Amino Acids and Their Properties

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Amino Acids and Their Properties"

Transcription

1 Amino Acids and Their Properties

2 Recap: ss-rrna and mutations Ribosomal RNA (rrna) evolves very slowly Much slower than proteins ss-rrna is typically used So by aligning ss-rrna of one organism with that of another We can estimate relatedness

3 Amino Acid Substitutions Recall we can align DNA & RNA sequences What does that mean? We can also align two amino acid sequences Can 2 nucleotides partially match? Can 2 amino acids partially match?

4 Amino Acid Substitutions Aligning sequences Can 2 nucleotides partially match? Are some nucleotide mutations more significant than others? Can 2 amino acids partially match? Are some amino acid mismatches more significant than others?

5 Amino Acid Substitutions Can 2 nucleotides partially match? Significance of a nucleobase mutation Does name matter? Does location matter? Can 2 amino acids partially match? Significance of an amino acid mutation Name? Location?

6 Sequence matching and evolution rate Proteins tend to evolve slower than DNA Many DNA changes have no affect on a protein A changed codon may map to the same amino acid Non-coding DNA changes may have no effect What does this mean for gauging the relatedness of humans and chimpanzees? humans and fish?

7 Sequence matching and evolution rate Ribosomal RNA (rrna) evolves very slowly Much slower than proteins What might rrna matching be good for measuring the relatedness of? humans and chimpanzees? humans and fish? humans and what?

8 Sequence matching and evolution rate Ribosomal RNA (rrna) evolves very slowly Much slower than proteins ss-rrna is typically used (what's that?) However, different regions of ss-rrna mutate at different rates (Ribosome images next)

9 The Ribosome Source: om/articles/ri bosomesfunction.html

10 Ribosomes: diagrams and images...check images.google.com for: Ribosome diagram Ribosome structure Videos includehttp://www.youtube.com/watch?v=id7tdar39ow

11 Recap: ss-rrna and mutations Ribosomal RNA (rrna) evolves very slowly Much slower than proteins ss-rrna is typically used So by aligning ss-rrna of one organism with that of another We can estimate relatedness

12 Relatedness and Mutations Much DNA mutates relatively quickly Much ss-rrna mutates relatively slowly Much protein mutates at intermediate rates Let's focus on protein mutation next

13 Amino acid subsitutions Some amino acids substitutions are more likely than others Why?

14 Amino acid substitutions Some amino acids substitutions are more likely than others Why? Some are closer to others in terms of nucleobase codons Some are closer in terms of resulting protein function

15 Amino acid substitutions II Substituting similar ones is likely to Retain the protein structure and function Substituting dissimilar ones is likely to Change the protein structure and function Similarity of amino acids means what?

16 Amino acid substitutions III Similarity of amino acids means similar physicochemical properties Physicochemical: Concerning the physical and chemical Concerning physical chemistry Physical chemistry: Connecting macroscopic properties of substances with their molecular properties

17 Amino acid physicochemical properties Nonpolar(Hydrophobic) ACFGILMPVW Polar (hydrophilic): NQSTY Aromatic: FHWY (having to do with 6-carbon rings) Basic: HKR Acidic: DE (See By way of contrast, can anyone think of a nonphysicochemical property of some amino acids?

18

19 Aromatic Special type of ring-shaped molecule Characterized by an unusual stabilizing property Aliphatic Non-aromatic

20 Amino acid abbrevs. G=glycine, P=proline, T=threonine, A=alanine,, but why the following?? F=phenylalanine Y=tyrosine N=asparagine Q=glutamine W=tryptophan

21 Scoring protein sequence alignments Simple way: Two matching (identical) amino acids score 1 Two mismatching (non-identical) ones score 0 Goal: maximize % of matching amino acids Works well for very similar sequences Example: CADQH CADPM Alignment score=

22 Scoring protein sequence alignments II Simple way ignores degree of similarity better to account for degree of similarity! Solution: substitution matrices PAM (Accepted Point Mutation, but PAM easier to say than APM ) matrix Developed in 1970s by Margaret Dayhoff PAM1 matrix: answers question, if 1% of the amino acids in a sequence change, at what rates would each amino acid be substituted for each other one?

23 Scoring protein sequence alignments II Substitution matrices PAM (Accepted Point Mutation, but PAM easier to say than APM ) matrix PAM1 matrix: answers question, if 1% of the amino acids in a sequence change, at what rates would each amino acid be substituted for each other one? PAM2 matrix: Not 2%! Rather, 1%, twice What is the difference?

