DNA Sequence Analysis

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "DNA Sequence Analysis"

Transcription

1 DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide probe. Species-specific PCR primers. Fluorescent probes for real-time PCR. Fixed probes for binding PCR product to a membrane (e.g. a dot blot system) or a microarray chip. 1

2 Medical scientist now routinely use this sort of approach to screen for known genotypes (e.g., an allele associated with a disease). The more high-tech methods they have developed are starting to diffuse into forensic science Microarrays Silicon microchips can be constructed with a huge array (thousands) of attached probes. Hybridization can be enhanced (template molecules clamped on or kicked off) electronically. Detection is usually optical, e.g., fluorescentlylabeled PCR product. 2

3 The microarray has become a standard tool of medical and other biological research. A common use is to study gene expression using reverse transcriptase PCR product. Another screening approach: link to real-time measurement of PCR amplification. [Recall DNA extract quantitation by real time PCR. Also note potential confusion with acronym RT- PCR.] 3

4 These are methods for detecting a polymorphism within an amplicon. The signal that hybridization has occurred is a function of the amount of PCR product that has been produced. This is measured while the reaction cycles are taking place (real time) or when the program is complete. An exonuclease probe relies on the 5 nuclease activity of Taq. The signal of the attached fluorophore cannot be detected in close proximity to the quencher. They are separated when Taq chews up the probe. EXAMPLE: Various TaqMan products sold by Applied Biosystems A molecular beacon acts in a similar manner, however the probe is not destroyed 4

5 The oligonucleotide probe is designed to have a higher annealing temperature than the primers. Experimental conditions are such that the probe binds only if it is a perfect match. The amount of fluorescence is a function of the amount of PCR product that has been produced. The fluorescent agent can be one of the probe types just described. This makes it possible to do a multiplex reaction. A simpler alternative is to use a specific primer assay, i.e. the primer annealing site covers the polymorphic base position, and the primer will only bind if the allele of interest is present. For this one could use a general purpose dye such as SYBR green that only fluoresces when bound to dsdna. 5

6 The amount of product reaches the same plateau for a range of initial DNA copy numbers. Applied Biosystems Quantifiler kit. R n = normalized reporter signal Determination of a potentially novel allele sequence There are a variety of methods that involve information about the final nucleotide on each of a series of fragments separated according to length. 6

7 Cycle sequencing A process that resembles PCR (a primer, repeated temperature cycles, thermostable polymerase, etc.). One big difference is that only one primer is used therefore only one strand is copied. This produces an arithmetic rather than an exponential increase in product. Therefore PCR product is used as the template. If only a (secret) fraction of nucleotides are ddntps labeled with a dye, then all possible lengths of DNA copies will be made. Processed and electrophoresed molecules, with 3 nucleotide color-coded Template (actually the complement strand) Primer + AGTTTTGGCTCGAACACGTCACAGCCTTTAA AGTTTTGGCTCGAACACGTCACAGCCTTTAA AGTTTTGGCTCGAACACGTCACAGCCTTTA AGTTTTGGCTCGAACACGTCACAGCCTTT AGTTTTGGCTCGAACACGTCACAGCCTT AGTTTTGGCTCGAACACGTCACAGCCT AGTTTTGGCTCGAACACGTCACAGCC AGTTTTGGCTCGAACACGTCACAGC AGTTTTGGCTCGAACACGTCACAG AGTTTTGGCTCGAACACGTCACA AGTTTTGGCTCGAACACGTCAC AGTTTTGGCTCGAACACGTCA AGTTTTGGCTCGAACACGTC AGTTTTGGCTCGAACACGT etc. electropherogram-> 7

8 This can be done separately for each strand of the PCR product, e.g. forward and reverse. 377 sequencing gel image The standard cycle-sequencing reagent kit is one of the BigDye series sold by Applied Biosystems. 8

9 Applied Biosystems 310 instrument raw signal, before applying the dye matrix. same 310 signal following matrix analysis From commercial literature (Applied Biosystems pdf) selling an improved sequencing chemistry kit. Short repeats make for a difficult template. 9

10 In the old days, before fancy colors, the only way to do this was with four separate sequencing reactions, each with only one kind of ddntp. Technical aspects of the cyclesequencing electropherogram. The analysis software (usually): -applies a spectral calibration -determines approximate peak spacing -calls the color (=base) according to spacing expectation -returns an N if too little signal or conflicting signal 10

