Classic and Next-Gen Sequencing Technologies. David Miller Australian Genome Research Facility
|
|
- Ferdinand Henry
- 7 years ago
- Views:
Transcription
1 Classic and Next-Gen Sequencing Technologies David Miller Australian Genome Research Facility 6 th July 2009
2 Overview of Presentation
3 Milestones 1953 Discovery of the structure of the DNA double helix Development of recombinant DNA technology, which permits isolation of defined fragments of DNA; prior to this, the only accessible samples for sequencing were from bacteriophage or virus DNA The first complete DNA genome to be sequenced is that of bacteriophage φx Allan Maxam and Walter Gilbert publish "DNA sequencing by chemical degradation". [3] Frederick Sanger, independently, publishes "DNA sequencing by enzymatic synthesis" Frederick Sanger and Walter Gilbert receive the Nobel Prize in Chemistry 1984 Medical Research Council scientists decipher the complete DNA sequence of the Epstein-Barr virus, 170 kb Leroy E. Hood's laboratory at the California Institute of Technology and Smith announce the first semi-automated DNA sequencing machine Applied Biosystems markets first automated sequencing machine, the model ABI The U.S. National Institutes of Health (NIH) begins large-scale sequencing trials on Mycoplasma capricolum, Escherichia coli, Caenorhabditis elegans, and Saccharomyces cerevisiae (at 75 cents (US)/base) Richard Mathies et al. publish dye-based sequencing Phil Green and Brent Ewing of the University of Washington publish phred for sequencer data analysis.
4 History of DNA Sequencing Frederick Sanger Only person to receive two Noble prizes in Chemistry. One of only four people ever to receive two Nobel prizes. Only living person to receive two Nobel prizes.
5 Human Genome Project Brief Overview 15 year project began in 1990 US $3 Billion dollar project 2000 first draft genome was announced 2003 complete genome announced 2006 final chromosome published in nature
6 Human Genome Project Project Goals identify all the approximately 20,000-25,000 genes in human DNA, determine the sequences of the 3 billion chemical base pairs that make up human DNA, store this information in databases, improve tools for data analysis, transfer related technologies to the private sector, and address the ethical, legal, and social issues (ELSI) that may arise from the project.
7 Human Genome Project Goals and Completion Dates Area HGP Goal Standard Achieved Date Achieved Genetic Map 2- to 5-cM resolution map 1-cM resolution map (3,000 September 1994 (600 1,500 markers) markers) Physical Map 30,000 STSs 52,000 STSs October 1998 DNA Sequence 95% of gene-containing part of human sequence finished to 99.99% accuracy 99% of gene-containing part of human sequence finished to 99.99% accuracy April 2003 Capacity and Cost of Finished Sequence Human Sequence Variation Sequence 500 Mb/year at < $0.25 per finished base 100,000 mapped human SNPs Sequence >1,400 Mb/year at <$0.09 per finished base November million mapped human SNPs February 2003 Gene Identification Full-length human cdnas 15,000 full-length human cdnas March 2003 Model Organisms Complete genome sequences of E. coli, S. cerevisiae, C. eleg ans,d. melanogaster Finished genome sequences of E. coli,s. cerevisiae, C. elegans, D. melanogaster, plus wholegenome drafts of several others, including C. briggsae, D. pseudoobscura, mouse and rat April 2003
8 Shotgun Sequencing Approach
9 1977 Classic Sequencing Technologies Allan Maxam and Walter Gilbert publish "DNA sequencing by chemical degradation". [3] Frederick Sanger, independently, publishes "DNA sequencing by enzymatic synthesis". Both methods generate fragment pools which are resolved via electrophoresis with a resolution of 1 BP.
10 Reactions to 1 Lane Sequencing Reaction Products Progression of Sequencing Reaction
11 Classic Sequencing Technologies
12 ABI377
13 Capillary Based Electrophoresis
14 Raw Data
15 Electropherograms
16 ABI3700
17 MegaBACE 1000
18 ABI3730xl
19 Sanger Sequencing Maximum yield / days <3,000,000bp <0.1% of the human genome 1000 days of sequencing for a 1 fold coverage...
