Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Size: px
Start display at page:

Download "Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company"

Transcription

1 Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just a characteristic risk versus benefit Germ-line gene therapy currently impractical Somatic gene therapy in clinical trials Overview Genomics is the molecular mapping and characterization of whole genomes and whole sets of gene products. Consecutive high-resolution genetic and physical maps culminate in the complete DNA sequence. Sequencing strategies depend upon the size of the genome and the distribution of its repetitive sequences. Assembly of sequences is done clone by clone or by whole genome assembly, or both. Computational analysis is used to describe encoded information whereas functional genomics explores function and interaction of gene products. Genomics Focuses on the entire genome Made possible by advances in technology automated cloning and sequencing (robotics) allowing high throughput computerized tracking and analysis of sequences Insights into global organization, expression, regulation and evolution enumeration of genes identification regulatory and functional motifs Functional genomics to determine actual function of genetic material

2 Genome projects Starts with high-resolution recombination and cytogenetic maps of each chromosome Followed by physical characterization and positioning of cloned DNA fragments to anchor to high-resolution map Followed by large-scale sequencing and analysis clone-based sequencing whole genome shotgun sequencing Last step: functional genomics (the hard part) Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company High-resolution genetic maps Start with low-resolution maps from existing recombination maps Next, layer DNA polymorphisms onto map e.g., neutral DNA sequence variation not associated with phenotypic variation phenotypic consequences, if any, irrelevant such DNA markers behave as allelic gene pairs and can be detected by Southern blotting or PCR mapped by recombination or cytogenetics

3 Physical maps Maps of physically isolated pieces of genome, i.e., cloned DNA previously cloned DNA can be localized to map by Southern blotting or PCR to measure location and distance useful in assembly of sequences Vectors with large inserts are most useful Overlapping clones are assembled into contigs, ideally, one per chromosome mapping of restriction sites sequence-tagged sites (STSs) RFLP Restriction fragment length polymorphism May or may not be neutral Detected by Southern blotting or PCR Multiple RFLPs can be mapped by classical segregation analysis Example: = cut site = primer restriction digestion of PCR products yields one fragment for allele A and two fragments for a note that homozygotes and heterozygote have different restriction patterns, permitting identification of carrier A a

4 Short-sequence repeat markers Tandemly repeated Variable numbers of repeats, give different size restriction fragments detected on Southern blots Single sequence length polymorphisms (SSLPs) e.g., TGACGTATGACGTATGACGTATGACGTA mutations give rise to large number of alleles higher proportion of heterozygotes two types in genomics minisatellite (VNTRs) microsatellite Minisatellites and microsatellites Minisatellites based on variation of number of tandem repeats (VNTRs) which segregate as alleles in humans, repeat unit is nucleotides, for total of 1-5 kb if number of repeats is variable, Southern blot will show numerous bands basis of DNA fingerprinting and can be used in mapping Microsatellites sequences dispersed throughout the genome variable numbers of dinucleotide repeats detected by PCR Short-sequence repeat markers Tandemly repeated Variable numbers of repeats, give different size restriction fragments detected on Southern blots Single sequence length polymorphisms (SSLPs) e.g., TGACGTATGACGTATGACGTATGACGTA mutations give rise to large number of alleles higher proportion of heterozygotes two types in genomics minisatellite (VNTRs) microsatellite

5 Microsatellite markers Simple sequences of tandem, repetitive DNA runs, 2,3,4,up to 8 bp - ex: CATCATCATCAT scattered at random in the genome Variation in the number of repeat elements exists for any position (locus) in the genome PCR primers can be designed to unique regions that span the repeat, predicted to vary in length Amplify the region, run the amplicons on an electrophoretic gel to determine allele size example: chrom 1A 16 repeats, chrom 1B 22 repeats, if this is a microsat trimer, how many bp differences should exist between the 2 alleles? Ans: 3 x 16 = 48, 3 x 22 = 66, = 18bp

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1 CAP 5510-8 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Genomic Mapping & Mapping Databases High resolution, genome-wide maps of DNA markers. Integrated maps, genome catalogs and comprehensive