11 Sequencing requires no size standard. One simply notes the relative position of the peaks. The mobility files are software calibration settings that account for the fact that eletrophoretic mobility is a function of DNA fragment length, instrument parameters (e.g. polymer type) and the type of dye. Even a clean sequence data file will start with a few bases that are poorly resolved (peaks shifted and too broad). This is actually a mobility calibration problem. Do not expect to infer the sequence immediately adjacent to your sequencing primer. 11

12 Part of the initial mess can be signal from unincorporated ddntps (from This probably resulted from poor cleaning of the CS product (a process to remove small molecules). The underlying peaks might be manually called. Peaks in the middle should be sharp, not much different in height, evenly spaced with little overlap, and have little underlying noise (signal from colors other than the major peak). 12

13 Toward the downstream end, peaks will become broad and irregular in shape. In part this is simply a statistical phenomenon. Longer electrophoresis time means that random differences accumulate. However this doesn t explain everything, and this pattern is not completely understood. If the PCR product was short, this may affect only a few bases. Other potential problems. Underlying (minor) peaks. -if out of phase with the major peaks, it could be a variety of problems. -If in phase with the major peaks, it could be a poor spectral calibration, or reflect a mixture a sequences in your PCR product. 13

14 A homomeric stretch will cause strand slippage (during PCR, CS, or cell replication). Downstream of the position where 2 or more sequences are out of phase the electropherogram rapidly decays. Sequence toward the stretch from both directions. It may be that the homomeric stretch produced this replication error in the cell. (A) 16189T Good quality sequence (B) Poor quality sequence (two length variants out of phase) HV1 C-stretch (C) Primer strategies typically used with C-stretch containing samples C-stretch C-stretch Use of internal primers Double reactions from the same strand Figure 10.7, J.M. Butler (2005) Forensic DNA Typing, 2 nd Edition 2005 Elsevier Academic Press A so-called strong stop, in which peak height is suddenly reduced, is thought to result from template secondary structure inhibiting the polymerase. Sequence from both directions. 14

15 Too much sequencing product, sometimes a result of adding too much PCR product to the reaction, can lead to off-scale peaks. This can make it difficult to distinguish adjacent peaks of the same color. This problem may be unavoidable when sequencing a short amplicon, such as may be necessary for a degraded sample. Initially blobs of signal from unincorporated ddntps. Downstream just low level noise. The CS reaction was a failure. Do over. Sequence electropherogram software often includes a peak quality score generated by the program Phred* Probability that the Phred quality score base is called wrong 10 1 in 10 Common threshold for 20 1 in 100 accepting a base call 30 1 in 1, in 10, in 100,000 *Ewing et al Genome Res. 8:

16 en.wikipedia.org/wiki/file:phred_figure_1.jpg 16

17 Common cycle-sequence product electrophoresis technology is limited to a maximum read of about 1000 bp. This requires a longer capillary or acrylamide gel than is needed for STR analysis, and the electrophoresis time is longer as well. For example, with the 3100 line of Applied Biosystems genetic Analyzers, STR analysis works best* with a 36 cm capillary (~40 min), and sequencing with a 50 cm capillary (~2 hr). *There is some flexibility, i.e. one can get roughly 400 bases of sequence using a 36 cm capillary. Large scale sequencing: Genome projects. The availability of published whole genomes allows one, including forensic biologists, to search with a computer for new loci. 17

18 TO REPEAT... Common cycle-sequence product electrophoresis technology is limited to a maximum read of about 1000 bp. Genomes are huge, therefore a project to determine the entire sequence must somehow be obtained in short segments. The individual, overlapping, sequences are then assembled into the final contiguous sequence using a lot of computer power. This is done several ways. The first widespread method was Shotgun sequencing The DNA is fragmented with restriction enzymes. Fragments up to 150KB are then cloned. 18

19 Cloning a segment of DNA in a bacterial cell is relatively easy because a circular plasmid will be replicated by the cell. From NCBI web site. The fragments are ligated to a cloning vector DNA fragment, inserted in a bacterial cell for amplification (by cell division), then sequenced from the ends of the vector. Only ~1000 bp obtained in each direction. dimer.tamu.edu/young/genomics/images/index/image013.jpg Contig is the jargon term for the assembled sequence. 19