20 Next-Gen Sequencing Technologies
21 Next-Gen Sequencing Technologies Three platforms, three technologies All massively parallel sequencing Read lengths vary from ~36bp to >400bp Read numbers vary from ~ 1 Million to >150 Million per run
22 Next-Gen Sequencing Technologies 4.50E E+06 Raw Data Storage (Mb) 3.50E E E E E E E E GS- 20 GS- FLX GS- FLX TI GAII 1x 18 GAII 1x 26 GAII 1x 35 GAII GAIIx 2x 35 2x 35 GAII GAIIx 2x 50 2x 50 GAII GAIIx 2x 75 2x 75 Instrument Run Type
23 Next-Gen Sequencing Technologies Roche GS-FLX Illumina GAII ABI SOLiD
24 Roche GS-Flx
25 Workflow Sample Fragmentation Library Preparation empcr Setup empcr Amplification Pyrosequencing Data Analysis
26 Sample Fragmentation and Library Generation
27 empcr Emulsion PCR is a method of clonal amplification which allows for millions of unique PCRs to be performed at once through the generation of micro-reactors.
28 empcr The Water-in-Oil-Emulsion
29 Pyrosequencing
30 Data Analysis Raw Image Files
31 Platform Updates Maximum yield / days 1,000,000,000bp 30% of the human genome ~3 days of sequencing for a 1 fold coverage...
32 Illumina GAII
33 Illumina Library Preparation Stylised graphic of the Paired-End library preparation taken from the Paired-End Protocol
34 Illumina Sequencing Technology Robust Reversible Terminator Chemistry Foundation 3 5 DNA ( ug) Sample preparation Cluster growth A C T C T G C T G A A G 5 T G C T A C G A T A C C C G A T C G A T Sequencing T G C T A C G A T Image acquisition Base calling
35 Illumina GAII Development 2009 Roadmap
36 SCS 2.4 and Pipeline 1.4 Two recent software updates from Illumina Huge impact on data yields by not only increasing the number of clusters detectable, but also the number of clusters that pass quality filtering Originally aimed for ~50 Million reads / run Now aiming for ~150 Million reads / run
37 Platform Updates Maximum yield / days 2,000,000,000bp 60% of the human genome ~1.5 days of sequencing for a 1 fold coverage...
38 ABI SOLiD
39 ABI ColorSpace
40 ABI SOLiD
41 empcr and Enrichment
42 Bead Deposition 3 Modification allows covalent bonding to the slide surface
43 Sequencing by Ligation
44 Base Interrogations
45
46 Genome Web
47 Summary Both SOLiD and GS-FLX use empcr Both GS-FLX and GAII sequence by synthesis GAII uses cluster generation similar to the polony approach SOLiD sequencing by ligation GS-FLX provides ~100x decrease in costs compared to Sanger Sequencing GAII and SOLiD ~10x decrease in costs over GS- FLX (though this is probably increasing given the huge increase in output)
48 Applications
49 Targeted Enrichment Sequencing costs have shifted significantly from sequencing to up-front sample preparation, libraries, amplification Recent applications from Roche Nimblegen and Agilent Technologies have allowed for sequence capture through the use of microarrays Resulted in two products, Nimblgen Sequence Capture Arrays and Agilent SureSelect
50 SureSelect In-Solution Capture
51 Nimblegen Sequence Capture Arrays
52 PET-SEQ
53 PET-SEQ Mate-Pair P1 Tag1 Internal Adapter Tag2 P2 Tag Reads Reference Inversions Tag Reads Reference Insertions Deletions
54 Next-Next Next-Gen Sequencing Technologies
55
56 Websites of Note emsequencing/index.htm
57 THANKS David Miller Australian Genome Research Facility 6 th July 2009
Automated DNA sequencing 20/12/2009. Next Generation Sequencing
DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing
More informationNext Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
More informationJuly 7th 2009 DNA sequencing
July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer
More informationNext generation DNA sequencing technologies. theory & prac-ce
Next generation DNA sequencing technologies theory & prac-ce Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing
More informationGenetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
More informationOverview of Next Generation Sequencing platform technologies
Overview of Next Generation Sequencing platform technologies Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Outline 1. Technologies
More informationIntroduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
More informationG E N OM I C S S E RV I C ES
GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E
More informationIntroduction to next-generation sequencing data
Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS
More informationThe Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics
The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long
More informationNGS data analysis. Bernardo J. Clavijo
NGS data analysis Bernardo J. Clavijo 1 A brief history of DNA sequencing 1953 double helix structure, Watson & Crick! 1977 rapid DNA sequencing, Sanger! 1977 first full (5k) genome bacteriophage Phi X!
