Amino Acids and Their Properties

Size: px
Start display at page:

Download "Amino Acids and Their Properties"

Transcription

1 Amino Acids and Their Properties

2 Recap: ss-rrna and mutations Ribosomal RNA (rrna) evolves very slowly Much slower than proteins ss-rrna is typically used So by aligning ss-rrna of one organism with that of another We can estimate relatedness

3 Amino Acid Substitutions Recall we can align DNA & RNA sequences What does that mean? We can also align two amino acid sequences Can 2 nucleotides partially match? Can 2 amino acids partially match?

4 Amino Acid Substitutions Aligning sequences Can 2 nucleotides partially match? Are some nucleotide mutations more significant than others? Can 2 amino acids partially match? Are some amino acid mismatches more significant than others?

5 Amino Acid Substitutions Can 2 nucleotides partially match? Significance of a nucleobase mutation Does name matter? Does location matter? Can 2 amino acids partially match? Significance of an amino acid mutation Name? Location?

6 Sequence matching and evolution rate Proteins tend to evolve slower than DNA Many DNA changes have no affect on a protein A changed codon may map to the same amino acid Non-coding DNA changes may have no effect What does this mean for gauging the relatedness of humans and chimpanzees? humans and fish?

7 Sequence matching and evolution rate Ribosomal RNA (rrna) evolves very slowly Much slower than proteins What might rrna matching be good for measuring the relatedness of? humans and chimpanzees? humans and fish? humans and what?

8 Sequence matching and evolution rate Ribosomal RNA (rrna) evolves very slowly Much slower than proteins ss-rrna is typically used (what's that?) However, different regions of ss-rrna mutate at different rates (Ribosome images next)

9 The Ribosome Source: om/articles/ri bosomesfunction.html

10 Ribosomes: diagrams and images...check images.google.com for: Ribosome diagram Ribosome structure Videos includehttp://

11 Recap: ss-rrna and mutations Ribosomal RNA (rrna) evolves very slowly Much slower than proteins ss-rrna is typically used So by aligning ss-rrna of one organism with that of another We can estimate relatedness

12 Relatedness and Mutations Much DNA mutates relatively quickly Much ss-rrna mutates relatively slowly Much protein mutates at intermediate rates Let's focus on protein mutation next

13 Amino acid subsitutions Some amino acids substitutions are more likely than others Why?

14 Amino acid substitutions Some amino acids substitutions are more likely than others Why? Some are closer to others in terms of nucleobase codons Some are closer in terms of resulting protein function

15 Amino acid substitutions II Substituting similar ones is likely to Retain the protein structure and function Substituting dissimilar ones is likely to Change the protein structure and function Similarity of amino acids means what?

16 Amino acid substitutions III Similarity of amino acids means similar physicochemical properties Physicochemical: Concerning the physical and chemical Concerning physical chemistry Physical chemistry: Connecting macroscopic properties of substances with their molecular properties

17 Amino acid physicochemical properties Nonpolar(Hydrophobic) ACFGILMPVW Polar (hydrophilic): NQSTY Aromatic: FHWY (having to do with 6-carbon rings) Basic: HKR Acidic: DE (See By way of contrast, can anyone think of a nonphysicochemical property of some amino acids?

18

19 Aromatic Special type of ring-shaped molecule Characterized by an unusual stabilizing property Aliphatic Non-aromatic

20 Amino acid abbrevs. G=glycine, P=proline, T=threonine, A=alanine,, but why the following?? F=phenylalanine Y=tyrosine N=asparagine Q=glutamine W=tryptophan

21 Scoring protein sequence alignments Simple way: Two matching (identical) amino acids score 1 Two mismatching (non-identical) ones score 0 Goal: maximize % of matching amino acids Works well for very similar sequences Example: CADQH CADPM Alignment score=

22 Scoring protein sequence alignments II Simple way ignores degree of similarity better to account for degree of similarity! Solution: substitution matrices PAM (Accepted Point Mutation, but PAM easier to say than APM ) matrix Developed in 1970s by Margaret Dayhoff PAM1 matrix: answers question, if 1% of the amino acids in a sequence change, at what rates would each amino acid be substituted for each other one?

