Amino Acids and Their Properties
|
|
- Valentine Sims
- 7 years ago
- Views:
Transcription
1 Amino Acids and Their Properties
2 Recap: ss-rrna and mutations Ribosomal RNA (rrna) evolves very slowly Much slower than proteins ss-rrna is typically used So by aligning ss-rrna of one organism with that of another We can estimate relatedness
3 Amino Acid Substitutions Recall we can align DNA & RNA sequences What does that mean? We can also align two amino acid sequences Can 2 nucleotides partially match? Can 2 amino acids partially match?
4 Amino Acid Substitutions Aligning sequences Can 2 nucleotides partially match? Are some nucleotide mutations more significant than others? Can 2 amino acids partially match? Are some amino acid mismatches more significant than others?
5 Amino Acid Substitutions Can 2 nucleotides partially match? Significance of a nucleobase mutation Does name matter? Does location matter? Can 2 amino acids partially match? Significance of an amino acid mutation Name? Location?
6 Sequence matching and evolution rate Proteins tend to evolve slower than DNA Many DNA changes have no affect on a protein A changed codon may map to the same amino acid Non-coding DNA changes may have no effect What does this mean for gauging the relatedness of humans and chimpanzees? humans and fish?
7 Sequence matching and evolution rate Ribosomal RNA (rrna) evolves very slowly Much slower than proteins What might rrna matching be good for measuring the relatedness of? humans and chimpanzees? humans and fish? humans and what?
8 Sequence matching and evolution rate Ribosomal RNA (rrna) evolves very slowly Much slower than proteins ss-rrna is typically used (what's that?) However, different regions of ss-rrna mutate at different rates (Ribosome images next)
9 The Ribosome Source: om/articles/ri bosomesfunction.html
10 Ribosomes: diagrams and images...check images.google.com for: Ribosome diagram Ribosome structure Videos includehttp://
11 Recap: ss-rrna and mutations Ribosomal RNA (rrna) evolves very slowly Much slower than proteins ss-rrna is typically used So by aligning ss-rrna of one organism with that of another We can estimate relatedness
12 Relatedness and Mutations Much DNA mutates relatively quickly Much ss-rrna mutates relatively slowly Much protein mutates at intermediate rates Let's focus on protein mutation next
13 Amino acid subsitutions Some amino acids substitutions are more likely than others Why?
14 Amino acid substitutions Some amino acids substitutions are more likely than others Why? Some are closer to others in terms of nucleobase codons Some are closer in terms of resulting protein function
15 Amino acid substitutions II Substituting similar ones is likely to Retain the protein structure and function Substituting dissimilar ones is likely to Change the protein structure and function Similarity of amino acids means what?
16 Amino acid substitutions III Similarity of amino acids means similar physicochemical properties Physicochemical: Concerning the physical and chemical Concerning physical chemistry Physical chemistry: Connecting macroscopic properties of substances with their molecular properties
17 Amino acid physicochemical properties Nonpolar(Hydrophobic) ACFGILMPVW Polar (hydrophilic): NQSTY Aromatic: FHWY (having to do with 6-carbon rings) Basic: HKR Acidic: DE (See By way of contrast, can anyone think of a nonphysicochemical property of some amino acids?
18
19 Aromatic Special type of ring-shaped molecule Characterized by an unusual stabilizing property Aliphatic Non-aromatic
20 Amino acid abbrevs. G=glycine, P=proline, T=threonine, A=alanine,, but why the following?? F=phenylalanine Y=tyrosine N=asparagine Q=glutamine W=tryptophan
21 Scoring protein sequence alignments Simple way: Two matching (identical) amino acids score 1 Two mismatching (non-identical) ones score 0 Goal: maximize % of matching amino acids Works well for very similar sequences Example: CADQH CADPM Alignment score=
22 Scoring protein sequence alignments II Simple way ignores degree of similarity better to account for degree of similarity! Solution: substitution matrices PAM (Accepted Point Mutation, but PAM easier to say than APM ) matrix Developed in 1970s by Margaret Dayhoff PAM1 matrix: answers question, if 1% of the amino acids in a sequence change, at what rates would each amino acid be substituted for each other one?