24 Scoring protein sequence alignments II Substitution matrices PAM (Accepted Point Mutation, but PAM easier to say than APM ) matrix PAM1 matrix: answers question, if 1% of the amino acids in a sequence change, at what rates would each amino acid be substituted for each other one? PAM250 matrix: Not 250%, obviously Why obviously? It is 1%, repeated 250 times!

25 Scoring protein sequence alignments II Substitution matrices PAM (Accepted Point Mutation, but PAM easier to say than APM ) matrix PAM1 matrix: answers question, if 1% of the amino acids in a sequence change, at what rates would each amino acid be substituted for each other one? PAM250 matrix: It is 1%, repeated 250 times! BLOSUM matrix is a popular type also

26 Scoring protein sequences: Here is PAM250 source: PAM250 CADQH CADPM Alignment score=?

27 Scoring protein sequences: BLOSUM62 (default in Blast 2.0) Source=http://bioinfo.cnio.es/docus/courses/SEK2003Filoge nias/seq_analysis/pairwise.html.

28 Why do self substitutions have the highest numbers?

29 Why use PAM, BLOSUM, etc.? Sequence similarity is related to evolutionary distance Simple base matching (match/not) may work ok for closely related organisms humans and chimps, for example Amino acid matching works better as evolutionary distance increases (why?) We d like to be able to assess relatedness of organisms that diverged long ago humans and worms, for example

30 Relatedness Long Ago See images.google.com for domains of life We still are not sure, but the 3-domain system seems likely But cladistics demands binary splits, so 3 domains requires 2 splits, and 2 domains are more related than the 3rd

31 Why use PAM, BLOSUM (II) Organisms that diverged long ago have divergent analogous amino acid sequences Since different amino acid substitutions occur at different frequencies we can measure relatedness back farther e.g. when the fraction of identical amino acids is surprisingly low and the fraction of identical base pairs is even lower

32 Comparing Sequences with PAMs (+ recap)

33 What does PAM mean? PAM is considered an acronym for Point Accepted Mutation Accepted Point Mutation (original) Percent Accepted Mutations A point mutation is a substitution of 1 amino acid for another An accepted mutation is one that is passed down through the generations Will a mutation be accepted if it is helpful? Harmful? Neutral? Helpful in some circumstances, harmful in others?

34 What Does PAM Mean, cont. PAM has two meanings PAM is a unit of evolutionary time PAM is kind of substitution matrix (The meanings are related)

35 PAM as a Unit of Time A PAM is the amount of evolutionary change resulting in: 1 amino acid mutation per 100 amino acids It is an average over >>100 amino acids because mutations have randomness After 1 PAM, will an organism have exactly 1% of its amino acids different from what they started out as?

36

37 PAM, Evolution, and Gaps PAM ignores Insertions Deletions Silent nucleotide substitutions (which are?) PAM counts a change from A to B and back to A as 2 accepted point mutations 2 sequences 200 PAMs apart will have about 25% of amino acids the same!

38 PAM Matrices They describe substitutability of amino acids, based on empirical evidence Empirical = experiential The matrices are derived from repositories of actual homologous sequences A PAM 1 matrix is geared to best compare 2 sequences that are 1 PAM apart A PAM 250 matrix is good for comparing quite diverged sequences PAM 250 matrix is standard

39 Creating a PAM Matrix Let f i be the frequency of amino acid i We express f i as a fraction of the total f i = instances of i. instances of any amino acid Frequencies range from (L) down to (W) The most common amino acid occurs about times more commonly than the least

40 Creating PAM matrix, cont. Determine mutabilities of the amino acids Some amino acids tend to change easily Others not If alanine s mutability is set to 100 Serine s mutability is 117 (highest, 1991 data) Tryptophan s mutability is 25 (lowest, 1991) Let s look more closely at m i...

41 Creating PAM matrix, cont. Mutability is a number Given an evolutionary interval of 1 PAM let m i = # mutations of amino acid i # instances of amino acid i Alternatively, m i = p (an instance of i mutates)

42 Are the formulas on the previous slide identical?

43 Creating PAM matrix, cont. Next, we break m i into constituent m i,j s That is, i mutates, but into j at what rate? Use actual data from observed mutations Populate a matrix of probabilities

44 The Diagonal Values on the matrix diagonal do not really describe i mutating into itself! (In reality, can that happen?) They basically show p (i does not mutate) Thus, the columns add up to 1

45

46 Is the matrix on the last slide Symmetric? Are there about 1% changed?

47 PAM0 What do you think a PAM 0 matrix might look like?

48 PAMn Use matrix multiplication PAM2 = PAM1 x PAM1 PAM3 = PAM2 x PAM1 PAM250? Do it 250 times!

49 PAM What do you imagine a PAM matrix might look sort of like?

50 Logarithmicize Actually, we take logarithms to get the usual matrix from the probability matrices First, build another, reference matrix of expected probabilities Assume all amino acids are equally mutable Also assume they mutate into each other in proportion to their frequencies (I.e., overall amino acid frequencies are maintained, but otherwise they don t care what they mutate into)

51 Logarithmicize Now we have two matrices Make a 3 rd. Each entry is: Observed probability Expected probability we re comparing reality to if mutations were truly random Take the log of each entry to make a 4 th An entry of 1 means 10x more mutations of that type than expected An entry of -1 means what?

