NGS Technologies for Genomics and Transcriptomics
|
|
|
- Damon Tyler
- 10 years ago
- Views:
Transcription
1 NGS Technologies for Genomics and Transcriptomics Massimo Delledonne Department of Biotechnologies - University of Verona 13 years and $3 billion required for the Human Genome Project's reference genome 1
2 Clone-by-clone shotgun sequencing Whole-genome shotgun sequencing 3 The $300,000,000 Celera effort was intended to proceed at a faster pace and at a fraction of the cost.. 4 2
3 Sanger sequencing (invented in the early 1970s) 96 samples 800 nt / sample nt / day Human genome: bp Minimum coverage for an accurate analysis: 8X = nt = days! No Generation Sequencing 3
4 New Generation Sequencing! GS20 (2005) 100 bp x Reads = 20 Mbp x5 GS FLX (2007) 200 bp x Reads = 100 Mbp x5 GS FLX Titanium (2008) 400 bp x 1 M. Reads = 500 Mbp 454 Revolution GS20 (2005) 100 bp x Reads = 20 Mbp x5 GS FLX (2007) 200 bp x Reads = 100 Mbp x5 GS FLX Titanium (2008) 400 bp x 1 M. Reads = 500 Mbp >00405_2045_2005 CAGTCTCGTCGTCGTACGATCGTACGTAGCTTCACTTACGTACGCGGCG GGGCGCATCTGCGCGCGCGATTATATCATCATCATACTCAGCATCGTCC ATC >00343_3489_2007 CAGTCTCGTCGTCGTACGATCGTACGTAGCTTCACTTACGTACGCGGCG GGGCGCATCTGCGCGCGCGATTATATCATCATCATACTCAGCATCGTCC ATCGATCGATCGATGATCGACGATCGTAGTCTACGTAGTACGTAGCTAG CTTCGATCGATCGTACGTACGTCGTACGTAGTCAGACGTCAGCTACAGT CATCTACGTAGCTCTACGTCGTGCATGCTAGCTATCGATCACGACTTAT GCATC >01384_3992_2008 CAGTCTCGTCGTCGTACGATCGTACGTAGCTTCACTTACGTACGCGGCG GGGCGCATCTGCGCGCGCGATTATATCATCATCATACTCAGCATCGTCC ATCGATCGATCGATGATCGACGATCGTAGTCTACGTAGTACGTAGCTAG CTTCGATCGATCGTACGTACGTCGTACGTAGTCAGACGTCAGCTACAGT CATCTACGTAGCTCTACGTCGTGCATGCTAGCTATCGATCACGACTTAT GCATCCTCGGTATTCGGCGTACGATCGCTGACTGCTCGATTTTCGATCG TACGTACCGTCAGCTAGCTAAAAAAAAAGCTGCGCGGTCAGCATCGTTG CATGCGCTACTGCTAGTACGTAGTAGTGCTACGTTTTATATCGTCGCCA AATCTCTTCGGCTTTCG 4
5 April months and USD with 454 Life Sciences apoe unknown Now Generation Sequencing GSFLX reads ( 800 nt) GSJunior reads ( nt) 5
6 Genome Analyzer II (x) End 2007: 30 million reads, 33 nucleotides each (1 Gbase) End 2008: 50 million reads, 50 nucleotides each (2.5 Gbases) : 300 million single reads, 150 nucleotides each 600 million paired reads, 150 nucleotides each (90 Gbases) HiSeq 2000 HIGHEST OUTPUT 600 Gb per run HIGHEST NUMBER OF READS Three billion (100 or 2 x 100) reads 12 6
7 5500xl SOLiD System 7
8 8
9 9
10 The commercial PacBio RS instrument generates average read lengths of 1,000 bases, with a small fraction of reads longer than 10 kilobases, and have a typical run time of 30 minutes. The commercial instrument runs chips with 75,000 wells, or zero-mode waveguides. The commercial raw read accuracy is between 85 and 90 percent. September 27, 2011 With the C2 chemistry, the Expression Analysis team achieved average read lengths of 2,715 base pairs, with a mean maximum read length of 13,091 base pairs. "Our personal best is just over 14,000 bases," Hurban said. Despite the potential of PacBio's platform to produce very long reads, which would enable better assemblies, adoption of the instrument since its launch in the second quarter of this year has been slower than expected. As a result, PacBio last week announced that it would have to lay off around 130 employees 10
11 December,
12 MiSeq January, Next Generation Sequencing Ion Proton Sequencer The Benchtop Genome Center January 10th, 2012 Supports Ion Proton I and Proton II chips 209,800 system list price (sequencer and server) $164,900 for Ion PGM owners State-of-the-art electronics to support highest throughput 24 12
13 January 10th, 2012 Resequencing vs. de-novo assembling Long reads sequencing Short reads sequencing bases bases Reference genome 26 13
14 Resequencing is good only if the reference genome is good Next Next (Next) Generation Sequencing Technologies for haplotyping and de-novo assembling 14
15 Biological nanopores 15