23 Scoring protein sequence alignments II Substitution matrices PAM (Accepted Point Mutation, but PAM easier to say than APM ) matrix PAM1 matrix: answers question, if 1% of the amino acids in a sequence change, at what rates would each amino acid be substituted for each other one? PAM2 matrix: Not 2%! Rather, 1%, twice What is the difference?

24 Scoring protein sequence alignments II Substitution matrices PAM (Accepted Point Mutation, but PAM easier to say than APM ) matrix PAM1 matrix: answers question, if 1% of the amino acids in a sequence change, at what rates would each amino acid be substituted for each other one? PAM250 matrix: Not 250%, obviously Why obviously? It is 1%, repeated 250 times!

25 Scoring protein sequence alignments II Substitution matrices PAM (Accepted Point Mutation, but PAM easier to say than APM ) matrix PAM1 matrix: answers question, if 1% of the amino acids in a sequence change, at what rates would each amino acid be substituted for each other one? PAM250 matrix: It is 1%, repeated 250 times! BLOSUM matrix is a popular type also

26 Scoring protein sequences: Here is PAM250 source: PAM250 CADQH CADPM Alignment score=?

27 Scoring protein sequences: BLOSUM62 (default in Blast 2.0) Source= nias/seq_analysis/pairwise.html.

28 Why do self substitutions have the highest numbers?

29 Why use PAM, BLOSUM, etc.? Sequence similarity is related to evolutionary distance Simple base matching (match/not) may work ok for closely related organisms humans and chimps, for example Amino acid matching works better as evolutionary distance increases (why?) We d like to be able to assess relatedness of organisms that diverged long ago humans and worms, for example

30 Relatedness Long Ago See images.google.com for domains of life We still are not sure, but the 3-domain system seems likely But cladistics demands binary splits, so 3 domains requires 2 splits, and 2 domains are more related than the 3rd

31 Why use PAM, BLOSUM (II) Organisms that diverged long ago have divergent analogous amino acid sequences Since different amino acid substitutions occur at different frequencies we can measure relatedness back farther e.g. when the fraction of identical amino acids is surprisingly low and the fraction of identical base pairs is even lower

32 Comparing Sequences with PAMs (+ recap)

33 What does PAM mean? PAM is considered an acronym for Point Accepted Mutation Accepted Point Mutation (original) Percent Accepted Mutations A point mutation is a substitution of 1 amino acid for another An accepted mutation is one that is passed down through the generations Will a mutation be accepted if it is helpful? Harmful? Neutral? Helpful in some circumstances, harmful in others?

34 What Does PAM Mean, cont. PAM has two meanings PAM is a unit of evolutionary time PAM is kind of substitution matrix (The meanings are related)

35 PAM as a Unit of Time A PAM is the amount of evolutionary change resulting in: 1 amino acid mutation per 100 amino acids It is an average over >>100 amino acids because mutations have randomness After 1 PAM, will an organism have exactly 1% of its amino acids different from what they started out as?

36

37 PAM, Evolution, and Gaps PAM ignores Insertions Deletions Silent nucleotide substitutions (which are?) PAM counts a change from A to B and back to A as 2 accepted point mutations 2 sequences 200 PAMs apart will have about 25% of amino acids the same!

38 PAM Matrices They describe substitutability of amino acids, based on empirical evidence Empirical = experiential The matrices are derived from repositories of actual homologous sequences A PAM 1 matrix is geared to best compare 2 sequences that are 1 PAM apart A PAM 250 matrix is good for comparing quite diverged sequences PAM 250 matrix is standard

39 Creating a PAM Matrix Let f i be the frequency of amino acid i We express f i as a fraction of the total f i = instances of i. instances of any amino acid Frequencies range from (L) down to (W) The most common amino acid occurs about times more commonly than the least

40 Creating PAM matrix, cont. Determine mutabilities of the amino acids Some amino acids tend to change easily Others not If alanine s mutability is set to 100 Serine s mutability is 117 (highest, 1991 data) Tryptophan s mutability is 25 (lowest, 1991) Let s look more closely at m i...