52 Carrying On We now use the matrix to measure relative evolutionary distance

Sequence Analysis 15: lecture 5. Substitution matrices Multiple sequence alignment

Sequence Analysis 15: lecture 5. Substitution matrices Multiple sequence alignment Sequence Analysis 15: lecture 5 Substitution matrices Multiple sequence alignment A teacher's dilemma To understand... Multiple sequence alignment Substitution matrices Phylogenetic trees You first need

More information

Pairwise Sequence Alignment

Pairwise Sequence Alignment Pairwise Sequence Alignment carolin.kosiol@vetmeduni.ac.at SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What

More information

SAM Teacher s Guide DNA to Proteins

SAM Teacher s Guide DNA to Proteins SAM Teacher s Guide DNA to Proteins Note: Answers to activity and homework questions are only included in the Teacher Guides available after registering for the SAM activities, and not in this sample version.

More information

12/22/2014. Read the introduction. How does a cell make proteins with the information from DNA? Protein Synthesis: Transcription and Translation

12/22/2014. Read the introduction. How does a cell make proteins with the information from DNA? Protein Synthesis: Transcription and Translation EQ How does a cell make proteins with the information from DNA? Protein Synthesis: Get Started Get Started Think of a corn cell that is genetically modified to contain the Bt gene and a corn cell that

More information

Pairwise sequence alignments

Pairwise sequence alignments Pairwise sequence alignments Volker Flegel Vassilios Ioannidis VI - 2004 Page 1 Outline Introduction Definitions Biological context of pairwise alignments Computing of pairwise alignments Some programs

More information

Bio-Informatics Lectures. A Short Introduction

Bio-Informatics Lectures. A Short Introduction Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively

More information

THREE DIMENSIONAL REPRESENTATION OF AMINO ACID CHARAC- TERISTICS

THREE DIMENSIONAL REPRESENTATION OF AMINO ACID CHARAC- TERISTICS THREE DIMENSIONAL REPRESENTATION OF AMINO ACID CHARAC- TERISTICS O.U. Sezerman 1, R. Islamaj 2, E. Alpaydin 2 1 Laborotory of Computational Biology, Sabancı University, Istanbul, Turkey. 2 Computer Engineering

More information

Rapid alignment methods: FASTA and BLAST. p The biological problem p Search strategies p FASTA p BLAST

Rapid alignment methods: FASTA and BLAST. p The biological problem p Search strategies p FASTA p BLAST Rapid alignment methods: FASTA and BLAST p The biological problem p Search strategies p FASTA p BLAST 257 BLAST: Basic Local Alignment Search Tool p BLAST (Altschul et al., 1990) and its variants are some

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Clone Manager. Getting Started

Clone Manager. Getting Started Clone Manager for Windows Professional Edition Volume 2 Alignment, Primer Operations Version 9.5 Getting Started Copyright 1994-2015 Scientific & Educational Software. All rights reserved. The software

More information

Similarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003

Similarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Similarity Searches on Sequence Databases: BLAST, FASTA Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Outline Importance of Similarity Heuristic Sequence Alignment:

More information

Biology Performance Level Descriptors

Biology Performance Level Descriptors Limited A student performing at the Limited Level demonstrates a minimal command of Ohio s Learning Standards for Biology. A student at this level has an emerging ability to describe genetic patterns of

More information

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication Ch. 12: DNA and RNA 12.1 DNA A. To understand genetics, biologists had to learn the chemical makeup of the gene Genes are made of DNA DNA stores and transmits the genetic information from one generation

More information

CSE8393 Introduction to Bioinformatics Lecture 3: More problems, Global Alignment. DNA sequencing

CSE8393 Introduction to Bioinformatics Lecture 3: More problems, Global Alignment. DNA sequencing SE8393 Introduction to Bioinformatics Lecture 3: More problems, Global lignment DN sequencing Recall that in biological experiments only relatively short segments of the DN can be investigated. To investigate

More information

SAM Teachers Guide Nucleic Acids and Proteins (Long Version) Overview Learning Objectives Possible Student Pre/Misconceptions