20 There are ambiguities in the data, because of both sequencing and assembly errors. The quality of a genome data set is indicated by the number of independent times each bases call has been replicated, i.e. 8X. The technology has advanced quickly. Speed is up and cost is down. The first draft of the human genome (2001) cost $300M, $3B for the current draft. Jan 2006, report of rhesus monkey genome for $22M. Right now we seem to be at ~$15K for a human-size genome. The Holy Grail is the $1000 genome. A couple of new technologies for massive sequencing have burst on the scene. One is based on pyrosequencing, and is sold by the 454 Life Sciences company. 20

21 Figures from454 web site. Each ssdna fragment with adaptor/primer site, is individually attached to a bead. The bead is isolated in a drop of oil floating in a aqueous solution. Each drop contains the reagents for PCR, so the result is a huge number of independent emulsion PCR (empcr) reactions in the same tube. The resulting PCR product sticks to the same bead. The DNA enriched beads are centrifuged into individual wells on a plate, and covered with smaller beads carrying the enzymes needed for pyrosequencing. 200,000 pyrosequencing reactions are detected at the same time. Supposedly millions of bases of sequencing data can be generated per hour, and one person could do a complete bacterial genome in a few days. 21

22 So what is pyrosequencing? PCR product is used as template for a sequencing reaction that requires only ~10 minutes (for short sequences) once the instrument is loaded. One primer is biotinylated for separation of one stand for the next step. The addition of each nucleotide during extension involves the release of a pyrophosphate. This is turn triggers a cascade of reactions that include a fluorescent step. The four different nucleotides are injected and then flushed from the reaction chamber in sequence. A pyrogram. Although reads of >70 bp are reported, until recently data quality often seemed to drop after about 20 bp. 22

23 Pyrosequencing is great for large genotype screening projects, but it s less attractive if a long read is needed. Also, this technique does not handle mixtures well. 23

Essentials of Real Time PCR. About Sequence Detection Chemistries

Essentials of Real Time PCR. About Sequence Detection Chemistries Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

Real-Time PCR Vs. Traditional PCR

Real-Time PCR Vs. Traditional PCR Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives

More information

Single Nucleotide Polymorphisms (SNPs)

Single Nucleotide Polymorphisms (SNPs) Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded

More information

Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne

Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne Sanger Sequencing and Quality Assurance Zbigniew Rudzki Department of Pathology University of Melbourne Sanger DNA sequencing The era of DNA sequencing essentially started with the publication of the enzymatic

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR Roche Applied Science Technical Note No. LC 18/2004 Purpose of this Note Assay Formats for Use in Real-Time PCR The LightCycler Instrument uses several detection channels to monitor the amplification of

More information

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites.

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites. 1. A recombinant DNA molecules is one that is a. produced through the process of crossing over that occurs in meiosis b. constructed from DNA from different sources c. constructed from novel combinations

More information

A Brief Guide to Interpreting the DNA Sequencing Electropherogram Version 3.0

A Brief Guide to Interpreting the DNA Sequencing Electropherogram Version 3.0 A Brief Guide to Interpreting the DNA Sequencing Electropherogram Version 3.0 Plant-Microbe Genomics Facility The Ohio State University 484 W.12 th Ave., Columbus, OH 43210 Ph: 614/247-6204 FAX: 614/247-8696

More information

Lecture 37: Polymerase Chain Reaction

Lecture 37: Polymerase Chain Reaction Lecture 37: Polymerase Chain Reaction We have already studied basics of DNA/RNA structure and recombinant DNA technology in previous classes. Polymerase Chain Reaction (PCR) is another revolutionary method

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Biotechnology and reporter genes Here, a lentivirus is used to carry foreign DNA into chickens. A reporter gene (GFP)indicates that foreign DNA has been successfully transferred. Recombinant DNA continued

More information

Scientific Working Group on DNA Analysis Methods. Validation Guidelines for DNA Analysis Methods. Table of Contents

Scientific Working Group on DNA Analysis Methods. Validation Guidelines for DNA Analysis Methods. Table of Contents Scientific Working Group on DNA Analysis Methods Validation Guidelines for DNA Analysis Methods Table of Contents Introduction.2 1. Definitions. 2 2. General Considerations 3 3. Developmental Validation..5