41 Creating PAM matrix, cont. Mutability is a number Given an evolutionary interval of 1 PAM let m i = # mutations of amino acid i # instances of amino acid i Alternatively, m i = p (an instance of i mutates)

42 Are the formulas on the previous slide identical?

43 Creating PAM matrix, cont. Next, we break m i into constituent m i,j s That is, i mutates, but into j at what rate? Use actual data from observed mutations Populate a matrix of probabilities

44 The Diagonal Values on the matrix diagonal do not really describe i mutating into itself! (In reality, can that happen?) They basically show p (i does not mutate) Thus, the columns add up to 1

45

46 Is the matrix on the last slide Symmetric? Are there about 1% changed?

47 PAM0 What do you think a PAM 0 matrix might look like?

48 PAMn Use matrix multiplication PAM2 = PAM1 x PAM1 PAM3 = PAM2 x PAM1 PAM250? Do it 250 times!

49 PAM What do you imagine a PAM matrix might look sort of like?

50 Logarithmicize Actually, we take logarithms to get the usual matrix from the probability matrices First, build another, reference matrix of expected probabilities Assume all amino acids are equally mutable Also assume they mutate into each other in proportion to their frequencies (I.e., overall amino acid frequencies are maintained, but otherwise they don t care what they mutate into)

51 Logarithmicize Now we have two matrices Make a 3 rd. Each entry is: Observed probability Expected probability we re comparing reality to if mutations were truly random Take the log of each entry to make a 4 th An entry of 1 means 10x more mutations of that type than expected An entry of -1 means what?

52 Carrying On We now use the matrix to measure relative evolutionary distance

Sequence Analysis 15: lecture 5. Substitution matrices Multiple sequence alignment

Sequence Analysis 15: lecture 5. Substitution matrices Multiple sequence alignment Sequence Analysis 15: lecture 5 Substitution matrices Multiple sequence alignment A teacher's dilemma To understand... Multiple sequence alignment Substitution matrices Phylogenetic trees You first need

More information

Pairwise Sequence Alignment

Pairwise Sequence Alignment Pairwise Sequence Alignment carolin.kosiol@vetmeduni.ac.at SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What

More information

Rapid alignment methods: FASTA and BLAST. p The biological problem p Search strategies p FASTA p BLAST

Rapid alignment methods: FASTA and BLAST. p The biological problem p Search strategies p FASTA p BLAST Rapid alignment methods: FASTA and BLAST p The biological problem p Search strategies p FASTA p BLAST 257 BLAST: Basic Local Alignment Search Tool p BLAST (Altschul et al., 1990) and its variants are some

More information

THREE DIMENSIONAL REPRESENTATION OF AMINO ACID CHARAC- TERISTICS

THREE DIMENSIONAL REPRESENTATION OF AMINO ACID CHARAC- TERISTICS THREE DIMENSIONAL REPRESENTATION OF AMINO ACID CHARAC- TERISTICS O.U. Sezerman 1, R. Islamaj 2, E. Alpaydin 2 1 Laborotory of Computational Biology, Sabancı University, Istanbul, Turkey. 2 Computer Engineering

More information

Bio-Informatics Lectures. A Short Introduction

Bio-Informatics Lectures. A Short Introduction Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively

More information

RNA Structure and folding

RNA Structure and folding RNA Structure and folding Overview: The main functional biomolecules in cells are polymers DNA, RNA and proteins For RNA and Proteins, the specific sequence of the polymer dictates its final structure

More information

Clone Manager. Getting Started

Clone Manager. Getting Started Clone Manager for Windows Professional Edition Volume 2 Alignment, Primer Operations Version 9.5 Getting Started Copyright 1994-2015 Scientific & Educational Software. All rights reserved. The software

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Similarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003

Similarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Similarity Searches on Sequence Databases: BLAST, FASTA Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Outline Importance of Similarity Heuristic Sequence Alignment:

More information

PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org

PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,

More information

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized: Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

Name Class Date. binomial nomenclature. MAIN IDEA: Linnaeus developed the scientific naming system still used today.