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

Chapter 12 - DNA Technology

Chapter 12 - DNA Technology Bio 100 DNA Technology 1 Chapter 12 - DNA Technology Among bacteria, there are 3 mechanisms for transferring genes from one cell to another cell: transformation, transduction, and conjugation 1. Transformation

More information

Gene Mapping Techniques

Gene Mapping Techniques Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction

More information

BSCI410-Liu/SP07 Exam #2 Apr. 5, 2007

BSCI410-Liu/SP07 Exam #2 Apr. 5, 2007 Your Name: KEY UID# 1. (20 points) Dr. Liu has isolated a recessive Arabidopsis mutation; mutants homozygous for this mutation produce small seeds. She named this mutant tiny. To map and clone the corresponding

More information

Genetic Polymorphism. References. The story so far. We can explain how these dominant and recessive traits are inherited

Genetic Polymorphism. References. The story so far. We can explain how these dominant and recessive traits are inherited Week 1, Hilary Term Genetic Polymorphism Biology Hon. Mods: Cells and Genes 1.4 Genes 2 Human Sciences Prelims: Genetics and Evolution Lecturer: Rosalind Harding email: rosalind.harding@zoo.ox.ac.uk http://www.stats.ox.ac.uk/~harding

More information

The Human Genome Project

The Human Genome Project The Human Genome Project Brief History of the Human Genome Project Physical Chromosome Maps Genetic (or Linkage) Maps DNA Markers Sequencing and Annotating Genomic DNA What Have We learned from the HGP?

More information

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes.

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology has had-and will havemany important

More information

Arabidopsis. A Practical Approach. Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham

Arabidopsis. A Practical Approach. Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham Arabidopsis A Practical Approach Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham OXPORD UNIVERSITY PRESS List of Contributors Abbreviations xv xvu

More information

Gene mutation and molecular medicine Chapter 15

Gene mutation and molecular medicine Chapter 15 Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter

More information

Commonly Used STR Markers

Commonly Used STR Markers Commonly Used STR Markers Repeats Satellites 100 to 1000 bases repeated Minisatellites VNTR variable number tandem repeat 10 to 100 bases repeated Microsatellites STR short tandem repeat 2 to 6 bases repeated

More information

Human Mendelian Disorders. Genetic Technology. What is Genetics? Genes are DNA 9/3/2008. Multifactorial Disorders

Human Mendelian Disorders. Genetic Technology. What is Genetics? Genes are DNA 9/3/2008. Multifactorial Disorders Human genetics: Why? Human Genetics Introduction Determine genotypic basis of variant phenotypes to facilitate: Understanding biological basis of human genetic diversity Prenatal diagnosis Predictive testing

More information

CHAPTER 14 LECTURE NOTES: RECOMBINANT DNA TECHNOLOGY

CHAPTER 14 LECTURE NOTES: RECOMBINANT DNA TECHNOLOGY CHAPTER 14 LECTURE NOTES: RECOMBINANT DNA TECHNOLOGY I. General Info A. Landmarks in modern genetics 1. Rediscovery of Mendel s work 2. Chromosomal theory of inheritance 3. DNA as the genetic material

More information

Chapter 25: Population Genetics

Chapter 25: Population Genetics Chapter 25: Population Genetics Student Learning Objectives Upon completion of this chapter you should be able to: 1. Understand the concept of a population and polymorphism in populations. 2. Apply the

More information

3. comparison with proteins of known function

3. comparison with proteins of known function Lectures 26 and 27 recombinant DNA technology I. oal of genetics A. historically - easy to isolate total DNA - difficult to isolate individual gene B. recombinant DNA technology C. why get the gene? 1.

More information

Chapter 10 Manipulating Genes

Chapter 10 Manipulating Genes How DNA Molecules Are Analyzed Chapter 10 Manipulating Genes Until the development of recombinant DNA techniques, crucial clues for understanding how cell works remained lock in the genome. Important advances

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information

CHAPTER 8 RECOMBINANT DNA and GENETIC ENGINEERING

CHAPTER 8 RECOMBINANT DNA and GENETIC ENGINEERING CHAPTER 8 RECOMBINANT DNA and GENETIC ENGINEERING Questions to be addressed: How are recombinant DNA molecules generated in vitro? How is recombinant DNA amplified? What analytical techniques are used

More information

Chapter 20: Biotechnology: DNA Technology & Genomics

Chapter 20: Biotechnology: DNA Technology & Genomics Biotechnology Chapter 20: Biotechnology: DNA Technology & Genomics The BIG Questions How can we use our knowledge of DNA to: o Diagnose disease or defect? o Cure disease or defect? o Change/improve organisms?