More information

Troubleshooting Sequencing Data

Troubleshooting Sequencing Data Troubleshooting Sequencing Data Troubleshooting Sequencing Data No recognizable sequence (see page 7-10) Insufficient Quantitate the DNA. Increase the amount of DNA in the sequencing reactions. See page

More information

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

Genetics Faculty of Agriculture and Veterinary Medicine

Genetics Faculty of Agriculture and Veterinary Medicine Genetics 10201232 Faculty of Agriculture and Veterinary Medicine Instructor: Dr. Jihad Abdallah Topic 15:Recombinant DNA Technology 1 Recombinant DNA Technology Recombinant DNA Technology is the use of

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Molecular Methods Sylvain Forêt March 2010 http://dayhoff.anu.edu.au/~sf/next_gen_seq 1 Introduction 2 Sanger 3 Illumina 4 454 5 SOLiD 6 Summary The Genomic Age Recent landmarks

More information

Chapter 20: Biotechnology: DNA Technology & Genomics

Chapter 20: Biotechnology: DNA Technology & Genomics Biotechnology Chapter 20: Biotechnology: DNA Technology & Genomics The BIG Questions How can we use our knowledge of DNA to: o Diagnose disease or defect? o Cure disease or defect? o Change/improve organisms?

More information

CHAPTER 14 LECTURE NOTES: RECOMBINANT DNA TECHNOLOGY

CHAPTER 14 LECTURE NOTES: RECOMBINANT DNA TECHNOLOGY CHAPTER 14 LECTURE NOTES: RECOMBINANT DNA TECHNOLOGY I. General Info A. Landmarks in modern genetics 1. Rediscovery of Mendel s work 2. Chromosomal theory of inheritance 3. DNA as the genetic material

More information

DNA Detection. Chapter 13

DNA Detection. Chapter 13 DNA Detection Chapter 13 Detecting DNA molecules Once you have your DNA separated by size Now you need to be able to visualize the DNA on the gel somehow Original techniques: Radioactive label, silver

More information

DNA Sequencing Setup and Troubleshooting

DNA Sequencing Setup and Troubleshooting DNA Sequencing Setup and Troubleshooting Lara Cullen, PhD Scientific Applications Specialist Australia and New Zealand Reviewing Sequencing Data Review the Electropherogram Review the Raw Data (Signal

More information

PCR Polymerase Chain Reaction

PCR Polymerase Chain Reaction Biological Sciences Initiative HHMI PCR Polymerase Chain Reaction PCR is an extremely powerful technique used to amplify any specific piece of DNA of interest. The DNA of interest is selectively amplified

More information

Co Extra (GM and non GM supply chains: Their CO EXistence and TRAceability) Outcomes of Co Extra

Co Extra (GM and non GM supply chains: Their CO EXistence and TRAceability) Outcomes of Co Extra GM and non GM supply chains: Their CO EXistence and TRAceability Outcomes of Co Extra Comparison of different real time PCR chemistries and their suitability for detection and quantification of genetically

More information

Sanger Sequencing. Troubleshooting Guide. Failed sequence

Sanger Sequencing. Troubleshooting Guide. Failed sequence Sanger Sequencing Troubleshooting Guide Below are examples of the main problems experienced in ABI Sanger sequencing. Possible causes for failure and their solutions are listed below each example. The

More information

Chapter 10 Manipulating Genes

Chapter 10 Manipulating Genes How DNA Molecules Are Analyzed Chapter 10 Manipulating Genes Until the development of recombinant DNA techniques, crucial clues for understanding how cell works remained lock in the genome. Important advances

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

Introduction. Preparation of Template DNA

Introduction. Preparation of Template DNA Procedures and Recommendations for DNA Sequencing at the Plant-Microbe Genomics Facility Ohio State University Biological Sciences Building Room 420, 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204;

More information

Dye-Blob message: Example: Generally, this is due to incomplete excess dye removal of the cycle sequence reaction.