23 Scoring protein sequence alignments II Substitution matrices PAM (Accepted Point Mutation, but PAM easier to say than APM ) matrix PAM1 matrix: answers question, if 1% of the amino acids in a sequence change, at what rates would each amino acid be substituted for each other one? PAM2 matrix: Not 2%! Rather, 1%, twice What is the difference?
24 Scoring protein sequence alignments II Substitution matrices PAM (Accepted Point Mutation, but PAM easier to say than APM ) matrix PAM1 matrix: answers question, if 1% of the amino acids in a sequence change, at what rates would each amino acid be substituted for each other one? PAM250 matrix: Not 250%, obviously Why obviously? It is 1%, repeated 250 times!
25 Scoring protein sequence alignments II Substitution matrices PAM (Accepted Point Mutation, but PAM easier to say than APM ) matrix PAM1 matrix: answers question, if 1% of the amino acids in a sequence change, at what rates would each amino acid be substituted for each other one? PAM250 matrix: It is 1%, repeated 250 times! BLOSUM matrix is a popular type also
26 Scoring protein sequences: Here is PAM250 source: PAM250 CADQH CADPM Alignment score=?
27 Scoring protein sequences: BLOSUM62 (default in Blast 2.0) Source= nias/seq_analysis/pairwise.html.
28 Why do self substitutions have the highest numbers?
29 Why use PAM, BLOSUM, etc.? Sequence similarity is related to evolutionary distance Simple base matching (match/not) may work ok for closely related organisms humans and chimps, for example Amino acid matching works better as evolutionary distance increases (why?) We d like to be able to assess relatedness of organisms that diverged long ago humans and worms, for example
30 Relatedness Long Ago See images.google.com for domains of life We still are not sure, but the 3-domain system seems likely But cladistics demands binary splits, so 3 domains requires 2 splits, and 2 domains are more related than the 3rd
31 Why use PAM, BLOSUM (II) Organisms that diverged long ago have divergent analogous amino acid sequences Since different amino acid substitutions occur at different frequencies we can measure relatedness back farther e.g. when the fraction of identical amino acids is surprisingly low and the fraction of identical base pairs is even lower
32 Comparing Sequences with PAMs (+ recap)
33 What does PAM mean? PAM is considered an acronym for Point Accepted Mutation Accepted Point Mutation (original) Percent Accepted Mutations A point mutation is a substitution of 1 amino acid for another An accepted mutation is one that is passed down through the generations Will a mutation be accepted if it is helpful? Harmful? Neutral? Helpful in some circumstances, harmful in others?
34 What Does PAM Mean, cont. PAM has two meanings PAM is a unit of evolutionary time PAM is kind of substitution matrix (The meanings are related)
35 PAM as a Unit of Time A PAM is the amount of evolutionary change resulting in: 1 amino acid mutation per 100 amino acids It is an average over >>100 amino acids because mutations have randomness After 1 PAM, will an organism have exactly 1% of its amino acids different from what they started out as?
36
37 PAM, Evolution, and Gaps PAM ignores Insertions Deletions Silent nucleotide substitutions (which are?) PAM counts a change from A to B and back to A as 2 accepted point mutations 2 sequences 200 PAMs apart will have about 25% of amino acids the same!
38 PAM Matrices They describe substitutability of amino acids, based on empirical evidence Empirical = experiential The matrices are derived from repositories of actual homologous sequences A PAM 1 matrix is geared to best compare 2 sequences that are 1 PAM apart A PAM 250 matrix is good for comparing quite diverged sequences PAM 250 matrix is standard
39 Creating a PAM Matrix Let f i be the frequency of amino acid i We express f i as a fraction of the total f i = instances of i. instances of any amino acid Frequencies range from (L) down to (W) The most common amino acid occurs about times more commonly than the least
40 Creating PAM matrix, cont. Determine mutabilities of the amino acids Some amino acids tend to change easily Others not If alanine s mutability is set to 100 Serine s mutability is 117 (highest, 1991 data) Tryptophan s mutability is 25 (lowest, 1991) Let s look more closely at m i...