16 16
17 Current Status: alpha testing (beta testing to start by end of 2012) Projected commercial availability: 2013 Sequencing the Human Genome Human Genome Project James Watson Personal genome years dollars months dollars days dollars 17
18 18
19 Center for Functional Genomics Grid-ION-Proton? Illumina HiSeq 1000 Verona, 9 Febbraio 2007 PowerEdge TM R900 4 Intel Xeon core 128 Gb RAM Cluster HP DL380 G7 6 Xeon core 144 Gb RAM 19
20 Alberto Ferrarini Luciano Xumerle Luca Venturini Andrea Minio Plant Biology Mario Pezzotti (UniVR) Grant Cramer (USA) Medicine Giovanni Martinelli (UniBO) Paolo Garagnani (UniBO) Marina Noris (Mario Negri) Alberto Zamò (UniVR) Elisabetta Trabetti (UniVR) Domenico Girelli (UniVR) Giovanni Malerba Paola Tononi Gianpiero Zamperin Genny Buson Elisa Zago Anne-Marie Digby 20
Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center
Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing
NGS data analysis. Bernardo J. Clavijo
NGS data analysis Bernardo J. Clavijo 1 A brief history of DNA sequencing 1953 double helix structure, Watson & Crick! 1977 rapid DNA sequencing, Sanger! 1977 first full (5k) genome bacteriophage Phi X!
Next Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
July 7th 2009 DNA sequencing
July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer
Introduction to next-generation sequencing data
Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS
Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office
2013 Laboratory Accreditation Program Audioconferences and Webinars Implementing Next Generation Sequencing (NGS) as a Clinical Tool in the Laboratory Nazneen Aziz, PhD Director, Molecular Medicine Transformation
Introduction to NGS data analysis
Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High
Next generation DNA sequencing technologies. theory & prac-ce
Next generation DNA sequencing technologies theory & prac-ce Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing
Next Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University [email protected] http://tandem.bu.edu/ The Human Genome Project took
Computational Genomics. Next generation sequencing (NGS)
Computational Genomics Next generation sequencing (NGS) Sequencing technology defies Moore s law Nature Methods 2011 Log 10 (price) Sequencing the Human Genome 2001: Human Genome Project 2.7G$, 11 years
MiSeq: Imaging and Base Calling
MiSeq: Imaging and Page Welcome Navigation Presenter Introduction MiSeq Sequencing Workflow Narration Welcome to MiSeq: Imaging and. This course takes 35 minutes to complete. Click Next to continue. Please
Putting Genomes in the Cloud with WOS TM. ddn.com. DDN Whitepaper. Making data sharing faster, easier and more scalable
DDN Whitepaper Putting Genomes in the Cloud with WOS TM Making data sharing faster, easier and more scalable Table of Contents Cloud Computing 3 Build vs. Rent 4 Why WOS Fits the Cloud 4 Storing Sequences
Automated DNA sequencing 20/12/2009. Next Generation Sequencing
DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing
Microbial Oceanomics using High-Throughput DNA Sequencing
Microbial Oceanomics using High-Throughput DNA Sequencing Ramiro Logares Institute of Marine Sciences, CSIC, Barcelona 9th RES Users'Conference 23 September 2015 Importance of microbes in the sunlit ocean
History of DNA Sequencing & Current Applications
History of DNA Sequencing & Current Applications Christopher McLeod President & CEO, 454 Life Sciences, A Roche Company IMPORTANT NOTICE Intended Use Unless explicitly stated otherwise, all Roche Applied
Automated and Scalable Data Management System for Genome Sequencing Data
Automated and Scalable Data Management System for Genome Sequencing Data Michael Mueller NIHR Imperial BRC Informatics Facility Faculty of Medicine Hammersmith Hospital Campus Continuously falling costs