Name Class Date. binomial nomenclature. MAIN IDEA: Linnaeus developed the scientific naming system still used today. Section 1: The Linnaean System of Classification 17.1 Reading Guide KEY CONCEPT Organisms can be classified based on physical similarities. VOCABULARY taxonomy taxon binomial nomenclature genus MAIN IDEA:

More information

1 Mutation and Genetic Change

1 Mutation and Genetic Change CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds

More information

The Steps. 1. Transcription. 2. Transferal. 3. Translation

The Steps. 1. Transcription. 2. Transferal. 3. Translation Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

The Central Dogma of Molecular Biology

The Central Dogma of Molecular Biology Vierstraete Andy (version 1.01) 1/02/2000 -Page 1 - The Central Dogma of Molecular Biology Figure 1 : The Central Dogma of molecular biology. DNA contains the complete genetic information that defines

More information

Database searching with DNA and protein sequences: An introduction Clare Sansom Date received (in revised form): 12th November 1999

Database searching with DNA and protein sequences: An introduction Clare Sansom Date received (in revised form): 12th November 1999 Dr Clare Sansom works part time at Birkbeck College, London, and part time as a freelance computer consultant and science writer At Birkbeck she coordinates an innovative graduate-level Advanced Certificate

More information

Network Protocol Analysis using Bioinformatics Algorithms

Network Protocol Analysis using Bioinformatics Algorithms Network Protocol Analysis using Bioinformatics Algorithms Marshall A. Beddoe Marshall_Beddoe@McAfee.com ABSTRACT Network protocol analysis is currently performed by hand using only intuition and a protocol

More information

MAKING AN EVOLUTIONARY TREE

MAKING AN EVOLUTIONARY TREE Student manual MAKING AN EVOLUTIONARY TREE THEORY The relationship between different species can be derived from different information sources. The connection between species may turn out by similarities

More information

Graph theoretic approach to analyze amino acid network

Graph theoretic approach to analyze amino acid network Int. J. Adv. Appl. Math. and Mech. 2(3) (2015) 31-37 (ISSN: 2347-2529) Journal homepage: www.ijaamm.com International Journal of Advances in Applied Mathematics and Mechanics Graph theoretic approach to

More information

Concluding lesson. Student manual. What kind of protein are you? (Basic)

Concluding lesson. Student manual. What kind of protein are you? (Basic) Concluding lesson Student manual What kind of protein are you? (Basic) Part 1 The hereditary material of an organism is stored in a coded way on the DNA. This code consists of four different nucleotides:

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov

More information

6.4 Normal Distribution

6.4 Normal Distribution Contents 6.4 Normal Distribution....................... 381 6.4.1 Characteristics of the Normal Distribution....... 381 6.4.2 The Standardized Normal Distribution......... 385 6.4.3 Meaning of Areas under

More information

Chapter 6 DNA Replication

Chapter 6 DNA Replication Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore

More information

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme. Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.

More information

A Step-by-Step Tutorial: Divergence Time Estimation with Approximate Likelihood Calculation Using MCMCTREE in PAML

A Step-by-Step Tutorial: Divergence Time Estimation with Approximate Likelihood Calculation Using MCMCTREE in PAML 9 June 2011 A Step-by-Step Tutorial: Divergence Time Estimation with Approximate Likelihood Calculation Using MCMCTREE in PAML by Jun Inoue, Mario dos Reis, and Ziheng Yang In this tutorial we will analyze

More information

PRACTICE TEST QUESTIONS

PRACTICE TEST QUESTIONS PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.

More information

Bob Jesberg. Boston, MA April 3, 2014

Bob Jesberg. Boston, MA April 3, 2014 DNA, Replication and Transcription Bob Jesberg NSTA Conference Boston, MA April 3, 2014 1 Workshop Agenda Looking at DNA and Forensics The DNA, Replication i and Transcription i Set DNA Ladder The Double

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

Lab # 12: DNA and RNA

Lab # 12: DNA and RNA 115 116 Concepts to be explored: Structure of DNA Nucleotides Amino Acids Proteins Genetic Code Mutation RNA Transcription to RNA Translation to a Protein Figure 12. 1: DNA double helix Introduction Long

