not assigned to a transcript (CDS, 5 UTR, 3 UTR) is growing with increasing organism complexity. In human, nearly 70% of conserved element are not corresponding to any transcript, and therefore potentially control elements. Siepel et al. Genome Res. 15:1034,
20 Phylogenetic footprinting cis-regulatory elements: a region of DNA or RNA that regulates the expression of genes located on that same strand. Phylogenetic footprinting: An approach that seeks to identify conserved regulatory elements by comparing genomic sequences between related species. Decide on the gene of interest. Carefully choose species with orthologous genes. Decide on the length of the upstream or maybe downstream region to be looked at. Align the sequences. Look for conserved regions and analyze them. 20
21 Phylogenetic footprinting Decide on the gene of interest (SHH, sonic hedgehog: misexpression may lead to a common human limb malformation: preaxial polydactyly. ). Carefully choose species with orthologous genes (mouse-fugu). Decide on the length of the upstream or maybe downstream region to be looked at (may be very long). Align the sequences. Look for conserved regions and analyze them. Boffelli, et al. Nature Rev Genet 5:456,
22 Phylogenetic footprinting Four species of yeast (Kellis et al. Nature 423:241, 2003) Human, mouse, rat, dog (Xie et al. Nature 434:338, 2005) Kellis et al. Nature 423:241,
23 Non-coding RNAs trna, rrna micrornas (18-25nt): gene expression control Small RNAs: snornas, smrnas, pirnas, etc., cell machinery Long ncrnas (>200nt): Not very well known 23
24 Regulated expression of ultraconserved ncrnas HCC: hepatocellular carcinomas CRC: colorectal carcinomas CLL: leukemias Calin et al. Cancer Cell 12:215,
25 UCSC Genome Browser: _at 25
26 Summary Comparative genomics Genome evolution Genome function Ortholog vs paralog Conserved synteny Ka/Ks ratio and positive selection Whole genome alignment Conserved non-coding region Phylogenetic footprinting Non-coding RNA Hardison. PLoS Biol 1:156,
Human Genome Organization: An Update. Genome Organization: An Update
Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion
More informationRETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
More informationThe world of non-coding RNA. Espen Enerly
The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often
More informationWorksheet - COMPARATIVE MAPPING 1
Worksheet - COMPARATIVE MAPPING 1 The arrangement of genes and other DNA markers is compared between species in Comparative genome mapping. As early as 1915, the geneticist J.B.S Haldane reported that
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
More informationName Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
More informationDNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
More informationBIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16
Course Director: Dr. Barry Grant (DCM&B, bjgrant@med.umich.edu) Description: This is a three module course covering (1) Foundations of Bioinformatics, (2) Statistics in Bioinformatics, and (3) Systems
More informationHuman Genome and Human Genome Project. Louxin Zhang
Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular
More informationYale Pseudogene Analysis as part of GENCODE Project
Sanger Center 2009.01.20, 11:20-11:40 Mark B Gerstein Yale Illustra(on from Gerstein & Zheng (2006). Sci Am. (c) Mark Gerstein, 2002, (c) Yale, 1 1Lectures.GersteinLab.org 2007bioinfo.mbb.yale.edu Yale
More informationPairwise Sequence Alignment
Pairwise Sequence Alignment carolin.kosiol@vetmeduni.ac.at SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What
More information13.4 Gene Regulation and Expression
13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.
More informationSystematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh
More informationGenetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
More information1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
More informationHuman-Mouse Synteny in Functional Genomics Experiment
Human-Mouse Synteny in Functional Genomics Experiment Ksenia Krasheninnikova University of the Russian Academy of Sciences, JetBrains krasheninnikova@gmail.com September 18, 2012 Ksenia Krasheninnikova
More informationCCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
More informationOutline. MicroRNA Bioinformatics. microrna biogenesis. short non-coding RNAs not considered in this lecture. ! Introduction
Outline MicroRNA Bioinformatics Rickard Sandberg Dept. of Cell and Molecular Biology (CMB) Karolinska Institutet! Introduction! microrna target site prediction! Useful resources 2 short non-coding RNAs
More informationIntroduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov
More informationProtein Sequence Analysis - Overview -
Protein Sequence Analysis - Overview - UDEL Workshop Raja Mazumder Research Associate Professor, Department of Biochemistry and Molecular Biology Georgetown University Medical Center Topics Why do protein
More informationIntroduction to Phylogenetic Analysis
Subjects of this lecture Introduction to Phylogenetic nalysis Irit Orr 1 Introducing some of the terminology of phylogenetics. 2 Introducing some of the most commonly used methods for phylogenetic analysis.
More informationBIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS
BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:
More informationChapter 6 DNA Replication
Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore
More informationGene mutation and molecular medicine Chapter 15
Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to
More informationMAKING AN EVOLUTIONARY TREE
Student manual MAKING AN EVOLUTIONARY TREE THEORY The relationship between different species can be derived from different information sources. The connection between species may turn out by similarities
More informationPROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org
BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,
More informationFrom DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
More informationA Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
More informationDNA Sequence Alignment Analysis
Analysis of DNA sequence data p. 1 Analysis of DNA sequence data using MEGA and DNAsp. Analysis of two genes from the X and Y chromosomes of plant species from the genus Silene The first two computer classes
More informationFocusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
More informationNote: This document wh_informatics_practical.doc and supporting materials can be downloaded at
Woods Hole Zebrafish Genetics and Development Bioinformatics/Genomics Lab Ian Woods Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at http://faculty.ithaca.edu/iwoods/docs/wh/
More informationAmazing DNA facts. Hands-on DNA: A Question of Taste Amazing facts and quiz questions
Amazing DNA facts These facts can form the basis of a quiz (for example, how many base pairs are there in the human genome?). Students should be familiar with most of this material, so the quiz could be
More informationGenetics Lecture Notes 7.03 2005. Lectures 1 2
Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several
More informationGene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
More informationThymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown
1 DNA Coloring - Transcription & Translation Transcription RNA, Ribonucleic Acid is very similar to DNA. RNA normally exists as a single strand (and not the double stranded double helix of DNA). It contains
More informationGuide for Bioinformatics Project Module 3
Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first
More informationDNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
More informationBio 102 Practice Problems Genetic Code and Mutation
Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine
More informationExercises for the UCSC Genome Browser Introduction
Exercises for the UCSC Genome Browser Introduction 1) Find out if the mouse Brca1 gene has non-synonymous SNPs, color them blue, and get external data about a codon-changing SNP. Skills: basic text search;
More informationAP Biology Essential Knowledge Student Diagnostic
AP Biology Essential Knowledge Student Diagnostic Background The Essential Knowledge statements provided in the AP Biology Curriculum Framework are scientific claims describing phenomenon occurring in
More informationPhylogenetic Trees Made Easy
Phylogenetic Trees Made Easy A How-To Manual Fourth Edition Barry G. Hall University of Rochester, Emeritus and Bellingham Research Institute Sinauer Associates, Inc. Publishers Sunderland, Massachusetts
More informationBioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
More informationBiological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
More informationAmino Acids and Their Properties
Amino Acids and Their Properties Recap: ss-rrna and mutations Ribosomal RNA (rrna) evolves very slowly Much slower than proteins ss-rrna is typically used So by aligning ss-rrna of one organism with that
More informationLab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS
Lab 2/Phylogenetics/September 16, 2002 1 Read: Tudge Chapter 2 PHYLOGENETICS Objective of the Lab: To understand how DNA and protein sequence information can be used to make comparisons and assess evolutionary
More informationBiology Final Exam Study Guide: Semester 2
Biology Final Exam Study Guide: Semester 2 Questions 1. Scientific method: What does each of these entail? Investigation and Experimentation Problem Hypothesis Methods Results/Data Discussion/Conclusion
More informationLecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.au What is Gene Expression & Gene Regulation? 1. Gene Expression
More informationAlgorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
More informationGene Switches A Model
Gene Switches A Model Abstract Conceptually, how genetic switches function and their role in the process of evolution, can be difficult for students to visualize. Gene Switches A Model attempts to make
More informationIntroduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
More informationMUTATION, DNA REPAIR AND CANCER
MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful
More informationBasic Concepts of DNA, Proteins, Genes and Genomes
Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate
More informationAP Biology 2015 Free-Response Questions
AP Biology 2015 Free-Response Questions College Board, Advanced Placement Program, AP, AP Central, and the acorn logo are registered trademarks of the College Board. AP Central is the official online home
More informationGene Therapy and Genetic Counseling. Chapter 20
Gene Therapy and Genetic Counseling Chapter 20 What is Gene Therapy? Treating a disease by replacing, manipulating or supplementing a gene The act of changing an individual s DNA sequence to fix a non-functional
More informationBioinformatics Grid - Enabled Tools For Biologists.
Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis
More informationPRACTICE TEST QUESTIONS
PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.
More informationThe sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:
Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How
More informationCore Bioinformatics. Degree Type Year Semester. 4313473 Bioinformàtica/Bioinformatics OB 0 1
Core Bioinformatics 2014/2015 Code: 42397 ECTS Credits: 12 Degree Type Year Semester 4313473 Bioinformàtica/Bioinformatics OB 0 1 Contact Name: Sònia Casillas Viladerrams Email: Sonia.Casillas@uab.cat
More informationBioBoot Camp Genetics
BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before
More informationModule 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.
Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.
More informationINTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
More informationSequence Analysis 15: lecture 5. Substitution matrices Multiple sequence alignment
Sequence Analysis 15: lecture 5 Substitution matrices Multiple sequence alignment A teacher's dilemma To understand... Multiple sequence alignment Substitution matrices Phylogenetic trees You first need
More informationCurrent Motif Discovery Tools and their Limitations
Current Motif Discovery Tools and their Limitations Philipp Bucher SIB / CIG Workshop 3 October 2006 Trendy Concepts and Hypotheses Transcription regulatory elements act in a context-dependent manner.
More informationSample Questions for Exam 3
Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.
More informationComputational localization of promoters and transcription start sites in mammalian genomes
Computational localization of promoters and transcription start sites in mammalian genomes Thomas Down This dissertation is submitted for the degree of Doctor of Philosophy Wellcome Trust Sanger Institute
More informationTranslation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
More informationName Class Date. binomial nomenclature. MAIN IDEA: Linnaeus developed the scientific naming system still used today.
Section 1: The Linnaean System of Classification 17.1 Reading Guide KEY CONCEPT Organisms can be classified based on physical similarities. VOCABULARY taxonomy taxon binomial nomenclature genus MAIN IDEA:
More informationModule 10: Bioinformatics
Module 10: Bioinformatics 1.) Goal: To understand the general approaches for basic in silico (computer) analysis of DNA- and protein sequences. We are going to discuss sequence formatting required prior
More informationA and B are not absolutely linked. They could be far enough apart on the chromosome that they assort independently.
Name Section 7.014 Problem Set 5 Please print out this problem set and record your answers on the printed copy. Answers to this problem set are to be turned in to the box outside 68-120 by 5:00pm on Friday
More informationGene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook)
Name Date Per Look at the diagrams, then answer the questions. Gene Mutations affect a single gene by changing its base sequence, resulting in an incorrect, or nonfunctional, protein being made. (a) A
More information2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
More informationMolecular Genetics. RNA, Transcription, & Protein Synthesis
Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and
More informationTeaching Bioinformatics to Undergraduates
Teaching Bioinformatics to Undergraduates http://www.med.nyu.edu/rcr/asm Stuart M. Brown Research Computing, NYU School of Medicine I. What is Bioinformatics? II. Challenges of teaching bioinformatics
More informationStructure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
More informationThe Human Genome Project. From genome to health From human genome to other genomes and to gene function Structural Genomics initiative
The Human Genome Project From genome to health From human genome to other genomes and to gene function Structural Genomics initiative June 2000 What is the Human Genome Project? U.S. govt. project coordinated
More informationMicroRNA Mike needs help to degrade all the mrna transcripts! Aaron Arvey ISMB 2010
Target mrna abundance dilutes microrna and sirna activity MicroRNA Mike needs help to degrade all the mrna transcripts! Aaron Arvey ISMB 2010 Target mrna abundance dilutes microrna and sirna activity Erik
More informationProtein Synthesis How Genes Become Constituent Molecules
Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein
More informationGenetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
More informationEuropean Medicines Agency
European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein
More informationDnaSP, DNA polymorphism analyses by the coalescent and other methods.