Dye-Blob message: Example: Generally, this is due to incomplete excess dye removal of the cycle sequence reaction. When sequence data is uploaded to ilab, an email is sent notifying the user that data is ready. The staff of the DNA facility has the ability to edit this message to include specific remarks about how

More information

QPCR Applications using Stratagene s Mx Real-Time PCR Platform

QPCR Applications using Stratagene s Mx Real-Time PCR Platform QPCR Applications using Stratagene s Mx Real-Time PCR Platform Dan Schoeffner, Ph.D Field Applications Scientist Dan.Schoeffner@Stratagene.com Tech. Services 800-894-1304 Polymerase Chain Reaction Melt

More information

An Overview of DNA Sequencing

An Overview of DNA Sequencing An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure

More information

DNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE

DNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE DNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE We recommend for the sequence visualization the use of software that allows the examination of raw data in order to determine quantitatively how good has

More information

Mitochondrial DNA Analysis

Mitochondrial DNA Analysis Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)

More information

Quantitative Real Time PCR Protocol. Stack Lab

Quantitative Real Time PCR Protocol. Stack Lab Quantitative Real Time PCR Protocol Stack Lab Overview Real-time quantitative polymerase chain reaction (qpcr) differs from regular PCR by including in the reaction fluorescent reporter molecules that

More information

Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website

Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website Biomolecular Core Facility AI Dupont Hospital for Children, Rockland Center One, Room 214 Core: (302) 651-6712, Office: (302) 651-6707, mbcore@nemours.org Katia Sol-Church, Ph.D., Director Jennifer Frenck

More information

VLLM0421c Medical Microbiology I, practical sessions. Protocol to topic J10

VLLM0421c Medical Microbiology I, practical sessions. Protocol to topic J10 Topic J10+11: Molecular-biological methods + Clinical virology I (hepatitis A, B & C, HIV) To study: PCR, ELISA, your own notes from serology reactions Task J10/1: DNA isolation of the etiological agent

More information

July 7th 2009 DNA sequencing

July 7th 2009 DNA sequencing July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer

More information

Procedures For DNA Sequencing

Procedures For DNA Sequencing Procedures For DNA Sequencing Plant-Microbe Genomics Facility (PMGF) Ohio State University 420 Biological Sciences Building 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204 FAX: 614/292-6337

More information

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1 CAP 5510-8 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Genomic Mapping & Mapping Databases High resolution, genome-wide maps of DNA markers. Integrated maps, genome catalogs and comprehensive

More information

Sequencing a Genome: Inside the Washington University Genome Sequencing Center. Activity Supplement Paper PCR (DNA Amplification)

Sequencing a Genome: Inside the Washington University Genome Sequencing Center. Activity Supplement Paper PCR (DNA Amplification) Sequencing a Genome: Inside the Washington University Genome Sequencing Center Activity Supplement (DNA Amplification) Project Outline The multimedia project Sequencing a Genome: Inside the Washington

More information

Protocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR

Protocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR Protocol Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR Copyright 2008, 2010 Applied Biosystems. All rights reserved. Ambion and Applied Biosystems products are for Research Use Only.

More information

DNA Sequencing Dr. Serageldeen A. A. Sultan

DNA Sequencing Dr. Serageldeen A. A. Sultan DNA Sequencing Dr. Serageldeen A. A. Sultan PhD in Molecular virology Yamaguchi University, Japan (2010) Lecturer of virology Dept. of Microbiology SVU, Qena, Egypt seaas@lycos.com What is DNA sequencing?

More information

Artifacts in Genotyping STRs

Artifacts in Genotyping STRs Biology of STRs Artifacts in Genotyping STRs A number of artifacts are possible: Stuttering Non-template additions Microvariants Three peaks Allele dropouts Mutations All interfere with reading a DNA profile

More information

Application Guide... 2

Application Guide... 2 Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied

More information

Biotechnology Test Test

Biotechnology Test Test Log In Sign Up Biotechnology Test Test 15 Matching Questions Regenerate Test 1. Plasmid 2. PCR Process 3. humulin 4. pluripotent 5. polymerase chain reaction (PCR) a b Is much smaller than the human genome,

More information

Optimizing Real Time PCR: A Focused Approach for Exceptional Real-Time qpcr Results

Optimizing Real Time PCR: A Focused Approach for Exceptional Real-Time qpcr Results Optimizing Real Time PCR: A Focused Approach for Exceptional Real-Time qpcr Results Michael Wakem M.Sc Bio-Rad Laboratories Canada Ltd (800) 268-0213 Ext 3360 michael_wakem@bio-rad.com Overview Fundamentals

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

Methods and Application Guide. Introduction to Quantitative PCR

Methods and Application Guide. Introduction to Quantitative PCR Methods and Application Guide Introduction to Quantitative PCR Introduction to Quantitative PCR Methods and Application Guide Stratagene USA and Canada Order: 800-424-5444 x3 Technical Services: 800-894-1304

More information

DNA Sequencing Troubleshooting Guide.