More information

Separation of Amino Acids by Paper Chromatography

Separation of Amino Acids by Paper Chromatography Separation of Amino Acids by Paper Chromatography Chromatography is a common technique for separating chemical substances. The prefix chroma, which suggests color, comes from the fact that some of the

More information

Chapter 5: The Structure and Function of Large Biological Molecules

Chapter 5: The Structure and Function of Large Biological Molecules Name Period Concept 5.1 Macromolecules are polymers, built from monomers 1. The large molecules of all living things fall into just four main classes. Name them. 2. Circle the three classes that are called

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

H H N - C - C 2 R. Three possible forms (not counting R group) depending on ph

H H N - C - C 2 R. Three possible forms (not counting R group) depending on ph Amino acids - 0 common amino acids there are others found naturally but much less frequently - Common structure for amino acid - C, -N, and functional groups all attached to the alpha carbon N - C - C

More information

BLAST. Anders Gorm Pedersen & Rasmus Wernersson

BLAST. Anders Gorm Pedersen & Rasmus Wernersson BLAST Anders Gorm Pedersen & Rasmus Wernersson Database searching Using pairwise alignments to search databases for similar sequences Query sequence Database Database searching Most common use of pairwise

More information

BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS

BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:

More information

Introduction to Principal Components and FactorAnalysis

Introduction to Principal Components and FactorAnalysis Introduction to Principal Components and FactorAnalysis Multivariate Analysis often starts out with data involving a substantial number of correlated variables. Principal Component Analysis (PCA) is a

More information

Vector NTI Advance 11 Quick Start Guide

Vector NTI Advance 11 Quick Start Guide Vector NTI Advance 11 Quick Start Guide Catalog no. 12605050, 12605099, 12605103 Version 11.0 December 15, 2008 12605022 Published by: Invitrogen Corporation 5791 Van Allen Way Carlsbad, CA 92008 U.S.A.

More information

Principles of Evolution - Origin of Species

Principles of Evolution - Origin of Species Theories of Organic Evolution X Multiple Centers of Creation (de Buffon) developed the concept of "centers of creation throughout the world organisms had arisen, which other species had evolved from X

More information

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Molecular Genetics. RNA, Transcription, & Protein Synthesis Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and

More information

Name: Date: Period: DNA Unit: DNA Webquest

Name: Date: Period: DNA Unit: DNA Webquest Name: Date: Period: DNA Unit: DNA Webquest Part 1 History, DNA Structure, DNA Replication DNA History http://www.dnaftb.org/dnaftb/1/concept/index.html Read the text and answer the following questions.

More information

Hidden Markov Models

Hidden Markov Models 8.47 Introduction to omputational Molecular Biology Lecture 7: November 4, 2004 Scribe: Han-Pang hiu Lecturer: Ross Lippert Editor: Russ ox Hidden Markov Models The G island phenomenon The nucleotide frequencies

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

13.2 Ribosomes & Protein Synthesis

13.2 Ribosomes & Protein Synthesis 13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).

More information

Lecture 3: Mutations

Lecture 3: Mutations Lecture 3: Mutations Recall that the flow of information within a cell involves the transcription of DNA to mrna and the translation of mrna to protein. Recall also, that the flow of information between

More information

CALCULATIONS & STATISTICS

CALCULATIONS & STATISTICS CALCULATIONS & STATISTICS CALCULATION OF SCORES Conversion of 1-5 scale to 0-100 scores When you look at your report, you will notice that the scores are reported on a 0-100 scale, even though respondents

More information

DNA Insertions and Deletions in the Human Genome. Philipp W. Messer

DNA Insertions and Deletions in the Human Genome. Philipp W. Messer DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.

More information

Name: Date: Problem How do amino acid sequences provide evidence for evolution? Procedure Part A: Comparing Amino Acid Sequences

Name: Date: Problem How do amino acid sequences provide evidence for evolution? Procedure Part A: Comparing Amino Acid Sequences Name: Date: Amino Acid Sequences and Evolutionary Relationships Introduction Homologous structures those structures thought to have a common origin but not necessarily a common function provide some of

More information

Lab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS

Lab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS Lab 2/Phylogenetics/September 16, 2002 1 Read: Tudge Chapter 2 PHYLOGENETICS Objective of the Lab: To understand how DNA and protein sequence information can be used to make comparisons and assess evolutionary

More information

Evidence for evolution factsheet

Evidence for evolution factsheet The theory of evolution by natural selection is supported by a great deal of evidence. Fossils Fossils are formed when organisms become buried in sediments, causing little decomposition of the organism.