41 Creating PAM matrix, cont. Mutability is a number Given an evolutionary interval of 1 PAM let m i = # mutations of amino acid i # instances of amino acid i Alternatively, m i = p (an instance of i mutates)
42 Are the formulas on the previous slide identical?
43 Creating PAM matrix, cont. Next, we break m i into constituent m i,j s That is, i mutates, but into j at what rate? Use actual data from observed mutations Populate a matrix of probabilities
44 The Diagonal Values on the matrix diagonal do not really describe i mutating into itself! (In reality, can that happen?) They basically show p (i does not mutate) Thus, the columns add up to 1
45
46 Is the matrix on the last slide Symmetric? Are there about 1% changed?
47 PAM0 What do you think a PAM 0 matrix might look like?
48 PAMn Use matrix multiplication PAM2 = PAM1 x PAM1 PAM3 = PAM2 x PAM1 PAM250? Do it 250 times!
49 PAM What do you imagine a PAM matrix might look sort of like?
50 Logarithmicize Actually, we take logarithms to get the usual matrix from the probability matrices First, build another, reference matrix of expected probabilities Assume all amino acids are equally mutable Also assume they mutate into each other in proportion to their frequencies (I.e., overall amino acid frequencies are maintained, but otherwise they don t care what they mutate into)
51 Logarithmicize Now we have two matrices Make a 3 rd. Each entry is: Observed probability Expected probability we re comparing reality to if mutations were truly random Take the log of each entry to make a 4 th An entry of 1 means 10x more mutations of that type than expected An entry of -1 means what?
52 Carrying On We now use the matrix to measure relative evolutionary distance
Sequence Analysis 15: lecture 5. Substitution matrices Multiple sequence alignment
Sequence Analysis 15: lecture 5 Substitution matrices Multiple sequence alignment A teacher's dilemma To understand... Multiple sequence alignment Substitution matrices Phylogenetic trees You first need
More informationPairwise Sequence Alignment
Pairwise Sequence Alignment carolin.kosiol@vetmeduni.ac.at SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What
More informationRapid alignment methods: FASTA and BLAST. p The biological problem p Search strategies p FASTA p BLAST
Rapid alignment methods: FASTA and BLAST p The biological problem p Search strategies p FASTA p BLAST 257 BLAST: Basic Local Alignment Search Tool p BLAST (Altschul et al., 1990) and its variants are some
More informationTHREE DIMENSIONAL REPRESENTATION OF AMINO ACID CHARAC- TERISTICS
THREE DIMENSIONAL REPRESENTATION OF AMINO ACID CHARAC- TERISTICS O.U. Sezerman 1, R. Islamaj 2, E. Alpaydin 2 1 Laborotory of Computational Biology, Sabancı University, Istanbul, Turkey. 2 Computer Engineering
More informationBio-Informatics Lectures. A Short Introduction
Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively
More informationRNA Structure and folding
RNA Structure and folding Overview: The main functional biomolecules in cells are polymers DNA, RNA and proteins For RNA and Proteins, the specific sequence of the polymer dictates its final structure
More informationClone Manager. Getting Started
Clone Manager for Windows Professional Edition Volume 2 Alignment, Primer Operations Version 9.5 Getting Started Copyright 1994-2015 Scientific & Educational Software. All rights reserved. The software
More informationRETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
More informationSimilarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003
Similarity Searches on Sequence Databases: BLAST, FASTA Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Outline Importance of Similarity Heuristic Sequence Alignment:
More informationPROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org
BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,
More informationThe sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:
Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How
More informationFrom DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
More informationName Class Date. binomial nomenclature. MAIN IDEA: Linnaeus developed the scientific naming system still used today.