More information

Mutations & DNA Technology Worksheet

Mutations & DNA Technology Worksheet Mutations & DNA Technology Worksheet Name Section A: Mutations Mutations are changes in DNA. Somatic mutations occur in non-reproductive cells and won't be passed onto offspring. Mutations that occur in

More information

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot Recombinant technology Gene analysis Sequencing PCR RNA Northern-blot RT PCR Protein Western-blot Sequencing Southern-blot in situ hybridization in situ hybridization Function analysis Histochemical analysis

More information

Name Class Date. KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. frameshift mutation

Name Class Date. KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. frameshift mutation Unit 7 Study Guide Section 8.7: Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. VOCABULARY mutation point mutation frameshift mutation mutagen MAIN IDEA: Some mutations

More information

PLNT2530 Unit 6e DNA Sequencing

PLNT2530 Unit 6e DNA Sequencing PLNT2530 Unit 6e DNA Sequencing Unless otherwise cited or referenced, all content of this presenataion is licensed under the Creative Commons License Attribution Share-Alike 2.5 Canada 1 High-throughput

More information

Lecture 38: DNA Fingerprinting

Lecture 38: DNA Fingerprinting Lecture 38: DNA Fingerprinting (DNA technology) The most awesome and powerful tool acquired by man since the splitting of atoms - The Time Magazine (USA) Conventional fingerprint of an individual comes

More information

NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document.

NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document. Chapter 8 Study Guide What is the study of genetics, and what topics does it focus on? What is a genome? NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document. Describe

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur

More information

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long

More information

Biotechnology and Recombinant DNA

Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Recombinant DNA procedures - an overview Biotechnology: The use of microorganisms, cells, or cell components to make a product. Foods, antibiotics, vitamins, enzymes Recombinant

More information

Nature of Genetic Material. Nature of Genetic Material

Nature of Genetic Material. Nature of Genetic Material Core Category Nature of Genetic Material Nature of Genetic Material Core Concepts in Genetics (in bold)/example Learning Objectives How is DNA organized? Describe the types of DNA regions that do not encode

More information

Genetics Faculty of Agriculture and Veterinary Medicine

Genetics Faculty of Agriculture and Veterinary Medicine Genetics 10201232 Faculty of Agriculture and Veterinary Medicine Instructor: Dr. Jihad Abdallah Topic 15:Recombinant DNA Technology 1 Recombinant DNA Technology Recombinant DNA Technology is the use of

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information

Recombinant DNA Technology

Recombinant DNA Technology PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology

More information

Recipient Cell. DNA Foreign DNA. Recombinant DNA

Recipient Cell. DNA Foreign DNA. Recombinant DNA Module 4B Biotechnology In this module, we will examine some of the techniques scientists have developed to study and manipulate the DNA of living organisms. Objective # 7 Explain what genetic recombination

More information

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold

More information

Today-applications: Medicine-better health Pharmaceutical-production of antibiotics Foods-wine, cheese, beer Agriculture-selective breeding

Today-applications: Medicine-better health Pharmaceutical-production of antibiotics Foods-wine, cheese, beer Agriculture-selective breeding I. Genetic Engineering modification of DNA of organisms to produce new genes with new characteristics -genes are small compared to chromosomes -need methods to get gene-sized pieces of DNA -direct manipulation

More information

Becker Muscular Dystrophy

Becker Muscular Dystrophy Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

TECH NOTE Characterization of CRISPR/Cas9 introduced Mutations using the Guide it Indel Identification Kit

TECH NOTE Characterization of CRISPR/Cas9 introduced Mutations using the Guide it Indel Identification Kit TECH NOTE Characterization of CRISPR/Cas9 introduced Mutations using the Guide it Indel Identification Kit Streamlined method for characterizing the variety of indels introduced by genome editing technologies:

More information

Primer walking: Custom primers designed to be complementary to the known sequence can be used to extend the DNA sequence iteratively from the distal

Primer walking: Custom primers designed to be complementary to the known sequence can be used to extend the DNA sequence iteratively from the distal Primer walking: Custom primers designed to be complementary to the known sequence can be used to extend the DNA sequence iteratively from the distal ends of known regions into unknown regions of the same

More information

Tools and Techniques. Chapter 10. Genetic Engineering. Restriction endonuclease. 1. Enzymes

Tools and Techniques. Chapter 10. Genetic Engineering. Restriction endonuclease. 1. Enzymes Chapter 10. Genetic Engineering Tools and Techniques 1. Enzymes 2. 3. Nucleic acid hybridization 4. Synthesizing DNA 5. Polymerase Chain Reaction 1 2 1. Enzymes Restriction endonuclease Ligase Reverse

More information

Innovations in Molecular Epidemiology

Innovations in Molecular Epidemiology Innovations in Molecular Epidemiology Molecular Epidemiology Measure current rates of active transmission Determine whether recurrent tuberculosis is attributable to exogenous reinfection Determine whether

More information

An Overview of DNA Sequencing

An Overview of DNA Sequencing An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure

More information

Department of Biology Sample

Department of Biology Sample Syllabus BIOTECHNOLOGY Spring 2013 Instructor: Atanu Duttaroy, Professor Tel: 202-806-5362 Email: aduttaroy@howard.edu Office: Room 336, Just Hall Teaching Assistant: Mr. Subhas Mukherjee Lecture: Room

More information

2 The Human Genome Project

2 The Human Genome Project 2 The Human Genome Project LAP CHEE TSUI STEVE W. SCHERER Toronto, Canada 1 Introduction 42 2 Chromosome Maps 42 2.1 Genetic Maps 43 2.2 Physical Maps 44 3 DNA Sequencing 45 3.1 cdna Sequencing 47 3.2

More information

A Primer of Genome Science THIRD

A Primer of Genome Science THIRD A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:

More information

Biotechnology Test Test

Biotechnology Test Test Log In Sign Up Biotechnology Test Test 15 Matching Questions Regenerate Test 1. Plasmid 2. PCR Process 3. humulin 4. pluripotent 5. polymerase chain reaction (PCR) a b Is much smaller than the human genome,

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period Chapter 20: Biotechnology The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Biotechnology and reporter genes Here, a lentivirus is used to carry foreign DNA into chickens. A reporter gene (GFP)indicates that foreign DNA has been successfully transferred. Recombinant DNA continued

More information

Assessment Schedule 2014 Biology: Demonstrate understanding of genetic variation and change (91157) Evidence Statement

Assessment Schedule 2014 Biology: Demonstrate understanding of genetic variation and change (91157) Evidence Statement NCEA Level 2 Biology (91157) 2014 page 1 of 5 Assessment Schedule 2014 Biology: Demonstrate understanding of genetic variation and change (91157) Evidence Statement NCEA Level 2 Biology (91157) 2014 page

More information

Data Analysis for Ion Torrent Sequencing

Data Analysis for Ion Torrent Sequencing IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium

More information

Inherited Metabolic Disorders. Biol 405 Molecular Medicine

Inherited Metabolic Disorders. Biol 405 Molecular Medicine Inherited Metabolic Disorders Biol 405 Molecular Medicine Inherited Metabolic Disorders Although originally related to defects in specific enzymes (e.g. phenylalanine hydroxylase) this category of genetic

More information

DNA Technology Mapping a plasmid digesting How do restriction enzymes work?