SAM Teachers Guide Nucleic Acids and Proteins (Long Version) Overview Learning Objectives Possible Student Pre/Misconceptions SAM Teachers Guide Nucleic Acids and Proteins (Long Version) Overview Students explore the structure and function of two of the four major macromolecules: proteins and nucleic acids. On the first day they

More information

Ingenious Genes Curriculum Links for AQA AS (7401) and A-Level Biology (7402)

Ingenious Genes Curriculum Links for AQA AS (7401) and A-Level Biology (7402) Ingenious Genes Curriculum Links for AQA AS (7401) and A-Level Biology (7402) 3.1.1 Monomers and Polymers 3.1.4 Proteins 3.1.5 Nucleic acids are important information-carrying molecules 3.2.1 Cell structure

More information

PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org

PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,

More information

Translation. The process of converting the mrna base sequence into amino acid chains or proteins; occurs in the cytoplasm of the cell on ribosomes

Translation. The process of converting the mrna base sequence into amino acid chains or proteins; occurs in the cytoplasm of the cell on ribosomes The process of converting the mrna base sequence into amino acid chains or proteins; occurs in the cytoplasm of the cell on ribosomes The process of converting the mrna base sequence into amino acid chains

More information

Life. In nature, we find living things and non living things. Living things can move, reproduce, as opposed to non living things.

Life. In nature, we find living things and non living things. Living things can move, reproduce, as opposed to non living things. Computat onal Biology Lecture 1 Life In nature, we find living things and non living things. Living things can move, reproduce, as opposed to non living things. Both are composed of the same atoms and

More information

Opening Activity: Where in the cell does transcription take place? Latin Root Word: Review of Old Information: Transcription Video New Information:

Opening Activity: Where in the cell does transcription take place? Latin Root Word: Review of Old Information: Transcription Video New Information: Section 1.4 Name: Opening Activity: Where in the cell does transcription take place? Latin Root Word: Review of Old Information: Transcription Video New Information: Protein Synthesis: pages 193-196 As

More information

LAB 21 Using Bioinformatics to Investigate Evolutionary Relationships; Have a BLAST!

LAB 21 Using Bioinformatics to Investigate Evolutionary Relationships; Have a BLAST! LAB 21 Using Bioinformatics to Investigate Evolutionary Relationships; Have a BLAST! Introduction: Between 1990-2003, scientists working on an international research project known as the Human Genome Project,

More information

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized: Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How

More information

Network Protocol Analysis using Bioinformatics Algorithms

Network Protocol Analysis using Bioinformatics Algorithms Network Protocol Analysis using Bioinformatics Algorithms Marshall A. Beddoe Marshall_Beddoe@McAfee.com ABSTRACT Network protocol analysis is currently performed by hand using only intuition and a protocol

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

RNA Structure and folding

RNA Structure and folding RNA Structure and folding Overview: The main functional biomolecules in cells are polymers DNA, RNA and proteins For RNA and Proteins, the specific sequence of the polymer dictates its final structure

More information

The Steps. 1. Transcription. 2. Transferal. 3. Translation

The Steps. 1. Transcription. 2. Transferal. 3. Translation Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

Name Period _. Regents Biology Date _ REVIEW 5: GENETICS

Name Period _. Regents Biology Date _ REVIEW 5: GENETICS Name Period _ Regents Biology Date _ REVIEW 5: GENETICS 1. Chromosomes: a. Humans have 46 chromosomes, or _23 _ homologous pairs. Homologous: _Chromosomes of the same position and size b. Chromosome pairs

More information

Name Class Date. binomial nomenclature. MAIN IDEA: Linnaeus developed the scientific naming system still used today.

Name Class Date. binomial nomenclature. MAIN IDEA: Linnaeus developed the scientific naming system still used today. Section 1: The Linnaean System of Classification 17.1 Reading Guide KEY CONCEPT Organisms can be classified based on physical similarities. VOCABULARY taxonomy taxon binomial nomenclature genus MAIN IDEA:

More information

1 Mutation and Genetic Change

1 Mutation and Genetic Change CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds

More information

Transcription recap What is translation? Short Video Activity. Initiation Elongation Termination. Short Quiz on Thursday! 6.1 and 6.