Section 1: The Linnaean System of Classification 17.1 Reading Guide KEY CONCEPT Organisms can be classified based on physical similarities. VOCABULARY taxonomy taxon binomial nomenclature genus MAIN IDEA:
More information1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
More informationThe Steps. 1. Transcription. 2. Transferal. 3. Translation
Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order
More informationName Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
More informationThe Central Dogma of Molecular Biology
Vierstraete Andy (version 1.01) 1/02/2000 -Page 1 - The Central Dogma of Molecular Biology Figure 1 : The Central Dogma of molecular biology. DNA contains the complete genetic information that defines
More informationDatabase searching with DNA and protein sequences: An introduction Clare Sansom Date received (in revised form): 12th November 1999
Dr Clare Sansom works part time at Birkbeck College, London, and part time as a freelance computer consultant and science writer At Birkbeck she coordinates an innovative graduate-level Advanced Certificate
More informationNetwork Protocol Analysis using Bioinformatics Algorithms
Network Protocol Analysis using Bioinformatics Algorithms Marshall A. Beddoe Marshall_Beddoe@McAfee.com ABSTRACT Network protocol analysis is currently performed by hand using only intuition and a protocol
More informationMAKING AN EVOLUTIONARY TREE
Student manual MAKING AN EVOLUTIONARY TREE THEORY The relationship between different species can be derived from different information sources. The connection between species may turn out by similarities
More informationGraph theoretic approach to analyze amino acid network
Int. J. Adv. Appl. Math. and Mech. 2(3) (2015) 31-37 (ISSN: 2347-2529) Journal homepage: www.ijaamm.com International Journal of Advances in Applied Mathematics and Mechanics Graph theoretic approach to
More informationConcluding lesson. Student manual. What kind of protein are you? (Basic)
Concluding lesson Student manual What kind of protein are you? (Basic) Part 1 The hereditary material of an organism is stored in a coded way on the DNA. This code consists of four different nucleotides:
More informationIntroduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov
More information6.4 Normal Distribution
Contents 6.4 Normal Distribution....................... 381 6.4.1 Characteristics of the Normal Distribution....... 381 6.4.2 The Standardized Normal Distribution......... 385 6.4.3 Meaning of Areas under
More informationChapter 6 DNA Replication
Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore
More informationProvincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.
Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.
More informationA Step-by-Step Tutorial: Divergence Time Estimation with Approximate Likelihood Calculation Using MCMCTREE in PAML
9 June 2011 A Step-by-Step Tutorial: Divergence Time Estimation with Approximate Likelihood Calculation Using MCMCTREE in PAML by Jun Inoue, Mario dos Reis, and Ziheng Yang In this tutorial we will analyze
More informationPRACTICE TEST QUESTIONS
PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.
More informationBob Jesberg. Boston, MA April 3, 2014
DNA, Replication and Transcription Bob Jesberg NSTA Conference Boston, MA April 3, 2014 1 Workshop Agenda Looking at DNA and Forensics The DNA, Replication i and Transcription i Set DNA Ladder The Double
More informationGenetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
More informationLab # 12: DNA and RNA
115 116 Concepts to be explored: Structure of DNA Nucleotides Amino Acids Proteins Genetic Code Mutation RNA Transcription to RNA Translation to a Protein Figure 12. 1: DNA double helix Introduction Long
More informationSeparation of Amino Acids by Paper Chromatography
Separation of Amino Acids by Paper Chromatography Chromatography is a common technique for separating chemical substances. The prefix chroma, which suggests color, comes from the fact that some of the
More informationChapter 5: The Structure and Function of Large Biological Molecules
Name Period Concept 5.1 Macromolecules are polymers, built from monomers 1. The large molecules of all living things fall into just four main classes. Name them. 2. Circle the three classes that are called
More informationDNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
More informationH H N - C - C 2 R. Three possible forms (not counting R group) depending on ph
Amino acids - 0 common amino acids there are others found naturally but much less frequently - Common structure for amino acid - C, -N, and functional groups all attached to the alpha carbon N - C - C
More informationBLAST. Anders Gorm Pedersen & Rasmus Wernersson
BLAST Anders Gorm Pedersen & Rasmus Wernersson Database searching Using pairwise alignments to search databases for similar sequences Query sequence Database Database searching Most common use of pairwise
More informationBIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS
BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:
More informationIntroduction to Principal Components and FactorAnalysis
Introduction to Principal Components and FactorAnalysis Multivariate Analysis often starts out with data involving a substantial number of correlated variables. Principal Component Analysis (PCA) is a
More informationVector NTI Advance 11 Quick Start Guide
Vector NTI Advance 11 Quick Start Guide Catalog no. 12605050, 12605099, 12605103 Version 11.0 December 15, 2008 12605022 Published by: Invitrogen Corporation 5791 Van Allen Way Carlsbad, CA 92008 U.S.A.