More informationAn Overview of DNA Sequencing
An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure
More information14/12/2012. HLA typing - problem #1. Applications for NGS. HLA typing - problem #1 HLA typing - problem #2
www.medical-genetics.de Routine HLA typing by Next Generation Sequencing Kaimo Hirv Center for Human Genetics and Laboratory Medicine Dr. Klein & Dr. Rost Lochhamer Str. 9 D-8 Martinsried Tel: 0800-GENETIK
More informationDNA Sequencing & The Human Genome Project
DNA Sequencing & The Human Genome Project An Endeavor Revolutionizing Modern Biology Jutta Marzillier, Ph.D Lehigh University Biological Sciences November 13 th, 2013 Guess, who turned 60 earlier this
More informationNext Generation Sequencing
Next Generation Sequencing DNA sequence represents a single format onto which a broad range of biological phenomena can be projected for high-throughput data collection Over the past three years, massively
More informationHow is genome sequencing done?
How is genome sequencing done? Using 454 Sequencing on the Genome Sequencer FLX System, DNA from a genome is converted into sequence data through four primary steps: Step One DNA sample preparation; Step
More informationNew generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova
New generation sequencing: current limits and future perspectives Giorgio Valle CRIBI Università di Padova Around 2004 the Race for the 1000$ Genome started A few questions... When? How? Why? Standard
More informationRecombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
More informationGenomics Services @ GENterprise
Genomics Services @ GENterprise since 1998 Mainz University spin-off privately financed 6-10 employees since 2006 Genomics Services @ GENterprise Sequencing Service (Sanger/3730, 454) Genome Projects (Bacteria,
More informationDNA Sequence Analysis
DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide
More informationUniversidade Estadual de Maringá
Universidade Estadual de Maringá Disciplina: Biologia Molecular Sequenciamento de ácidos nucléicos Profa. Dra. Maria Aparecida Fernandez Maxan e Gilbert - quebra química Berg, Gilbert and Sanger dideoxinucleotideos
More informationBasic Concepts of DNA, Proteins, Genes and Genomes
Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate
More informationSanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne
Sanger Sequencing and Quality Assurance Zbigniew Rudzki Department of Pathology University of Melbourne Sanger DNA sequencing The era of DNA sequencing essentially started with the publication of the enzymatic
More informationIntroduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov
More informationrestriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
More informationNext Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took
More informationChapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
More informationSEQUENCING. From Sample to Sequence-Ready
SEQUENCING From Sample to Sequence-Ready ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES, NOT ONCE, BUT EVERY TIME The highest-quality amplicons more sensitive, accurate, and specific Full support for all major
More informationConcepts and methods in sequencing and genome assembly
BCM-2004 Concepts and methods in sequencing and genome assembly B. Franz LANG, Département de Biochimie Bureau: H307-15 Courrier électronique: Franz.Lang@Umontreal.ca Outline 1. Concepts in DNA and RNA
More informationBRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls?
BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? Giovanni Luca Scaglione, PhD ------------------------ Laboratory of Clinical Molecular Diagnostics and Personalized Medicine, Institute
More information- In 1976 1977, Allan Maxam and walter Gilbert devised the first method for sequencing DNA fragments containing up to ~ 500 nucleotides.
DNA Sequencing - DNA sequencing includes several methods and technologies that are used for determining the order of the nucleotide bases adenine, guanine, cytosine, and thymine in a molecule of DNA. -
More informationIllumina Sequencing Technology
Illumina Sequencing Technology Highest data accuracy, simple workflow, and a broad range of applications. Introduction Figure 1: Illumina Flow Cell Illumina sequencing technology leverages clonal array
More informationAnalysis of DNA methylation: bisulfite libraries and SOLiD sequencing
Analysis of DNA methylation: bisulfite libraries and SOLiD sequencing An easy view of the bisulfite approach CH3 genome TAGTACGTTGAT TAGTACGTTGAT read TAGTACGTTGAT TAGTATGTTGAT Three main problems 1.
More informationNazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office
2013 Laboratory Accreditation Program Audioconferences and Webinars Implementing Next Generation Sequencing (NGS) as a Clinical Tool in the Laboratory Nazneen Aziz, PhD Director, Molecular Medicine Transformation
More information1865 Discovery: Heredity Transmitted in Units
1859 Discovery: Natural Selection Genetic Timeline Charles Darwin wrote On the Origin of Species by Means of Natural Selection, or the Preservation of Favored Races in the Struggle for Life. 1865 Discovery:
More informationBioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing
STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAAC GTGCAC GTGAAC Wouter Coppieters Head of the genomics core facility GIGA center, University of Liège Bioruptor NGS: Unbiased DNA
More informationTruSeq Custom Amplicon v1.5
Data Sheet: Targeted Resequencing TruSeq Custom Amplicon v1.5 A new and improved amplicon sequencing solution for interrogating custom regions of interest. Highlights Figure 1: TruSeq Custom Amplicon Workflow
More informationCore Facility Genomics
Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray
More informationThe NGS IT notes. George Magklaras PhD RHCE
The NGS IT notes George Magklaras PhD RHCE Biotechnology Center of Oslo & The Norwegian Center of Molecular Medicine University of Oslo, Norway http://www.biotek.uio.no http://www.ncmm.uio.no http://www.no.embnet.org
More informationGenotyping by sequencing and data analysis. Ross Whetten North Carolina State University
Genotyping by sequencing and data analysis Ross Whetten North Carolina State University Stein (2010) Genome Biology 11:207 More New Technology on the Horizon Genotyping By Sequencing Timeline 2007 Complexity
More informationThe author(s) shown below used Federal funds provided by the U.S. Department of Justice and prepared the following final report:
The author(s) shown below used Federal funds provided by the U.S. Department of Justice and prepared the following final report: Document Title: Author(s): Resolution of DNA Mixtures and Analysis of Degraded
More informationComputational Genomics. Next generation sequencing (NGS)
Computational Genomics Next generation sequencing (NGS) Sequencing technology defies Moore s law Nature Methods 2011 Log 10 (price) Sequencing the Human Genome 2001: Human Genome Project 2.7G$, 11 years
More informationHistory of DNA Sequencing & Current Applications
History of DNA Sequencing & Current Applications Christopher McLeod President & CEO, 454 Life Sciences, A Roche Company IMPORTANT NOTICE Intended Use Unless explicitly stated otherwise, all Roche Applied
More informationNew Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.
New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
More informationGeospiza s Finch-Server: A Complete Data Management System for DNA Sequencing
KOO10 5/31/04 12:17 PM Page 131 10 Geospiza s Finch-Server: A Complete Data Management System for DNA Sequencing Sandra Porter, Joe Slagel, and Todd Smith Geospiza, Inc., Seattle, WA Introduction The increased
More informationWelcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation.
Introduction to SMRTbell Template Preparation 100 338 500 01 1. SMRTbell Template Preparation 1.1 Introduction to SMRTbell Template Preparation Welcome to Pacific Biosciences' Introduction to SMRTbell
More informationChapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes
Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes 2.1 Introduction Large-scale insertional mutagenesis screening in
More informationRecombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
More informationAll your base(s) are belong to us
All your base(s) are belong to us The dawn of the high-throughput DNA sequencing era 25C3 Magnus Manske The place Sanger Center, Cambridge, UK Basic biology Level of complexity Genome Single (all chromosomes
More informationHuman Genome and Human Genome Project. Louxin Zhang
Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular
More informationBioanalyzer Applications for
Bioanalyzer Applications for Next-Gen Sequencing: Updates and Tips March 1 st, 2011 Charmian Cher, Ph.D Field Applications Scientist Page 1 Agenda 1 2 3 Next-gen sequencing library preparation workflow
More informationData Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
More informationMiSeq: Imaging and Base Calling
MiSeq: Imaging and Page Welcome Navigation Presenter Introduction MiSeq Sequencing Workflow Narration Welcome to MiSeq: Imaging and. This course takes 35 minutes to complete. Click Next to continue. Please
More informationGene Expression Assays
APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency
More informationNGS Technologies for Genomics and Transcriptomics
NGS Technologies for Genomics and Transcriptomics Massimo Delledonne Department of Biotechnologies - University of Verona http://profs.sci.univr.it/delledonne 13 years and $3 billion required for the Human
More informationSNP genotyping. Gene expression. And now Solexa sequencing.