Overview of Next Generation Sequencing platform technologies
Overview of Next Generation Sequencing platform technologies Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Outline 1. Technologies
SEQUENCING. From Sample to Sequence-Ready
SEQUENCING From Sample to Sequence-Ready ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES, NOT ONCE, BUT EVERY TIME The highest-quality amplicons more sensitive, accurate, and specific Full support for all major
14/12/2012. HLA typing - problem #1. Applications for NGS. HLA typing - problem #1 HLA typing - problem #2
www.medical-genetics.de Routine HLA typing by Next Generation Sequencing Kaimo Hirv Center for Human Genetics and Laboratory Medicine Dr. Klein & Dr. Rost Lochhamer Str. 9 D-8 Martinsried Tel: 0800-GENETIK
Computational infrastructure for NGS data analysis. José Carbonell Caballero Pablo Escobar
Computational infrastructure for NGS data analysis José Carbonell Caballero Pablo Escobar Computational infrastructure for NGS Cluster definition: A computer cluster is a group of linked computers, working
Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing
STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAAC GTGCAC GTGAAC Wouter Coppieters Head of the genomics core facility GIGA center, University of Liège Bioruptor NGS: Unbiased DNA
How long is long enough?
How long is long enough? - Modeling to predict genome assembly performance - Hayan Lee@Schatz Lab Feb 26, 2014 Quantitative Biology Seminar 1 Outline Background Assembly history Recent sequencing technology
The NGS IT notes. George Magklaras PhD RHCE
The NGS IT notes George Magklaras PhD RHCE Biotechnology Center of Oslo & The Norwegian Center of Molecular Medicine University of Oslo, Norway http://www.biotek.uio.no http://www.ncmm.uio.no http://www.no.embnet.org
OpenCB a next generation big data analytics and visualisation platform for the Omics revolution
OpenCB a next generation big data analytics and visualisation platform for the Omics revolution Development at the University of Cambridge - Closing the Omics / Moore s law gap with Dell & Intel Ignacio
New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova
New generation sequencing: current limits and future perspectives Giorgio Valle CRIBI Università di Padova Around 2004 the Race for the 1000$ Genome started A few questions... When? How? Why? Standard
Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University
Genotyping by sequencing and data analysis Ross Whetten North Carolina State University Stein (2010) Genome Biology 11:207 More New Technology on the Horizon Genotyping By Sequencing Timeline 2007 Complexity
Analysis of NGS Data
Analysis of NGS Data Introduction and Basics Folie: 1 Overview of Analysis Workflow Images Basecalling Sequences denovo - Sequencing Assembly Annotation Resequencing Alignments Comparison to reference
RNAseq / ChipSeq / Methylseq and personalized genomics
RNAseq / ChipSeq / Methylseq and personalized genomics 7711 Lecture Subhajyo) De, PhD Division of Biomedical Informa)cs and Personalized Biomedicine, Department of Medicine University of Colorado School
The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics
The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long
Eoulsan Analyse du séquençage à haut débit dans le cloud et sur la grille
Eoulsan Analyse du séquençage à haut débit dans le cloud et sur la grille Journées SUCCES Stéphane Le Crom (UPMC IBENS) [email protected] Paris November 2013 The Sanger DNA sequencing method Sequencing
Next Generation Sequencing for DUMMIES
Next Generation Sequencing for DUMMIES Looking at a presentation without the explanation from the author is sometimes difficult to understand. This document contains extra information for some slides that
Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
Genomic Applications on Cray supercomputers: Next Generation Sequencing Workflow. Barry Bolding. Cray Inc Seattle, WA