More information

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams. Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.

More information

Focusing on results not data comprehensive data analysis for targeted next generation sequencing

Focusing on results not data comprehensive data analysis for targeted next generation sequencing Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes

More information

Regents Biology REGENTS REVIEW: PROTEIN SYNTHESIS

Regents Biology REGENTS REVIEW: PROTEIN SYNTHESIS Period Date REGENTS REVIEW: PROTEIN SYNTHESIS 1. The diagram at the right represents a portion of a type of organic molecule present in the cells of organisms. What will most likely happen if there is

More information

Bonding & Molecular Shape Ron Robertson

Bonding & Molecular Shape Ron Robertson Bonding & Molecular Shape Ron Robertson r2 n:\files\courses\1110-20\2010 possible slides for web\00bondingtrans.doc The Nature of Bonding Types 1. Ionic 2. Covalent 3. Metallic 4. Coordinate covalent Driving

More information

Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.

Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question. Name: Class: Date: Chapter 17 Practice Multiple Choice Identify the choice that best completes the statement or answers the question. 1. The correct order for the levels of Linnaeus's classification system,

More information

Protein & DNA Sequence Analysis. Bobbie-Jo Webb-Robertson May 3, 2004

Protein & DNA Sequence Analysis. Bobbie-Jo Webb-Robertson May 3, 2004 Protein & DNA Sequence Analysis Bobbie-Jo Webb-Robertson May 3, 2004 Sequence Analysis Anything connected to identifying higher biological meaning out of raw sequence data. 2 Genomic & Proteomic Data Sequence

More information

AP BIOLOGY 2010 SCORING GUIDELINES (Form B)

AP BIOLOGY 2010 SCORING GUIDELINES (Form B) AP BIOLOGY 2010 SCORING GUIDELINES (Form B) Question 2 Certain human genetic conditions, such as sickle cell anemia, result from single base-pair mutations in DNA. (a) Explain how a single base-pair mutation

More information

RNA and Protein Synthesis

RNA and Protein Synthesis Name lass Date RN and Protein Synthesis Information and Heredity Q: How does information fl ow from DN to RN to direct the synthesis of proteins? 13.1 What is RN? WHT I KNOW SMPLE NSWER: RN is a nucleic

More information

Introduction to Phylogenetic Analysis

Introduction to Phylogenetic Analysis Subjects of this lecture Introduction to Phylogenetic nalysis Irit Orr 1 Introducing some of the terminology of phylogenetics. 2 Introducing some of the most commonly used methods for phylogenetic analysis.

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

7 Gaussian Elimination and LU Factorization

7 Gaussian Elimination and LU Factorization 7 Gaussian Elimination and LU Factorization In this final section on matrix factorization methods for solving Ax = b we want to take a closer look at Gaussian elimination (probably the best known method

More information

Chapter 17. How are acids different from bases? Acid Physical properties. Base. Explaining the difference in properties of acids and bases

Chapter 17. How are acids different from bases? Acid Physical properties. Base. Explaining the difference in properties of acids and bases Chapter 17 Acids and Bases How are acids different from bases? Acid Physical properties Base Physical properties Tastes sour Tastes bitter Feels slippery or slimy Chemical properties Chemical properties

More information

CSC 2427: Algorithms for Molecular Biology Spring 2006. Lecture 16 March 10

CSC 2427: Algorithms for Molecular Biology Spring 2006. Lecture 16 March 10 CSC 2427: Algorithms for Molecular Biology Spring 2006 Lecture 16 March 10 Lecturer: Michael Brudno Scribe: Jim Huang 16.1 Overview of proteins Proteins are long chains of amino acids (AA) which are produced

More information

Bioinformatics Resources at a Glance

Bioinformatics Resources at a Glance Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences

More information

Linear Sequence Analysis. 3-D Structure Analysis

Linear Sequence Analysis. 3-D Structure Analysis Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical properties Molecular weight (MW), isoelectric point (pi), amino acid content, hydropathy (hydrophilic

More information

agucacaaacgcu agugcuaguuua uaugcagucuua

agucacaaacgcu agugcuaguuua uaugcagucuua RNA Secondary Structure Prediction: The Co-transcriptional effect on RNA folding agucacaaacgcu agugcuaguuua uaugcagucuua By Conrad Godfrey Abstract RNA secondary structure prediction is an area of bioinformatics

More information

MUTATION, DNA REPAIR AND CANCER

MUTATION, DNA REPAIR AND CANCER MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6

Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6 Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6 In the last lab, you learned how to perform basic multiple sequence alignments. While useful in themselves for determining conserved residues

More information

ASSIGNMENT 4 PREDICTIVE MODELING AND GAINS CHARTS

ASSIGNMENT 4 PREDICTIVE MODELING AND GAINS CHARTS DATABASE MARKETING Fall 2015, max 24 credits Dead line 15.10. ASSIGNMENT 4 PREDICTIVE MODELING AND GAINS CHARTS PART A Gains chart with excel Prepare a gains chart from the data in \\work\courses\e\27\e20100\ass4b.xls.

More information

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

Preliminary MFM Quiz

Preliminary MFM Quiz Preliminary MFM Quiz 1. The major carrier of chemical energy in all cells is: A) adenosine monophosphate B) adenosine diphosphate C) adenosine trisphosphate D) guanosine trisphosphate E) carbamoyl phosphate

More information

Protein Synthesis How Genes Become Constituent Molecules

Protein Synthesis How Genes Become Constituent Molecules Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein

More information

Bioinformatics Grid - Enabled Tools For Biologists.

Bioinformatics Grid - Enabled Tools For Biologists. Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis

More information

Notes on Orthogonal and Symmetric Matrices MENU, Winter 2013

Notes on Orthogonal and Symmetric Matrices MENU, Winter 2013 Notes on Orthogonal and Symmetric Matrices MENU, Winter 201 These notes summarize the main properties and uses of orthogonal and symmetric matrices. We covered quite a bit of material regarding these topics,

More information

Gene mutation and molecular medicine Chapter 15

Gene mutation and molecular medicine Chapter 15 Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to

More information

Ms. Campbell Protein Synthesis Practice Questions Regents L.E.

Ms. Campbell Protein Synthesis Practice Questions Regents L.E. Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide

More information

Representing Vector Fields Using Field Line Diagrams

Representing Vector Fields Using Field Line Diagrams Minds On Physics Activity FFá2 5 Representing Vector Fields Using Field Line Diagrams Purpose and Expected Outcome One way of representing vector fields is using arrows to indicate the strength and direction

More information

Lab 3 Organic Molecules of Biological Importance

Lab 3 Organic Molecules of Biological Importance Name Biology 3 ID Number Lab 3 Organic Molecules of Biological Importance Section 1 - Organic Molecules Section 2 - Functional Groups Section 3 - From Building Blocks to Macromolecules Section 4 - Carbohydrates

More information

Developing an interactive webbased learning. environment for bioinformatics. Master thesis. Daniel Løkken Rustad UNIVERSITY OF OSLO

Developing an interactive webbased learning. environment for bioinformatics. Master thesis. Daniel Løkken Rustad UNIVERSITY OF OSLO UNIVERSITY OF OSLO Department of Informatics Developing an interactive webbased learning environment for bioinformatics Master thesis Daniel Løkken Rustad 27th July 2005 Preface Preface This thesis is

More information

Lecture 19: Proteins, Primary Struture

Lecture 19: Proteins, Primary Struture CPS260/BGT204.1 Algorithms in Computational Biology November 04, 2003 Lecture 19: Proteins, Primary Struture Lecturer: Pankaj K. Agarwal Scribe: Qiuhua Liu 19.1 The Building Blocks of Protein [1] Proteins