DNA Sequencing Troubleshooting Guide. DNA Sequencing Troubleshooting Guide. There are a number of factors that can lead to less than perfect DNA sequencing results. In this guide, we explain some of the common problems encountered, and outline

More information

Introduction to Quantitative PCR

Introduction to Quantitative PCR Introduction to Quantitative PCR Methods and Applications Guide Introduction to Quantitative PCR Methods and Applications Guide IN 70200 D US and Canada Orders: 800-227-9770 x3 Technical Service: 800-227-9770

More information

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) Polymerase Chain Reaction (PCR) Paul C Winter, Belfast City Hospital, Belfast, UK The polymerase chain reaction is a technique that allows DNA molecules of interest (usually gene sequences) to be copied

More information

Introduction to next-generation sequencing data

Introduction to next-generation sequencing data Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS

More information

PCR: Polymerase Chain Reaction

PCR: Polymerase Chain Reaction PCR: Polymerase Chain Reaction Basics & Miniaturization Shared Nobel Prize - Chemistry 1993 for his invention of the polymerase chain reaction (PCR) method Outline What is PCR? DNA Background PCR Real

More information

Universidade Estadual de Maringá

Universidade Estadual de Maringá Universidade Estadual de Maringá Disciplina: Biologia Molecular Sequenciamento de ácidos nucléicos Profa. Dra. Maria Aparecida Fernandez Maxan e Gilbert - quebra química Berg, Gilbert and Sanger dideoxinucleotideos

More information

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) 05 PCR primer design 05.01 Design criteria PCR: an overview (from 02.01) PCR fidelity and optimization Primer design alessandro bogliolo isti information science and technology institute 1/20 Polymerase

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

Validating Microarray Data Using RT 2 Real-Time PCR Products

Validating Microarray Data Using RT 2 Real-Time PCR Products Validating Microarray Data Using RT 2 Real-Time PCR Products Introduction: Real-time PCR monitors the amount of amplicon as the reaction occurs. Usually, the amount of product is directly related to the

More information

Artisan Scientific is You~ Source for: Quality New and Certified-Used/Pre:-awned ECJuiflment

Artisan Scientific is You~ Source for: Quality New and Certified-Used/Pre:-awned ECJuiflment Looking for more information? Visit us on the web at http://www.artisan-scientific.com for more information: Price Quotations Drivers Technical Specifications. Manuals and Documentation Artisan Scientific

More information

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 BioScience quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 This method describes a Real-time semi-quantitative TaqMan PCR procedure for the determination of

More information

Welcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation.

Welcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation. Introduction to SMRTbell Template Preparation 100 338 500 01 1. SMRTbell Template Preparation 1.1 Introduction to SMRTbell Template Preparation Welcome to Pacific Biosciences' Introduction to SMRTbell

More information

Recombinant DNA Technology

Recombinant DNA Technology PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977

More information

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES SERVICES CATALOGUE WITH SUBMISSION GUIDELINES 3921 Montgomery Road Cincinnati, Ohio 45212 513-841-2428 www.agctsequencing.com CONTENTS Welcome Dye Terminator Sequencing DNA Sequencing Services - Full Service

More information

Name Class Date. KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. frameshift mutation

Name Class Date. KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. frameshift mutation Unit 7 Study Guide Section 8.7: Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. VOCABULARY mutation point mutation frameshift mutation mutagen MAIN IDEA: Some mutations

More information

Tools and Techniques. Chapter 10. Genetic Engineering. Restriction endonuclease. 1. Enzymes

Tools and Techniques. Chapter 10. Genetic Engineering. Restriction endonuclease. 1. Enzymes Chapter 10. Genetic Engineering Tools and Techniques 1. Enzymes 2. 3. Nucleic acid hybridization 4. Synthesizing DNA 5. Polymerase Chain Reaction 1 2 1. Enzymes Restriction endonuclease Ligase Reverse