More informationPrinciples of Evolution - Origin of Species
Theories of Organic Evolution X Multiple Centers of Creation (de Buffon) developed the concept of "centers of creation throughout the world organisms had arisen, which other species had evolved from X
More informationMolecular Genetics. RNA, Transcription, & Protein Synthesis
Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and
More informationName: Date: Period: DNA Unit: DNA Webquest
Name: Date: Period: DNA Unit: DNA Webquest Part 1 History, DNA Structure, DNA Replication DNA History http://www.dnaftb.org/dnaftb/1/concept/index.html Read the text and answer the following questions.
More informationHidden Markov Models
8.47 Introduction to omputational Molecular Biology Lecture 7: November 4, 2004 Scribe: Han-Pang hiu Lecturer: Ross Lippert Editor: Russ ox Hidden Markov Models The G island phenomenon The nucleotide frequencies
More informationStructure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
More informationTranslation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
More information13.2 Ribosomes & Protein Synthesis
13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).
More informationLecture 3: Mutations
Lecture 3: Mutations Recall that the flow of information within a cell involves the transcription of DNA to mrna and the translation of mrna to protein. Recall also, that the flow of information between
More informationCALCULATIONS & STATISTICS
CALCULATIONS & STATISTICS CALCULATION OF SCORES Conversion of 1-5 scale to 0-100 scores When you look at your report, you will notice that the scores are reported on a 0-100 scale, even though respondents
More informationDNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
More informationName: Date: Problem How do amino acid sequences provide evidence for evolution? Procedure Part A: Comparing Amino Acid Sequences
Name: Date: Amino Acid Sequences and Evolutionary Relationships Introduction Homologous structures those structures thought to have a common origin but not necessarily a common function provide some of
More informationLab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS
Lab 2/Phylogenetics/September 16, 2002 1 Read: Tudge Chapter 2 PHYLOGENETICS Objective of the Lab: To understand how DNA and protein sequence information can be used to make comparisons and assess evolutionary
More informationEvidence for evolution factsheet
The theory of evolution by natural selection is supported by a great deal of evidence. Fossils Fossils are formed when organisms become buried in sediments, causing little decomposition of the organism.
More informationModule 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.
Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.
More informationFocusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
More informationRegents Biology REGENTS REVIEW: PROTEIN SYNTHESIS
Period Date REGENTS REVIEW: PROTEIN SYNTHESIS 1. The diagram at the right represents a portion of a type of organic molecule present in the cells of organisms. What will most likely happen if there is
More informationBonding & Molecular Shape Ron Robertson
Bonding & Molecular Shape Ron Robertson r2 n:\files\courses\1110-20\2010 possible slides for web\00bondingtrans.doc The Nature of Bonding Types 1. Ionic 2. Covalent 3. Metallic 4. Coordinate covalent Driving
More informationName: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.
Name: Class: Date: Chapter 17 Practice Multiple Choice Identify the choice that best completes the statement or answers the question. 1. The correct order for the levels of Linnaeus's classification system,
More informationProtein & DNA Sequence Analysis. Bobbie-Jo Webb-Robertson May 3, 2004
Protein & DNA Sequence Analysis Bobbie-Jo Webb-Robertson May 3, 2004 Sequence Analysis Anything connected to identifying higher biological meaning out of raw sequence data. 2 Genomic & Proteomic Data Sequence
More informationAP BIOLOGY 2010 SCORING GUIDELINES (Form B)
AP BIOLOGY 2010 SCORING GUIDELINES (Form B) Question 2 Certain human genetic conditions, such as sickle cell anemia, result from single base-pair mutations in DNA. (a) Explain how a single base-pair mutation
More informationRNA and Protein Synthesis
Name lass Date RN and Protein Synthesis Information and Heredity Q: How does information fl ow from DN to RN to direct the synthesis of proteins? 13.1 What is RN? WHT I KNOW SMPLE NSWER: RN is a nucleic
More informationIntroduction to Phylogenetic Analysis
Subjects of this lecture Introduction to Phylogenetic nalysis Irit Orr 1 Introducing some of the terminology of phylogenetics. 2 Introducing some of the most commonly used methods for phylogenetic analysis.