More information

Titration curves. Strong Acid-Strong Base Titrations

Titration curves. Strong Acid-Strong Base Titrations Titration curves A titration is a procedure for carrying out a chemical reaction between two solutions by the controlled addition from a buret of one solution (the titrant) to the other, allowing measurements

More information

Operation Count; Numerical Linear Algebra

Operation Count; Numerical Linear Algebra 10 Operation Count; Numerical Linear Algebra 10.1 Introduction Many computations are limited simply by the sheer number of required additions, multiplications, or function evaluations. If floating-point

More information

Guide for Bioinformatics Project Module 3

Guide for Bioinformatics Project Module 3 Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first

More information

14.10.2014. Overview. Swarms in nature. Fish, birds, ants, termites, Introduction to swarm intelligence principles Particle Swarm Optimization (PSO)

14.10.2014. Overview. Swarms in nature. Fish, birds, ants, termites, Introduction to swarm intelligence principles Particle Swarm Optimization (PSO) Overview Kyrre Glette kyrrehg@ifi INF3490 Swarm Intelligence Particle Swarm Optimization Introduction to swarm intelligence principles Particle Swarm Optimization (PSO) 3 Swarms in nature Fish, birds,

More information

BCOR101 Midterm II Wednesday, October 26, 2005

BCOR101 Midterm II Wednesday, October 26, 2005 BCOR101 Midterm II Wednesday, October 26, 2005 Name Key Please show all of your work. 1. A donor strain is trp+, pro+, met+ and a recipient strain is trp-, pro-, met-. The donor strain is infected with

More information

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3 DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can

More information

Umm AL Qura University MUTATIONS. Dr Neda M Bogari

Umm AL Qura University MUTATIONS. Dr Neda M Bogari Umm AL Qura University MUTATIONS Dr Neda M Bogari CONTACTS www.bogari.net http://web.me.com/bogari/bogari.net/ From DNA to Mutations MUTATION Definition: Permanent change in nucleotide sequence. It can

More information

Row Echelon Form and Reduced Row Echelon Form

Row Echelon Form and Reduced Row Echelon Form These notes closely follow the presentation of the material given in David C Lay s textbook Linear Algebra and its Applications (3rd edition) These notes are intended primarily for in-class presentation

More information

Phylogenetic Trees Made Easy

Phylogenetic Trees Made Easy Phylogenetic Trees Made Easy A How-To Manual Fourth Edition Barry G. Hall University of Rochester, Emeritus and Bellingham Research Institute Sinauer Associates, Inc. Publishers Sunderland, Massachusetts

More information

Translation. Translation: Assembly of polypeptides on a ribosome

Translation. Translation: Assembly of polypeptides on a ribosome Translation Translation: Assembly of polypeptides on a ribosome Living cells devote more energy to the synthesis of proteins than to any other aspect of metabolism. About a third of the dry mass of a cell

More information

12.1 The Role of DNA in Heredity

12.1 The Role of DNA in Heredity 12.1 The Role of DNA in Heredity Only in the last 50 years have scientists understood the role of DNA in heredity. That understanding began with the discovery of DNA s structure. In 1952, Rosalind Franklin

More information

Hidden Markov Models in Bioinformatics. By Máthé Zoltán Kőrösi Zoltán 2006

Hidden Markov Models in Bioinformatics. By Máthé Zoltán Kőrösi Zoltán 2006 Hidden Markov Models in Bioinformatics By Máthé Zoltán Kőrösi Zoltán 2006 Outline Markov Chain HMM (Hidden Markov Model) Hidden Markov Models in Bioinformatics Gene Finding Gene Finding Model Viterbi algorithm

More information

Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations

Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations AlCoB 2014 First International Conference on Algorithms for Computational Biology Thiago da Silva Arruda Institute

More information

Unit 1 Number Sense. In this unit, students will study repeating decimals, percents, fractions, decimals, and proportions.

Unit 1 Number Sense. In this unit, students will study repeating decimals, percents, fractions, decimals, and proportions. Unit 1 Number Sense In this unit, students will study repeating decimals, percents, fractions, decimals, and proportions. BLM Three Types of Percent Problems (p L-34) is a summary BLM for the material

More information