Transcription recap What is translation? Short Video Activity. Initiation Elongation Termination. Short Quiz on Thursday! 6.1 and 6. Protein Synthesis Transcription recap What is translation? Initiation Elongation Termination Short Video Activity Short Quiz on Thursday! 6.1 and 6.2 1. RNA polymerase attaches to promoter region 2. Unwinds/unzips

More information

WEEK ONE VOCABULARY. Adhesion- the attraction between water molecules and other molecules

WEEK ONE VOCABULARY. Adhesion- the attraction between water molecules and other molecules WEEK ONE VOCABULARY Acid- hydrogen donors; acids increase the hydrogen ion concentration in solution Adhesion- the attraction between water molecules and other molecules Alpha (α) helix- secondary protein

More information

Tuesday 11/13. Agenda 1.Warm Up (Stamp HW) 2.Protein Synthesis Notes 3.HW Time (Transcription/ Translation Worksheet)

Tuesday 11/13. Agenda 1.Warm Up (Stamp HW) 2.Protein Synthesis Notes 3.HW Time (Transcription/ Translation Worksheet) Tuesday 11/13 Warm Up 1.What are the three parts of a nucleotide? How do two nucleotides link together 2.What binds the two strands of DNA together? Be Specific 3.What are the three main enzymes of DNA

More information

Database searching with DNA and protein sequences: An introduction Clare Sansom Date received (in revised form): 12th November 1999

Database searching with DNA and protein sequences: An introduction Clare Sansom Date received (in revised form): 12th November 1999 Dr Clare Sansom works part time at Birkbeck College, London, and part time as a freelance computer consultant and science writer At Birkbeck she coordinates an innovative graduate-level Advanced Certificate

More information

Concluding lesson. Student manual. What kind of protein are you? (Basic)

Concluding lesson. Student manual. What kind of protein are you? (Basic) Concluding lesson Student manual What kind of protein are you? (Basic) Part 1 The hereditary material of an organism is stored in a coded way on the DNA. This code consists of four different nucleotides:

More information

MAKING AN EVOLUTIONARY TREE

MAKING AN EVOLUTIONARY TREE Student manual MAKING AN EVOLUTIONARY TREE THEORY The relationship between different species can be derived from different information sources. The connection between species may turn out by similarities

More information

Graph theoretic approach to analyze amino acid network

Graph theoretic approach to analyze amino acid network Int. J. Adv. Appl. Math. and Mech. 2(3) (2015) 31-37 (ISSN: 2347-2529) Journal homepage: www.ijaamm.com International Journal of Advances in Applied Mathematics and Mechanics Graph theoretic approach to

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov

More information

The Central Dogma of Molecular Biology

The Central Dogma of Molecular Biology Vierstraete Andy (version 1.01) 1/02/2000 -Page 1 - The Central Dogma of Molecular Biology Figure 1 : The Central Dogma of molecular biology. DNA contains the complete genetic information that defines

More information

How to Build a Phylogenetic Tree

How to Build a Phylogenetic Tree How to Build a Phylogenetic Tree Phylogenetics tree is a structure in which species are arranged on branches that link them according to their relationship and/or evolutionary descent. A typical rooted

More information

Algorithms for Sequence Alignment. Dynamic programming

Algorithms for Sequence Alignment. Dynamic programming Algorithms for Sequence Alignment Previous lectures Global alignment (Needleman-Wunsch algorithm) Local alignment (Smith-Waterman algorithm) Heuristic method BLAST Statistics of BLAST scores Dynamic programming

More information

The joined base + sugar is called a nucleoside. Study the picture below:

The joined base + sugar is called a nucleoside. Study the picture below: BIOMOLECULES.2 (nucleic acids, genetic code) Nucleic acids -- these molecules are the basis for the genetic material of all life on Earth, and so are central for our speculations about life elsewhere.

More information

Transcription Animations

Transcription Animations Transcription Animations Name: Lew Ports Biology Place http://www.lewport.wnyric.org/jwanamaker/animations/protein%20synthesis%20-%20long.html Protein is the making of proteins from the information found

More information

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme. Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.

More information

Bob Jesberg. Boston, MA April 3, 2014

Bob Jesberg. Boston, MA April 3, 2014 DNA, Replication and Transcription Bob Jesberg NSTA Conference Boston, MA April 3, 2014 1 Workshop Agenda Looking at DNA and Forensics The DNA, Replication i and Transcription i Set DNA Ladder The Double

More information

16 Protein Synthesis: Transcription and Translation

16 Protein Synthesis: Transcription and Translation 16 Protein Synthesis: Transcription and Translation Ge n e s c a r r y t h e information that, along with environmental factors, determines an organism s traits. How does this work? Although the complete

More information

Chapter 17: From Gene to Protein

Chapter 17: From Gene to Protein Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master

More information

Term paper 1 : Prebiotic RNA Protein Co-evolution and the Origin of Life. - Swarbhanu Chatterjee.