Genomic Applications on Cray supercomputers: Next Generation Sequencing Workflow Barry Bolding Cray Inc Seattle, WA 1 CUG 2013 Paper Genomic Applications on Cray supercomputers: Next Generation Sequencing
Removing Sequential Bottlenecks in Analysis of Next-Generation Sequencing Data
Removing Sequential Bottlenecks in Analysis of Next-Generation Sequencing Data Yi Wang, Gagan Agrawal, Gulcin Ozer and Kun Huang The Ohio State University HiCOMB 2014 May 19 th, Phoenix, Arizona 1 Outline
Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe
Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. To published results faster With proven scalability To the forefront of discovery To limitless applications
NECC History. Karl V. Steiner 2011 Annual NECC Meeting, Orono, Maine March 15, 2011
NECC History Karl V. Steiner 2011 Annual NECC Meeting, Orono, Maine March 15, 2011 EPSCoR Cyberinfrastructure Workshop First regional NENI (now NECC) Workshop held in Vermont in August 2007 Workshop heldinkentucky
SMRT Analysis v2.2.0 Overview. 1. SMRT Analysis v2.2.0. 1.1 SMRT Analysis v2.2.0 Overview. Notes:
SMRT Analysis v2.2.0 Overview 100 338 400 01 1. SMRT Analysis v2.2.0 1.1 SMRT Analysis v2.2.0 Overview Welcome to Pacific Biosciences' SMRT Analysis v2.2.0 Overview 1.2 Contents This module will introduce
PAGANTEC: OPENMP PARALLEL ERROR CORRECTION FOR NEXT-GENERATION SEQUENCING DATA
PAGANTEC: OPENMP PARALLEL ERROR CORRECTION FOR NEXT-GENERATION SEQUENCING DATA Markus Joppich, Tony Bolger, Dirk Schmidl Björn Usadel and Torsten Kuhlen Markus Joppich Lehr- und Forschungseinheit Bioinformatik
Next Generation Sequencing data Analysis at Genoscope. Jean-Marc Aury
Next Generation Sequencing data Analysis at Genoscope Jean-Marc Aury Introduction Presentation of Genoscope and NGS activities Overview of sequencing technologies Sequencing and assembly of prokaryotic
How Sequencing Experiments Fail
How Sequencing Experiments Fail v1.0 Simon Andrews [email protected] Classes of Failure Technical Tracking Library Contamination Biological Interpretation Something went wrong with a machine
Keeping up with DNA technologies
Keeping up with DNA technologies Mihai Pop Department of Computer Science Center for Bioinformatics and Computational Biology University of Maryland, College Park The evolution of DNA sequencing Since
The Rise of Industrial Big Data. Brian Courtney General Manager Industrial Data Intelligence
The Rise of Industrial Big Data Brian Courtney General Manager Industrial Data Intelligence Agenda Introduction Big Data for the industrial sector Case in point: Big data saves millions at GE Energy Seeking
NGS and complex genetics
NGS and complex genetics Robert Kraaij Genetic Laboratory Department of Internal Medicine [email protected] Gene Hunting Rotterdam Study and GWAS Next Generation Sequencing Gene Hunting Mendelian gene
UCLA Team Sequences Cell Line, Puts Open Source Software Framework into Production
Page 1 of 6 UCLA Team Sequences Cell Line, Puts Open Source Software Framework into Production February 05, 2010 Newsletter: BioInform BioInform - February 5, 2010 By Vivien Marx Scientists at the department
DNA Sequencing & The Human Genome Project
DNA Sequencing & The Human Genome Project An Endeavor Revolutionizing Modern Biology Jutta Marzillier, Ph.D Lehigh University Biological Sciences November 13 th, 2013 Guess, who turned 60 earlier this
Genomic Testing: Actionability, Validation, and Standard of Lab Reports
Genomic Testing: Actionability, Validation, and Standard of Lab Reports emerge: Laura Rasmussen-Torvik Reaction: Heidi Rehm Summary: Dick Weinshilboum Panel: Murray Brilliant, David Carey, John Carpten,
Bacterial Next Generation Sequencing - nur mehr Daten oder auch mehr Wissen? Dag Harmsen Univ. Münster, Germany dharmsen@uni-muenster.