DNA Technology Mapping a plasmid digesting How do restriction enzymes work? DNA Technology Mapping a plasmid A first step in working with DNA is mapping the DNA molecule. One way to do this is to use restriction enzymes (restriction endonucleases) that are naturally found in bacteria

More information

RESTRICTION DIGESTS Based on a handout originally available at

RESTRICTION DIGESTS Based on a handout originally available at RESTRICTION DIGESTS Based on a handout originally available at http://genome.wustl.edu/overview/rst_digest_handout_20050127/restrictiondigest_jan2005.html What is a restriction digests? Cloned DNA is cut

More information

Introduction to Medical Genetics. 1. Introduction to Medical Genetics

Introduction to Medical Genetics. 1. Introduction to Medical Genetics Introduction to Medical Genetics 1 2 1: Introduction 2: Chromosomes and chromosome abnormalities 3: Single gene disorders 4: Polygenic Disorders 5: Mutation and human disease 6: Genes in Populations 7:

More information

MOLECULAR GENETICS GENETIC ENGINEERING RECOMBINANT DNA. Molecular Genetics Activity #6 page 1

MOLECULAR GENETICS GENETIC ENGINEERING RECOMBINANT DNA. Molecular Genetics Activity #6 page 1 AP BIOLOGY MOLECULAR GENETICS ACTIVITY #6 NAME DATE HOUR RECOMBINANT DNA GENETIC ENGINEERING Molecular Genetics Activity #6 page 1 GENETIC ENGINEERING Molecular Genetics Activity #6 page 2 PART I: PRODUCING

More information

Single Nucleotide Polymorphisms (SNPs)

Single Nucleotide Polymorphisms (SNPs) Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded

More information

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites.

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites. 1. A recombinant DNA molecules is one that is a. produced through the process of crossing over that occurs in meiosis b. constructed from DNA from different sources c. constructed from novel combinations

More information

Genetics Module B, Anchor 3

Genetics Module B, Anchor 3 Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for

More information

Chapter 21 Active Reading Guide The Evolution of Populations

Chapter 21 Active Reading Guide The Evolution of Populations Name: Roksana Korbi AP Biology Chapter 21 Active Reading Guide The Evolution of Populations This chapter begins with the idea that we focused on as we closed Chapter 19: Individuals do not evolve! Populations

More information

Plasmid Isolation. Prepared by Latifa Aljebali Office: Building 5, 3 rd floor, 5T250

Plasmid Isolation. Prepared by Latifa Aljebali Office: Building 5, 3 rd floor, 5T250 Plasmid Isolation Prepared by Latifa Aljebali Office: Building 5, 3 rd floor, 5T250 Plasmid Plasmids are small, double strand, closed circular DNA molecules. Isolated from bacterial cells. Replicate independently

More information

Biotechnology. Selective breeding Use of microbes (bacteria & yeast)

Biotechnology. Selective breeding Use of microbes (bacteria & yeast) Biotechnology bio and technology The use of living organisms to solve problems or make useful products. Biotechnology has been practiced for the last 10,000 years. Selective breeding Use of microbes (bacteria

More information

Recombinant DNA Unit Exam

Recombinant DNA Unit Exam Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the

More information

Creation of a Bacterial Cell Controlled by a Chemically Synthesized Genome Gibson et al. (2010)

Creation of a Bacterial Cell Controlled by a Chemically Synthesized Genome Gibson et al. (2010) Creation of a Bacterial Cell Controlled by a Chemically Synthesized Genome Gibson et al. (2010) In 1977 Sanger and his colleagues were the first who sequenced the complete DNA genome of a phage. From 1977

More information

Gene Isolation and Manipulation

Gene Isolation and Manipulation 10 Gene Isolation and Manipulation WORKING WITH THE FIGURES 1. Figure 10-1 shows that specific DNA fragments can be synthesized in vitro prior to cloning. What are two ways to synthesize DNA inserts for

More information

3/31 Using DNA to Track Your Ancestors

3/31 Using DNA to Track Your Ancestors 1/9/16 11:49 AM 3/31 Using DNA to Track Your Ancestors DNA analysis: General Procedure (slide 1) Amplify sections of the DNA Separate DNA fragments by length and visualize Compare the DNA pattern between

More information

Basic Premises of Population Genetics

Basic Premises of Population Genetics Population genetics is concerned with the origin, amount and distribution of genetic variation present in populations of organisms, and the fate of this variation through space and time. The fate of genetic

More information

Biological Sciences Initiative. Human Genome

Biological Sciences Initiative. Human Genome Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.