SNP genotyping. Gene expression. And now Solexa sequencing. Let s find the answers together. It s your research. You question. You test. You want answers quickly, accurately, and at a good value. Illumina
More informationTechniques in Molecular Biology (to study the function of genes)
Techniques in Molecular Biology (to study the function of genes) Analysis of nucleic acids: Polymerase chain reaction (PCR) Gel electrophoresis Blotting techniques (Northern, Southern) Gene expression
More informationAdvances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage
Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research March 17, 2011 Rendez-Vous Séquençage Presentation Overview Core Technology Review Sequence Enrichment Application
More informationIntroduction Bioo Scientific
Next Generation Sequencing Catalog 2014-2015 Introduction Bioo Scientific Bioo Scientific is a global life science company headquartered in Austin, TX, committed to providing innovative products and superior
More informationHandling next generation sequence data
Handling next generation sequence data a pilot to run data analysis on the Dutch Life Sciences Grid Barbera van Schaik Bioinformatics Laboratory - KEBB Academic Medical Center Amsterdam Very short intro
More informationAppendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
More informationThe Human Genome Project
The Human Genome Project Brief History of the Human Genome Project Physical Chromosome Maps Genetic (or Linkage) Maps DNA Markers Sequencing and Annotating Genomic DNA What Have We learned from the HGP?
More informationFocusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
More informationSingle-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation
PN 100-9879 A1 TECHNICAL NOTE Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation Introduction Cancer is a dynamic evolutionary process of which intratumor genetic and phenotypic
More informationHow many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
More informationGo where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe
Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. To published results faster With proven scalability To the forefront of discovery To limitless applications
More informationDe Novo Assembly Using Illumina Reads
De Novo Assembly Using Illumina Reads High quality de novo sequence assembly using Illumina Genome Analyzer reads is possible today using publicly available short-read assemblers. Here we summarize the
More informationLecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
More informationNext Generation Sequencing for DUMMIES
Next Generation Sequencing for DUMMIES Looking at a presentation without the explanation from the author is sometimes difficult to understand. This document contains extra information for some slides that
More informationData Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms
Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Introduction Mate pair sequencing enables the generation of libraries with insert sizes in the range of several kilobases (Kb).
More informationSimplifying Data Interpretation with Nexus Copy Number
Simplifying Data Interpretation with Nexus Copy Number A WHITE PAPER FROM BIODISCOVERY, INC. Rapid technological advancements, such as high-density acgh and SNP arrays as well as next-generation sequencing
More information2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
More informationSequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website
Biomolecular Core Facility AI Dupont Hospital for Children, Rockland Center One, Room 214 Core: (302) 651-6712, Office: (302) 651-6707, mbcore@nemours.org Katia Sol-Church, Ph.D., Director Jennifer Frenck
More informationBioinformatics I, WS 09-10, D. Huson, January 27, 2010 145
Bioinformatics I, WS 09-10, D. Huson, January 27, 2010 145 10 DNA sequencing This exposition is very closely based on the following sources, which are all recommended reading: 1. Clyde A. Hutchison, DNA
More informationFirst generation" sequencing technologies and genome assembly. Roger Bumgarner Associate Professor, Microbiology, UW Rogerb@u.washington.