Bacterial Next Generation Sequencing - nur mehr Daten oder auch mehr Wissen? Dag Harmsen Univ. Münster, Germany [email protected] Commercial Disclosure Dag Harmsen is co-founder and partial owner
Intro to Bioinformatics
Intro to Bioinformatics Marylyn D Ritchie, PhD Professor, Biochemistry and Molecular Biology Director, Center for Systems Genomics The Pennsylvania State University Sarah A Pendergrass, PhD Research Associate
An example of bioinformatics application on plant breeding projects in Rijk Zwaan
An example of bioinformatics application on plant breeding projects in Rijk Zwaan Xiangyu Rao 17-08-2012 Introduction of RZ Rijk Zwaan is active worldwide as a vegetable breeding company that focuses on
DNA Sequencing and Personalised Medicine
DNA Sequencing and Personalised Medicine Mick Watson Director of ARK-Genomics The Roslin Institute PERSONALISED MEDICINE What is personalised medicine? Personalized Medicine refers to the tailoring of
Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms
Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Introduction Mate pair sequencing enables the generation of libraries with insert sizes in the range of several kilobases (Kb).
Worldwide Collaborations in Molecular Profiling
Worldwide Collaborations in Molecular Profiling Lillian L. Siu, MD Director, Phase I Program and Cancer Genomics Program Princess Margaret Cancer Centre Lillian Siu, MD Contracted Research: Novartis, Pfizer,
Illumina Sequencing Technology
Illumina Sequencing Technology Highest data accuracy, simple workflow, and a broad range of applications. Introduction Figure 1: Illumina Flow Cell Illumina sequencing technology leverages clonal array
Concepts and methods in sequencing and genome assembly
BCM-2004 Concepts and methods in sequencing and genome assembly B. Franz LANG, Département de Biochimie Bureau: H307-15 Courrier électronique: [email protected] Outline 1. Concepts in DNA and RNA
-> Integration of MAPHiTS in Galaxy
Enabling NGS Analysis with(out) the Infrastructure, 12:0512 Development of a workflow for SNPs detection in grapevine From Sets to Graphs: Towards a Realistic Enrichment Analy species: MAPHiTS -> Integration
Building Bioinformatics Capacity in Africa. Nicky Mulder CBIO Group, UCT
Building Bioinformatics Capacity in Africa Nicky Mulder CBIO Group, UCT Outline What is bioinformatics? Why do we need IT infrastructure? What e-infrastructure does it require? How we are developing this
Managing and Conducting Biomedical Research on the Cloud Prasad Patil
Managing and Conducting Biomedical Research on the Cloud Prasad Patil Laboratory for Personalized Medicine Center for Biomedical Informatics Harvard Medical School SaaS & PaaS gmail google docs app engine
NEXT GENERATION SEQUENCING
NEXT GENERATION SEQUENCING Dr. R. Piazza SANGER SEQUENCING + DNA NEXT GENERATION SEQUENCING Flowcell NEXT GENERATION SEQUENCING Library di DNA Genomic DNA NEXT GENERATION SEQUENCING NEXT GENERATION SEQUENCING
Searching Nucleotide Databases
Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames
Data Analysis & Management of High-throughput Sequencing Data. Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute
Data Analysis & Management of High-throughput Sequencing Data Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute Current Issues Current Issues The QSEQ file Number files per
Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011
Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear
Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage
Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research March 17, 2011 Rendez-Vous Séquençage Presentation Overview Core Technology Review Sequence Enrichment Application
A Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
Cloud BioLinux: Pre-configured and On-demand Bioinformatics Computing for the Genomics Community
Cloud BioLinux: Pre-configured and On-demand Bioinformatics Computing for the Genomics Community Ntinos Krampis Asst. Professor J. Craig Venter Institute [email protected] http://www.jcvi.org/cms/about/bios/kkrampis/
Data Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
Big Data Challenges. technology basics for data scientists. Spring - 2014. Jordi Torres, UPC - BSC www.jorditorres.