Term paper 1 : Prebiotic RNA Protein Co-evolution and the Origin of Life. - Swarbhanu Chatterjee. Term paper 1 : Prebiotic RNA Protein Co-evolution and the Origin of Life - Swarbhanu Chatterjee. In Biology, life is defined as a cellular phenomenon that perpetuates itself in suitable conditions. The

More information

From DNA to Protein! (Transcription & Translation)! I. An Overview

From DNA to Protein! (Transcription & Translation)! I. An Overview Protein Synthesis! From DNA to Protein! (Transcription & Translation)! I. An Overview A. Certain sequences of nucleotides in DNA [called genes], can be expressed/used as a code to determine the sequence

More information

PRACTICE TEST QUESTIONS

PRACTICE TEST QUESTIONS PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

Chapter 6 DNA Replication

Chapter 6 DNA Replication Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore

More information

Using the NCBI Genome Databases to Compare the Genes for Human & Chimpanzee Beta Hemoglobin

Using the NCBI Genome Databases to Compare the Genes for Human & Chimpanzee Beta Hemoglobin Using the NCBI Genome Databases to Compare the Genes for Human & Chimpanzee Beta Hemoglobin Author(s) :Susan Offner Source: The American Biology Teacher, 72(4):252-256. 2010. Published By: National Association

More information

Transcription Study Guide

Transcription Study Guide Transcription Study Guide This study guide is a written version of the material you have seen presented in the transcription unit. The cell s DNA contains the instructions for carrying out the work of

More information

ECO-1.1: I can describe the processes that move carbon and nitrogen through ecosystems.

ECO-1.1: I can describe the processes that move carbon and nitrogen through ecosystems. Cycles of Matter ECO-1.1: I can describe the processes that move carbon and nitrogen through ecosystems. ECO-1.2: I can explain how carbon and nitrogen are stored in ecosystems. ECO-1.3: I can describe

More information

From Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

From Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp

More information

Evolution at Two Levels in Humans and Chimpanzees

Evolution at Two Levels in Humans and Chimpanzees Evolution at Two Levels in Humans and Chimpanzees Mary-Claire King and A.C. Wilson What did we know prior to 1975? 1700 s: Linnaeus and others of that time considered Great Apes to be the closest relatives

More information

A Step-by-Step Tutorial: Divergence Time Estimation with Approximate Likelihood Calculation Using MCMCTREE in PAML

A Step-by-Step Tutorial: Divergence Time Estimation with Approximate Likelihood Calculation Using MCMCTREE in PAML 9 June 2011 A Step-by-Step Tutorial: Divergence Time Estimation with Approximate Likelihood Calculation Using MCMCTREE in PAML by Jun Inoue, Mario dos Reis, and Ziheng Yang In this tutorial we will analyze

More information

Lecture 5 Mutation and Genetic Variation

Lecture 5 Mutation and Genetic Variation 1 Lecture 5 Mutation and Genetic Variation I. Review of DNA structure and function you should already know this. A. The Central Dogma DNA mrna Protein where the mistakes are made. 1. Some definitions based

More information

Unit 6 Study Guide Protein Name pg I can tell the difference between mrna, trna, and rrna.

Unit 6 Study Guide Protein Name pg I can tell the difference between mrna, trna, and rrna. Unit 6 Study Guide Protein Name pg. 1 1. I can tell the difference between mrna, trna, and rrna. Messenger RNA (mrna) acts as a copy of the instructions for making a protein. mrna carries these instructions

More information

BLAST. Anders Gorm Pedersen & Rasmus Wernersson

BLAST. Anders Gorm Pedersen & Rasmus Wernersson BLAST Anders Gorm Pedersen & Rasmus Wernersson Database searching Using pairwise alignments to search databases for similar sequences Query sequence Database Database searching Most common use of pairwise

More information

Transcription, Translation & Protein Synthesis

Transcription, Translation & Protein Synthesis Transcription, Translation & Protein Synthesis Do you remember what proteins are made of? Hundreds of Amino Acids link together to make one Protein There are 20 types of amino acids, some we can make,

More information

OUTCOMES. PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation OVERVIEW ANIMATION CONTEXT RIBONUCLEIC ACID (RNA)

OUTCOMES. PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation OVERVIEW ANIMATION CONTEXT RIBONUCLEIC ACID (RNA) OUTCOMES PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation 3.5.1 Compare the structure of RNA and DNA. 3.5.2 Outline DNA transcription in terms of the formation of an RNA strand

More information

H H N - C - C 2 R. Three possible forms (not counting R group) depending on ph

H H N - C - C 2 R. Three possible forms (not counting R group) depending on ph Amino acids - 0 common amino acids there are others found naturally but much less frequently - Common structure for amino acid - C, -N, and functional groups all attached to the alpha carbon N - C - C

More information

Lesson Overview. Fermentation. Lesson Overview 13.1 RNA

Lesson Overview. Fermentation. Lesson Overview 13.1 RNA Lesson Overview 13.1 RNA Similarities between DNA & RNA They are both nucleic acids They both have: a 5-carbon sugar, a phosphate group, a nitrogenous base. Comparing RNA and DNA There are three important

More information

Background Knowledge: Students should understand the structure of DNA and basic genetics.