More information

Description: Molecular Biology Services and DNA Sequencing

Description: Molecular Biology Services and DNA Sequencing Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:

More information

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS

More information

Lecture 2. A B C D histidine Protein

Lecture 2. A B C D histidine Protein Lecture 2 In this lecture we are going to consider experiments on yeast, a very useful organism for genetic study. Yeast is more properly known as Saccharomyces cerevisiae, which is the single-celled microbe

More information

HC70A & SAS70A Winter 2016 Genetic Engineering in Medicine, Agriculture, and Law Professors Bob Goldberg, & John Harada

HC70A & SAS70A Winter 2016 Genetic Engineering in Medicine, Agriculture, and Law Professors Bob Goldberg, & John Harada HC70A & SAS70A Winter 2016 Genetic Engineering in Medicine, Agriculture, and Law Professors Bob Goldberg, & John Harada Lecture 4 What Are Genes & How Do They Work: Part Two Course Administratorp Last

More information

Human Genome and Human Genome Project. Louxin Zhang

Human Genome and Human Genome Project. Louxin Zhang Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

PAPER RFLP TEACHER GUIDE

PAPER RFLP TEACHER GUIDE PAPER RFLP TEACHER GUIDE Paper = DNA Scissors = Restriction Enzyme Desktop = Electrophoresis NOTE: There are TWO versions of this activity one where the students write their own sentences (to represent

More information

CTY Genetics Syllabus

CTY Genetics Syllabus CTY Genetics Syllabus Week 1: Review and Mendelian Genetics What (DUE DATE) 1 Introduction and Review Morning Classroom Policies/ Ice Breaker Game/Introductions Syllabus Distribute Syllabus, Discuss Course

More information

NB: All the figures are modifiable and can be provided as a PPT file, so do not hesitate to contact Maggy Fostier to get the files.

NB: All the figures are modifiable and can be provided as a PPT file, so do not hesitate to contact Maggy Fostier to get the files. Title Workshop on genetic disease and gene therapy Authors Danielle Higham (BSc Genetics), Dr. Maggy Fostier Contact Maggy.fostier@manchester.ac.uk Target level KS4 science, GCSE (or A-level) Publication

More information

PCR Polymerase Chain Reaction

PCR Polymerase Chain Reaction Biological Sciences Initiative HHMI PCR Polymerase Chain Reaction PCR is an extremely powerful technique used to amplify any specific piece of DNA of interest. The DNA of interest is selectively amplified

More information

14.3 Studying the Human Genome

14.3 Studying the Human Genome 14.3 Studying the Human Genome Lesson Objectives Summarize the methods of DNA analysis. State the goals of the Human Genome Project and explain what we have learned so far. Lesson Summary Manipulating

More information

29 YEARS ON, A NOBEL PRIZE, AND A DIAGNOSTIC DREAM: THE USES OF THE POLYMERASE CHAIN REACTION IN MODERN BIOLOGY

29 YEARS ON, A NOBEL PRIZE, AND A DIAGNOSTIC DREAM: THE USES OF THE POLYMERASE CHAIN REACTION IN MODERN BIOLOGY The West London Medical Journal 2012 Vol 4 No 1 pp 7-11 29 YEARS ON, A NOBEL PRIZE, AND A DIAGNOSTIC DREAM: THE USES OF THE POLYMERASE CHAIN REACTION IN MODERN BIOLOGY Jason Seewoodhary Specialist Registrar

More information

Design of conditional gene targeting vectors - a recombineering approach

Design of conditional gene targeting vectors - a recombineering approach Recombineering protocol #4 Design of conditional gene targeting vectors - a recombineering approach Søren Warming, Ph.D. The purpose of this protocol is to help you in the gene targeting vector design

More information

Basic Principles of Forensic Molecular Biology and Genetics. Population Genetics

Basic Principles of Forensic Molecular Biology and Genetics. Population Genetics Basic Principles of Forensic Molecular Biology and Genetics Population Genetics Significance of a Match What is the significance of: a fiber match? a hair match? a glass match? a DNA match? Meaning of

More information

Population Genetics (Outline)

Population Genetics (Outline) Population Genetics (Outline) Definition of terms of population genetics: population, species, gene, pool, gene flow Calculation of genotypic of homozygous dominant, recessive, or heterozygous individuals,