More information

Chapter 12 - DNA Technology

Chapter 12 - DNA Technology Bio 100 DNA Technology 1 Chapter 12 - DNA Technology Among bacteria, there are 3 mechanisms for transferring genes from one cell to another cell: transformation, transduction, and conjugation 1. Transformation

More information

Molecular Diagnostics in the Clinical Microbiology Laboratory

Molecular Diagnostics in the Clinical Microbiology Laboratory Molecular Diagnostics in the Clinical Microbiology Laboratory Patrick Tang, MD, PhD, FRCPC B.C. Centre for Disease Control University of British Columbia Molecular Diagnostics in the Clinical Microbiology

More information

Beginner s Guide to Real-Time PCR

Beginner s Guide to Real-Time PCR Beginner s Guide to Real-Time PCR 02 Real-time PCR basic principles PCR or the Polymerase Chain Reaction has become the cornerstone of modern molecular biology the world over. Real-time PCR is an advanced

More information

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) PR037 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Polymerase Chain Reaction (PCR) Teacher s Guidebook (Cat. # BE 305) think proteins!

More information

How is genome sequencing done?

How is genome sequencing done? How is genome sequencing done? Using 454 Sequencing on the Genome Sequencer FLX System, DNA from a genome is converted into sequence data through four primary steps: Step One DNA sample preparation; Step

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing DNA sequence represents a single format onto which a broad range of biological phenomena can be projected for high-throughput data collection Over the past three years, massively

More information

DNA Sequencing Troubleshooting Guide

DNA Sequencing Troubleshooting Guide DNA Sequencing Troubleshooting Guide Successful DNA Sequencing Read Peaks are well formed and separated with good quality scores. There is a small area at the beginning of the run before the chemistry

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter

More information

Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit

Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit Product Bulletin Human Identification Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit The Quantifiler kits produce reliable and reproducible results, helping to

More information

4 General PCR Methods Page

4 General PCR Methods Page Table of Contents General PCR Methods Page PCR Protocol Selection Guide...65.1 Basic PCR... 66.1.1 Hot Start PCR - The new Standard... 66.1.1.1 Reagents and Equipment Required... 66.1.1.2 General Considerations

More information

Extraction from Buccal Epithelial Cells

Extraction from Buccal Epithelial Cells Genomic DNA Extraction from Buccal Epithelial Cells The purpose of this lab is to collect a DNA sample from the cells that line the inside of your mouth and to use this sample to explore one of the most

More information

Lab 1: Who s Your Daddy? (AKA DNA Purification and PCR)

Lab 1: Who s Your Daddy? (AKA DNA Purification and PCR) Lab 1: Who s Your Daddy? (AKA DNA Purification and PCR) Goals of the lab: 1. To understand how DNA s chemical properties can be exploited for purification 2. To learn practical applications of DNA purification

More information

DNA and Forensic Science

DNA and Forensic Science DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief

More information

DNA FRAGMENT ANALYSIS by Capillary Electrophoresis

DNA FRAGMENT ANALYSIS by Capillary Electrophoresis DNA FRAGMENT ANALYSIS by Capillary Electrophoresis USER GUIDE DNA Fragment Analysis by Capillary Electrophoresis Publication Number 4474504 Rev. A Revision Date September 2012 For Research Use Only. Not

More information

T08-003A. Figure 1: The Results Editor home screen.

T08-003A. Figure 1: The Results Editor home screen. Technical Note Dissociation Curve Analysis T08-003A General Introduction to Data Analysis The aim of this Technical Note is to explain the principle of dissociation curve analysis and to guide you through

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

An introduction to PCR and real-time PCR Dr. F. Waldherr CONGEN Biotechnologie GmbH

An introduction to PCR and real-time PCR Dr. F. Waldherr CONGEN Biotechnologie GmbH An introduction to PCR and real-time PCR Dr. F. Waldherr CONGEN Biotechnologie GmbH DNA basic principles DNA carries the information of life on Earth DNA is present in all organisms (some viruses use RNA)

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

BIOTECHNOLOGY. What can we do with DNA?

BIOTECHNOLOGY. What can we do with DNA? BIOTECHNOLOGY What can we do with DNA? Biotechnology Manipulation of biological organisms or their components for research and industrial purpose Usually manipulate DNA itself How to study individual gene?