Background Knowledge: Students should understand the structure of DNA and basic genetics. Biology STANDARD V: Objective 3 Title: Investigating Common Descent Background Knowledge: Students should understand the structure of DNA and basic genetics. Objective: In this activity students will build

More information

Amino Acids - Building Blocks of Proteins

Amino Acids - Building Blocks of Proteins Amino Acids - Building Blocks of Proteins Introduction Proteins are more than an important part of your diet. Proteins are complex molecular machines that are involved in nearly all of your cellular functions.

More information

Introduction to Principal Components and FactorAnalysis

Introduction to Principal Components and FactorAnalysis Introduction to Principal Components and FactorAnalysis Multivariate Analysis often starts out with data involving a substantial number of correlated variables. Principal Component Analysis (PCA) is a

More information

BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS

BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:

More information

Principles of Evolution - Origin of Species

Principles of Evolution - Origin of Species Theories of Organic Evolution X Multiple Centers of Creation (de Buffon) developed the concept of "centers of creation throughout the world organisms had arisen, which other species had evolved from X

More information

A response to charges of error in Biology by Miller & Levine

A response to charges of error in Biology by Miller & Levine A response to charges of error in Biology by Miller & Levine According to TEA, a citizen disputes two sentences on page 767 of our textbook, Biology, by Miller & Levine. These sentences are: SE 767, par.

More information

DNA to Protein BIOLOGY INSTRUCTIONAL TASKS

DNA to Protein BIOLOGY INSTRUCTIONAL TASKS BIOLOGY INSTRUCTIONAL TASKS DNA to Protein Grade-Level Expectations The exercises in these instructional tasks address content related to the following science grade-level expectations: Contents LS-H-B1

More information

Cells. DNA and Heredity

Cells. DNA and Heredity Cells DNA and Heredity ! Nucleic acids DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) Determines how cell function " change the DNA and you change the nature of the organism Changes of DNA allows

More information

Hidden Markov Models

Hidden Markov Models 8.47 Introduction to omputational Molecular Biology Lecture 7: November 4, 2004 Scribe: Han-Pang hiu Lecturer: Ross Lippert Editor: Russ ox Hidden Markov Models The G island phenomenon The nucleotide frequencies

More information

Lab # 12: DNA and RNA

Lab # 12: DNA and RNA 115 116 Concepts to be explored: Structure of DNA Nucleotides Amino Acids Proteins Genetic Code Mutation RNA Transcription to RNA Translation to a Protein Figure 12. 1: DNA double helix Introduction Long

More information

Central Dogma of Genetics

Central Dogma of Genetics Central Dogma of Genetics Within each cell the genetic information flows from DNA to RNA to protein. This flow of information is unidirectional and irreversible. The information carried within the DNA

More information

PAHs (Polycyclic Aromatic Hydrocarbons) and the Origins of Life. Alexander Karol Padden Murphy Scott Pruessing

PAHs (Polycyclic Aromatic Hydrocarbons) and the Origins of Life. Alexander Karol Padden Murphy Scott Pruessing PAHs (Polycyclic Aromatic Hydrocarbons) and the Origins of Life Alexander Karol Padden Murphy Scott Pruessing What Are PAHs? PAHS are very stable organic molecules made up of only carbon and hydrogen PAHS

More information

Name: Date: Period: DNA Unit: DNA Webquest

Name: Date: Period: DNA Unit: DNA Webquest Name: Date: Period: DNA Unit: DNA Webquest Part 1 History, DNA Structure, DNA Replication DNA History http://www.dnaftb.org/dnaftb/1/concept/index.html Read the text and answer the following questions.