DnaSP, DNA polymorphism analyses by the coalescent and other methods. Author affiliation: Julio Rozas 1, *, Juan C. Sánchez-DelBarrio 2,3, Xavier Messeguer 2 and Ricardo Rozas 1 1 Departament de Genètica,
More informationThe Central Dogma of Molecular Biology
Vierstraete Andy (version 1.01) 1/02/2000 -Page 1 - The Central Dogma of Molecular Biology Figure 1 : The Central Dogma of molecular biology. DNA contains the complete genetic information that defines
More informationNetwork Protocol Analysis using Bioinformatics Algorithms
Network Protocol Analysis using Bioinformatics Algorithms Marshall A. Beddoe Marshall_Beddoe@McAfee.com ABSTRACT Network protocol analysis is currently performed by hand using only intuition and a protocol
More informationOkami Study Guide: Chapter 3 1
Okami Study Guide: Chapter 3 1 Chapter in Review 1. Heredity is the tendency of offspring to resemble their parents in various ways. Genes are units of heredity. They are functional strands of DNA grouped
More informationLECTURE 6 Gene Mutation (Chapter 16.1-16.2)
LECTURE 6 Gene Mutation (Chapter 16.1-16.2) 1 Mutation: A permanent change in the genetic material that can be passed from parent to offspring. Mutant (genotype): An organism whose DNA differs from the
More informationProblem Set 5 BILD10 / Winter 2014 Chapters 8, 10-12
Chapter 8: Evolution and Natural Selection 1) A population is: a) a group of species that shares the same habitat. b) a group of individuals of the same species that lives in the same general location
More informationSearching Nucleotide Databases
Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames
More informationEvidence for evolution factsheet
The theory of evolution by natural selection is supported by a great deal of evidence. Fossils Fossils are formed when organisms become buried in sediments, causing little decomposition of the organism.
More informationCD-HIT User s Guide. Last updated: April 5, 2010. http://cd-hit.org http://bioinformatics.org/cd-hit/
CD-HIT User s Guide Last updated: April 5, 2010 http://cd-hit.org http://bioinformatics.org/cd-hit/ Program developed by Weizhong Li s lab at UCSD http://weizhong-lab.ucsd.edu liwz@sdsc.edu 1. Introduction
More information12.1 The Role of DNA in Heredity
12.1 The Role of DNA in Heredity Only in the last 50 years have scientists understood the role of DNA in heredity. That understanding began with the discovery of DNA s structure. In 1952, Rosalind Franklin
More informationProtein Protein Interaction Networks
Functional Pattern Mining from Genome Scale Protein Protein Interaction Networks Young-Rae Cho, Ph.D. Assistant Professor Department of Computer Science Baylor University it My Definition of Bioinformatics
More informationGenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
More informationThe Steps. 1. Transcription. 2. Transferal. 3. Translation
Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order
More informationPrinciples of Evolution - Origin of Species
Theories of Organic Evolution X Multiple Centers of Creation (de Buffon) developed the concept of "centers of creation throughout the world organisms had arisen, which other species had evolved from X
More information4. Why are common names not good to use when classifying organisms? Give an example.
1. Define taxonomy. Classification of organisms 2. Who was first to classify organisms? Aristotle 3. Explain Aristotle s taxonomy of organisms. Patterns of nature: looked like 4. Why are common names not
More informationName: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.
Name: Class: Date: Chapter 17 Practice Multiple Choice Identify the choice that best completes the statement or answers the question. 1. The correct order for the levels of Linnaeus's classification system,
More informationRNA & Protein Synthesis
RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis
More informationHeuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations
Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations AlCoB 2014 First International Conference on Algorithms for Computational Biology Thiago da Silva Arruda Institute
More informationGenomes and SNPs in Malaria and Sickle Cell Anemia
Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing
More informationSpecific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons
Tutorial II Gene expression: mrna translation and protein synthesis Piergiorgio Percipalle, PhD Program Control of gene transcription and RNA processing mrna translation and protein synthesis KAROLINSKA
More informationGenome Explorer For Comparative Genome Analysis
Genome Explorer For Comparative Genome Analysis Jenn Conn 1, Jo L. Dicks 1 and Ian N. Roberts 2 Abstract Genome Explorer brings together the tools required to build and compare phylogenies from both sequence
More information