More information

A great video with lots of visuals of plots and how the fluorescent probes work, reviewing this info, is at:

A great video with lots of visuals of plots and how the fluorescent probes work, reviewing this info, is at: REAL- TIME POLYMERASE CHAIN REACTION: This technology has all but replaced Northern blots for determining gene expression in tissues, cells, and organisms with more accuracy and more quantitative capabilities

More information

DNA Core Facility: DNA Sequencing Guide

DNA Core Facility: DNA Sequencing Guide DNA Core Facility: DNA Sequencing Guide University of Missouri-Columbia 216 Life Sciences Center Columbia, MO 65211 http://biotech.missouri.edu/dnacore/ Table of Contents 1. Evaluating Sequencing Data..

More information

Cloning of genes from genomic DNA: Part 3-Restriction Enzyme Digestion and Agarose Gel Electrophoresis

Cloning of genes from genomic DNA: Part 3-Restriction Enzyme Digestion and Agarose Gel Electrophoresis Cloning of genes from genomic DNA: Part 3-Restriction Enzyme Digestion and Agarose Gel Electrophoresis Continuing from our isolation of genomic DNA and PCR amplification of either the evenskipped gene

More information

DNA Sequencing: The Past, the Present and the Future

DNA Sequencing: The Past, the Present and the Future STARS Mini-Symposium 9/12/2016 DNA Sequencing: The Past, the Present and the Future Ralf Kittler, Ph.D. McDermott Center for Human Growth and Development ralf.kittler@utsouthwestern.edu Outline DNA sequencing

More information

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes.

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology has had-and will havemany important

More information

PCR and Real-time PCR. Richard Thwaites Plant Health Group, CSL

PCR and Real-time PCR. Richard Thwaites Plant Health Group, CSL PCR and Real-time PCR Richard Thwaites Plant Health Group, CSL Conventional PCR Amplification of a specific target DNA sequence DNA amplified between primers Target sequences typically 150 bp or more Requires

More information

CHAPTER 8 RECOMBINANT DNA and GENETIC ENGINEERING

CHAPTER 8 RECOMBINANT DNA and GENETIC ENGINEERING CHAPTER 8 RECOMBINANT DNA and GENETIC ENGINEERING Questions to be addressed: How are recombinant DNA molecules generated in vitro? How is recombinant DNA amplified? What analytical techniques are used

More information

MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS

MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS Richard L. Hodinka, Ph.D. University of South Carolina School of Medicine Greenville Greenville Health System, Greenville, SC hodinka@greenvillemed.sc.edu

More information

Fluorescent dyes for use with the

Fluorescent dyes for use with the Detection of Multiple Reporter Dyes in Real-time, On-line PCR Analysis with the LightCycler System Gregor Sagner, Cornelia Goldstein, and Rob van Miltenburg Roche Molecular Biochemicals, Penzberg, Germany

More information

Gene Mapping Techniques

Gene Mapping Techniques Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction

More information

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...

More information

Sequencing a Genome:

Sequencing a Genome: Sequencing a Genome: Inside the Washington University Genome Sequencing Center Activity Supplement (Electropherogram Interpretation) Project Outline The multimedia project Sequencing a Genome: Inside the

More information

1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.

1. Molecular computation uses molecules to represent information and molecular processes to implement information processing. Chapter IV Molecular Computation These lecture notes are exclusively for the use of students in Prof. MacLennan s Unconventional Computation course. c 2013, B. J. MacLennan, EECS, University of Tennessee,

More information

360 Master Mix. , and a supplementary 360 GC Enhancer.

360 Master Mix. , and a supplementary 360 GC Enhancer. Product Bulletin AmpliTaq Gold 360 Master Mix and 360 DNA Polymerase AmpliTaq Gold 360 Master Mix AmpliTaq Gold 360 DNA Polymerase 360 Coverage for a Full Range of Targets AmpliTaq Gold 360 Master Mix

More information

SEQUENCING TROUBLESHOOTING

SEQUENCING TROUBLESHOOTING SEQUENCING TROUBLESHOOTING No sequence or very weak sequence Possible explanations: There was no DNA in your tube (or far less DNA than necessary). o Did you quantitate the DNA using a spectrophotometer?

More information

BacReady TM Multiplex PCR System

BacReady TM Multiplex PCR System BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental

More information

Biotechnology: DNA Technology & Genomics

Biotechnology: DNA Technology & Genomics Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What

More information