First generation" sequencing technologies and genome assembly Roger Bumgarner ssociate Professor, Microbiology, UW Rogerb@u.washington.edu Why discuss a technology that appears to be being replaced? Next
More informationTargeted. sequencing solutions. Accurate, scalable, fast TARGETED
Targeted TARGETED Sequencing sequencing solutions Accurate, scalable, fast Sequencing for every lab, every budget, every application Ion Torrent semiconductor sequencing Ion Torrent technology has pioneered
More informationFOR REFERENCE PURPOSES
BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit
More informationShort History of DNA Sequencing. Institute of Biotechnology. Lars Paulin. DNA Sequencing Technologies. Genomics Laboratory. Institute of Biotechnology
Lars Paulin Viikki Science Park 1999 DNA Sequencing Technologies DNA Sequencing and Genomics Laboratory Institute of Biotechnology University of Helsinki http://www.biocenter.helsinki.fi/bi/dnagen www.biocenter.helsinki.fi/bi/dnagen/
More informationForensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
More informationLectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling
Lectures 1 and 8 15 February 7, 2013 This is a review of the material from lectures 1 and 8 14. Note that the material from lecture 15 is not relevant for the final exam. Today we will go over the material
More informationComplete Genomics Sequencing
TECHNOLOGY OVERVIEW Complete Genomics Sequencing Introduction With advances in nanotechnology, high-throughput instruments, and large-scale computing, it has become possible to sequence a complete human
More informationPreciseTM Whitepaper
Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis
More informationReal time and Quantitative (RTAQ) PCR. so I have an outlier and I want to see if it really is changed
Real time and Quantitative (RTAQ) PCR or.. for this audience so I have an outlier and I want to see if it really is changed Nigel Walker, Ph.D. Laboratory of Computational Biology and Risk Analysis, Environmental
More informationReading DNA Sequences:
Reading DNA Sequences: 18-th Century Mathematics for 21-st Century Technology Michael Waterman University of Southern California Tsinghua University DNA Genetic information of an organism Double helix,
More informationBig data in cancer research : DNA sequencing and personalised medicine
Big in cancer research : DNA sequencing and personalised medicine Philippe Hupé Conférence BIGDATA 04/04/2013 1 - Titre de la présentation - nom du département émetteur et/ ou rédacteur - 00/00/2005 Deciphering
More informationLifeScope Genomic Analysis Software 2.5
USER GUIDE LifeScope Genomic Analysis Software 2.5 Graphical User Interface DATA ANALYSIS METHODS AND INTERPRETATION Publication Part Number 4471877 Rev. A Revision Date November 2011 For Research Use
More informationIntroduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
More informationSMRT Analysis v2.2.0 Overview. 1. SMRT Analysis v2.2.0. 1.1 SMRT Analysis v2.2.0 Overview. Notes:
SMRT Analysis v2.2.0 Overview 100 338 400 01 1. SMRT Analysis v2.2.0 1.1 SMRT Analysis v2.2.0 Overview Welcome to Pacific Biosciences' SMRT Analysis v2.2.0 Overview 1.2 Contents This module will introduce
More informationAnalysis of ChIP-seq data in Galaxy
Analysis of ChIP-seq data in Galaxy November, 2012 Local copy: https://galaxy.wi.mit.edu/ Joint project between BaRC and IT Main site: http://main.g2.bx.psu.edu/ 1 Font Conventions Bold and blue refers
More informationBiotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
More informationGenetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.
Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists
More informationAssuring the Quality of Next-Generation Sequencing in Clinical Laboratory Practice. Supplementary Guidelines
Assuring the Quality of Next-Generation Sequencing in Clinical Laboratory Practice Next-generation Sequencing: Standardization of Clinical Testing (Nex-StoCT) Workgroup Principles and Guidelines Supplementary
More informationDescription: Molecular Biology Services and DNA Sequencing
Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:
More informationHigh Performance Compu2ng Facility
High Performance Compu2ng Facility Center for Health Informa2cs and Bioinforma2cs Accelera2ng Scien2fic Discovery and Innova2on in Biomedical Research at NYULMC through Advanced Compu2ng Efstra'os Efstathiadis,
More informationPersonal Genome Sequencing with Complete Genomics Technology. Maido Remm
Personal Genome Sequencing with Complete Genomics Technology Maido Remm 11 th Oct 2010 Three related papers 1. Describing the Complete Genomics technology Drmanac et al., Science 1 January 2010: Vol. 327.
More informationAnalysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics
Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics Christopher Benner, PhD Director, Integrative Genomics and Bioinformatics Core (IGC) idash Webinar,
More informationIntroduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
More information1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.
Chapter IV Molecular Computation These lecture notes are exclusively for the use of students in Prof. MacLennan s Unconventional Computation course. c 2013, B. J. MacLennan, EECS, University of Tennessee,
More informationGenome and DNA Sequence Databases. BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009
Genome and DNA Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009 Admin Reading: Chapters 1 & 2 Notes available in PDF format on-line (see class calendar page): http://www.soe.ucsc.edu/classes/bme110/spring09/bme110-calendar.html
More information