More informationName Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
More information7 Gaussian Elimination and LU Factorization
7 Gaussian Elimination and LU Factorization In this final section on matrix factorization methods for solving Ax = b we want to take a closer look at Gaussian elimination (probably the best known method
More informationChapter 17. How are acids different from bases? Acid Physical properties. Base. Explaining the difference in properties of acids and bases
Chapter 17 Acids and Bases How are acids different from bases? Acid Physical properties Base Physical properties Tastes sour Tastes bitter Feels slippery or slimy Chemical properties Chemical properties
More informationCSC 2427: Algorithms for Molecular Biology Spring 2006. Lecture 16 March 10
CSC 2427: Algorithms for Molecular Biology Spring 2006 Lecture 16 March 10 Lecturer: Michael Brudno Scribe: Jim Huang 16.1 Overview of proteins Proteins are long chains of amino acids (AA) which are produced
More informationBioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
More informationLinear Sequence Analysis. 3-D Structure Analysis
Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical properties Molecular weight (MW), isoelectric point (pi), amino acid content, hydropathy (hydrophilic
More informationagucacaaacgcu agugcuaguuua uaugcagucuua
RNA Secondary Structure Prediction: The Co-transcriptional effect on RNA folding agucacaaacgcu agugcuaguuua uaugcagucuua By Conrad Godfrey Abstract RNA secondary structure prediction is an area of bioinformatics
More informationMUTATION, DNA REPAIR AND CANCER
MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful
More informationTranscription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
More informationIntroduction to Bioinformatics AS 250.265 Laboratory Assignment 6
Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6 In the last lab, you learned how to perform basic multiple sequence alignments. While useful in themselves for determining conserved residues
More informationASSIGNMENT 4 PREDICTIVE MODELING AND GAINS CHARTS
DATABASE MARKETING Fall 2015, max 24 credits Dead line 15.10. ASSIGNMENT 4 PREDICTIVE MODELING AND GAINS CHARTS PART A Gains chart with excel Prepare a gains chart from the data in \\work\courses\e\27\e20100\ass4b.xls.
More informationISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes
ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination
More informationa. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled
Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino
More informationPreliminary MFM Quiz
Preliminary MFM Quiz 1. The major carrier of chemical energy in all cells is: A) adenosine monophosphate B) adenosine diphosphate C) adenosine trisphosphate D) guanosine trisphosphate E) carbamoyl phosphate
More informationProtein Synthesis How Genes Become Constituent Molecules
Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein
More informationBioinformatics Grid - Enabled Tools For Biologists.
Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis
More informationNotes on Orthogonal and Symmetric Matrices MENU, Winter 2013
Notes on Orthogonal and Symmetric Matrices MENU, Winter 201 These notes summarize the main properties and uses of orthogonal and symmetric matrices. We covered quite a bit of material regarding these topics,
More informationGene mutation and molecular medicine Chapter 15
Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to
More informationMs. Campbell Protein Synthesis Practice Questions Regents L.E.
Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide
More informationRepresenting Vector Fields Using Field Line Diagrams
Minds On Physics Activity FFá2 5 Representing Vector Fields Using Field Line Diagrams Purpose and Expected Outcome One way of representing vector fields is using arrows to indicate the strength and direction
More informationLab 3 Organic Molecules of Biological Importance
Name Biology 3 ID Number Lab 3 Organic Molecules of Biological Importance Section 1 - Organic Molecules Section 2 - Functional Groups Section 3 - From Building Blocks to Macromolecules Section 4 - Carbohydrates
More informationDeveloping an interactive webbased learning. environment for bioinformatics. Master thesis. Daniel Løkken Rustad UNIVERSITY OF OSLO
UNIVERSITY OF OSLO Department of Informatics Developing an interactive webbased learning environment for bioinformatics Master thesis Daniel Løkken Rustad 27th July 2005 Preface Preface This thesis is
More informationLecture 19: Proteins, Primary Struture
CPS260/BGT204.1 Algorithms in Computational Biology November 04, 2003 Lecture 19: Proteins, Primary Struture Lecturer: Pankaj K. Agarwal Scribe: Qiuhua Liu 19.1 The Building Blocks of Protein [1] Proteins
More informationTitration curves. Strong Acid-Strong Base Titrations
Titration curves A titration is a procedure for carrying out a chemical reaction between two solutions by the controlled addition from a buret of one solution (the titrant) to the other, allowing measurements
More informationOperation Count; Numerical Linear Algebra
10 Operation Count; Numerical Linear Algebra 10.1 Introduction Many computations are limited simply by the sheer number of required additions, multiplications, or function evaluations. If floating-point
More informationGuide for Bioinformatics Project Module 3
Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first
More information14.10.2014. Overview. Swarms in nature. Fish, birds, ants, termites, Introduction to swarm intelligence principles Particle Swarm Optimization (PSO)
Overview Kyrre Glette kyrrehg@ifi INF3490 Swarm Intelligence Particle Swarm Optimization Introduction to swarm intelligence principles Particle Swarm Optimization (PSO) 3 Swarms in nature Fish, birds,
More informationBCOR101 Midterm II Wednesday, October 26, 2005
BCOR101 Midterm II Wednesday, October 26, 2005 Name Key Please show all of your work. 1. A donor strain is trp+, pro+, met+ and a recipient strain is trp-, pro-, met-. The donor strain is infected with
More informationDNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3
DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can
More informationUmm AL Qura University MUTATIONS. Dr Neda M Bogari
Umm AL Qura University MUTATIONS Dr Neda M Bogari CONTACTS www.bogari.net http://web.me.com/bogari/bogari.net/ From DNA to Mutations MUTATION Definition: Permanent change in nucleotide sequence. It can
More informationRow Echelon Form and Reduced Row Echelon Form
These notes closely follow the presentation of the material given in David C Lay s textbook Linear Algebra and its Applications (3rd edition) These notes are intended primarily for in-class presentation
More informationPhylogenetic Trees Made Easy
Phylogenetic Trees Made Easy A How-To Manual Fourth Edition Barry G. Hall University of Rochester, Emeritus and Bellingham Research Institute Sinauer Associates, Inc. Publishers Sunderland, Massachusetts
More informationTranslation. Translation: Assembly of polypeptides on a ribosome
Translation Translation: Assembly of polypeptides on a ribosome Living cells devote more energy to the synthesis of proteins than to any other aspect of metabolism. About a third of the dry mass of a cell
More information12.1 The Role of DNA in Heredity
12.1 The Role of DNA in Heredity Only in the last 50 years have scientists understood the role of DNA in heredity. That understanding began with the discovery of DNA s structure. In 1952, Rosalind Franklin
More informationHidden Markov Models in Bioinformatics. By Máthé Zoltán Kőrösi Zoltán 2006
Hidden Markov Models in Bioinformatics By Máthé Zoltán Kőrösi Zoltán 2006 Outline Markov Chain HMM (Hidden Markov Model) Hidden Markov Models in Bioinformatics Gene Finding Gene Finding Model Viterbi algorithm
More informationHeuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations
Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations AlCoB 2014 First International Conference on Algorithms for Computational Biology Thiago da Silva Arruda Institute
More informationUnit 1 Number Sense. In this unit, students will study repeating decimals, percents, fractions, decimals, and proportions.
Unit 1 Number Sense In this unit, students will study repeating decimals, percents, fractions, decimals, and proportions. BLM Three Types of Percent Problems (p L-34) is a summary BLM for the material
More information