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

Chapter 5: The Structure and Function of Large Biological Molecules

Chapter 5: The Structure and Function of Large Biological Molecules Name Period Concept 5.1 Macromolecules are polymers, built from monomers 1. The large molecules of all living things fall into just four main classes. Name them. 2. Circle the three classes that are called

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

What next? Computational Biology and Bioinformatics. Finding homologs 2. Finding homologs. 4. Searching for homologs with BLAST

What next? Computational Biology and Bioinformatics. Finding homologs 2. Finding homologs. 4. Searching for homologs with BLAST Computational Biology and Bioinformatics 4. Searching for homologs with BLAST What next? Comparing sequences and searching for homologs Sequence alignment and substitution matrices Searching for sequences

More information

What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations

What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations http://members.cox.net/amgough/mutation_chromosome_translocation.gif Introduction: In biology, mutations are changes to the base

More information

13.2 Ribosomes & Protein Synthesis

13.2 Ribosomes & Protein Synthesis 13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).

More information

DNA Glycosylase Exercise - Levels 1 & 2: Answer Key

DNA Glycosylase Exercise - Levels 1 & 2: Answer Key Name StarBiochem DNA Glycosylase Exercise - Levels 1 & 2: Answer Key Background In this exercise, you will explore the structure of a DNA repair protein found in most species, including bacteria. DNA repair

More information

Introduction to Phylogenetic Analysis

Introduction to Phylogenetic Analysis Subjects of this lecture Introduction to Phylogenetic nalysis Irit Orr 1 Introducing some of the terminology of phylogenetics. 2 Introducing some of the most commonly used methods for phylogenetic analysis.

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

Lecture 3: Mutations

Lecture 3: Mutations Lecture 3: Mutations Recall that the flow of information within a cell involves the transcription of DNA to mrna and the translation of mrna to protein. Recall also, that the flow of information between

More information

Written by: Prof. Brian White

Written by: Prof. Brian White Molecular Biology II: DNA Transcription Written by: Prof. Brian White Learning Goals: To work with a physical model of DNA and RNA in order to help you to understand: o rules for both DNA & RNA structure

More information

DNA Insertions and Deletions in the Human Genome. Philipp W. Messer

DNA Insertions and Deletions in the Human Genome. Philipp W. Messer DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.

More information

Separation of Amino Acids by Paper Chromatography

Separation of Amino Acids by Paper Chromatography Separation of Amino Acids by Paper Chromatography Chromatography is a common technique for separating chemical substances. The prefix chroma, which suggests color, comes from the fact that some of the

More information

Focusing on results not data comprehensive data analysis for targeted next generation sequencing

Focusing on results not data comprehensive data analysis for targeted next generation sequencing Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes

More information

Genetics Notes C. Molecular Genetics

Genetics Notes C. Molecular Genetics Genetics Notes C Molecular Genetics Vocabulary central dogma of molecular biology Chargaff's rules messenger RNA (mrna) ribosomal RNA (rrna) transfer RNA (trna) Your DNA, or deoxyribonucleic acid, contains

More information

DNA Web Quest. 2. Who discovered that individual traits are passed on from one generation to the next? In what year?

DNA Web Quest. 2. Who discovered that individual traits are passed on from one generation to the next? In what year? Part 1 Introduction, History, DNA Structure, DNA Replication Introduction Go to http://science.howstuffworks.com/cell4.htm Read the text. As you read fill in the blanks below. Stop! 1 DNA History Go to

More information

6.4 Normal Distribution

6.4 Normal Distribution Contents 6.4 Normal Distribution....................... 381 6.4.1 Characteristics of the Normal Distribution....... 381 6.4.2 The Standardized Normal Distribution......... 385 6.4.3 Meaning of Areas under

More information

Regents Biology REGENTS REVIEW: PROTEIN SYNTHESIS

Regents Biology REGENTS REVIEW: PROTEIN SYNTHESIS Period Date REGENTS REVIEW: PROTEIN SYNTHESIS 1. The diagram at the right represents a portion of a type of organic molecule present in the cells of organisms. What will most likely happen if there is

More information

Vector NTI Advance 11 Quick Start Guide

Vector NTI Advance 11 Quick Start Guide Vector NTI Advance 11 Quick Start Guide Catalog no. 12605050, 12605099, 12605103 Version 11.0 December 15, 2008 12605022 Published by: Invitrogen Corporation 5791 Van Allen Way Carlsbad, CA 92008 U.S.A.

More information

Lab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS

Lab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS Lab 2/Phylogenetics/September 16, 2002 1 Read: Tudge Chapter 2 PHYLOGENETICS Objective of the Lab: To understand how DNA and protein sequence information can be used to make comparisons and assess evolutionary

More information

INTRODUCTION TO DNA. DNA, CHROMOSOMES AND GENES How do these terms relate to one another?

INTRODUCTION TO DNA. DNA, CHROMOSOMES AND GENES How do these terms relate to one another? INTRODUCTION TO DNA You've probably heard the term a million times. You know that DNA is something inside cells; you probably know that DNA has something to do with who we are and how we get to look the

More information