More information

Molecular typing of VTEC: from PFGE to NGS-based phylogeny

Molecular typing of VTEC: from PFGE to NGS-based phylogeny Molecular typing of VTEC: from PFGE to NGS-based phylogeny Valeria Michelacci 10th Annual Workshop of the National Reference Laboratories for E. coli in the EU Rome, November 5 th 2015 Molecular typing

More information

Using Molecular Markers in Plant Genetics Research Unlocking genetic potential for increased productivity

Using Molecular Markers in Plant Genetics Research Unlocking genetic potential for increased productivity Using Molecular Markers in Plant enetics Research Unlocking genetic potential for increased productivity Molecular Markers Researchers at Pioneer blaze a new genetic trail. Identifying molecular markers

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Molecular Methods Sylvain Forêt March 2010 http://dayhoff.anu.edu.au/~sf/next_gen_seq 1 Introduction 2 Sanger 3 Illumina 4 454 5 SOLiD 6 Summary The Genomic Age Recent landmarks

More information

History of DNA Sequencing & Current Applications

History of DNA Sequencing & Current Applications History of DNA Sequencing & Current Applications Christopher McLeod President & CEO, 454 Life Sciences, A Roche Company IMPORTANT NOTICE Intended Use Unless explicitly stated otherwise, all Roche Applied

More information

Assessment Schedule 2013 Biology: Demonstrate understanding of genetic variation and change (91157)

Assessment Schedule 2013 Biology: Demonstrate understanding of genetic variation and change (91157) NCEA Level 2 Biology (91157) 2013 page 1 of 5 Assessment Schedule 2013 Biology: Demonstrate understanding of genetic variation and change (91157) Assessment Criteria with with Excellence Demonstrate understanding

More information

MOLECULAR MARKERS AND THEIR APPLICATIONS IN CEREALS BREEDING

MOLECULAR MARKERS AND THEIR APPLICATIONS IN CEREALS BREEDING MOLECULAR MARKERS AND THEIR APPLICATIONS IN CEREALS BREEDING Viktor Korzun Lochow-Petkus GmbH, Grimsehlstr.24, 37574 Einbeck, Germany korzun@lochow-petkus.de Summary The development of molecular techniques

More information

Chapter 2. Scientific basis

Chapter 2. Scientific basis 7 Chapter 2 Scientific basis What genes are 2.1 The inheritance of all our characteristics, including susceptibility to genetic diseases, is dependent on genes and chromosomes. Genes are large molecules

More information

Answer Key Problem Set 5

Answer Key Problem Set 5 7.03 Fall 2003 1 of 6 1. a) Genetic properties of gln2- and gln 3-: Answer Key Problem Set 5 Both are uninducible, as they give decreased glutamine synthetase (GS) activity. Both are recessive, as mating

More information

Example report 1: Diagnostic test for female with normal results. The Laboratory Laboratory Avenue. City, State (555)

Example report 1: Diagnostic test for female with normal results. The Laboratory Laboratory Avenue. City, State (555) FX 8. Appendix Example report 1: Diagnostic test for female with normal results The Laboratory 1111 Laboratory Avenue City, State 00839 (555) 920-3333 www.laboratory.com Patient Name: Jane D. ID number:

More information

Basic Concepts Recombinant DNA Use with Chapter 13, Section 13.2

Basic Concepts Recombinant DNA Use with Chapter 13, Section 13.2 Name Date lass Master 19 Basic oncepts Recombinant DN Use with hapter, Section.2 Formation of Recombinant DN ut leavage Splicing opyright lencoe/mcraw-hill, a division of he Mcraw-Hill ompanies, Inc. Bacterial

More information

How is genome sequencing done?

How is genome sequencing done? How is genome sequencing done? Using 454 Sequencing on the Genome Sequencer FLX System, DNA from a genome is converted into sequence data through four primary steps: Step One DNA sample preparation; Step

More information

Chapter 15 Lecture Notes: Applications of Recombinant DNA Technology

Chapter 15 Lecture Notes: Applications of Recombinant DNA Technology Chapter 15 Lecture Notes: Applications of Recombinant DNA Technology I. In Vitro Mutagenesis: It is possible (and relatively easy) to make specific mutations in a gene using a variety of methods which

More information