Big Data Challenges technology basics for data scientists Spring - 2014 Jordi Torres, UPC - BSC www.jorditorres.eu @JordiTorresBCN Data Deluge: Due to the changes in big data generation Example: Biomedicine
Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment
Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249
G E N OM I C S S E RV I C ES
GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E
Cloud BioLinux: Pre-configured and On-demand Bioinformatics Computing for the Genomics Community
Cloud BioLinux: Pre-configured and On-demand Bioinformatics Computing for the Genomics Community Ntinos Krampis Asst. Professor J. Craig Venter Institute [email protected] http://www.jcvi.org/cms/about/bios/kkrampis/
8/7/2012. Experimental Design & Intro to NGS Data Analysis. Examples. Agenda. Shoe Example. Breast Cancer Example. Rat Example (Experimental Design)
Experimental Design & Intro to NGS Data Analysis Ryan Peters Field Application Specialist Partek, Incorporated Agenda Experimental Design Examples ANOVA What assays are possible? NGS Analytical Process
OpenCB development - A Big Data analytics and visualisation platform for the Omics revolution
OpenCB development - A Big Data analytics and visualisation platform for the Omics revolution Ignacio Medina, Paul Calleja, John Taylor (University of Cambridge, UIS, HPC Service (HPCS)) Abstract The advent
HADOOP IN THE LIFE SCIENCES:
White Paper HADOOP IN THE LIFE SCIENCES: An Introduction Abstract This introductory white paper reviews the Apache Hadoop TM technology, its components MapReduce and Hadoop Distributed File System (HDFS)
HP ProLiant Gen8 vs Gen9 Server Blades on Data Warehouse Workloads
HP ProLiant Gen8 vs Gen9 Server Blades on Data Warehouse Workloads Gen9 Servers give more performance per dollar for your investment. Executive Summary Information Technology (IT) organizations face increasing
Typing in the NGS era: The way forward!
Typing in the NGS era: The way forward! Valeria Michelacci NGS course, June 2015 Typing from sequence data NGS-derived conventional Multi Locus Sequence Typing (University of Warwick, 7 housekeeping genes)
Integrated Rule-based Data Management System for Genome Sequencing Data
Integrated Rule-based Data Management System for Genome Sequencing Data A Research Data Management (RDM) Green Shoots Pilots Project Report by Michael Mueller, Simon Burbidge, Steven Lawlor and Jorge Ferrer
Analysis of VDI Storage Performance During Bootstorm
Analysis of VDI Storage Performance During Bootstorm Introduction Virtual desktops are gaining popularity as a more cost effective and more easily serviceable solution. The most resource-dependent process
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
Next generation sequencing (NGS)
Next generation sequencing (NGS) Vijayachitra Modhukur BIIT [email protected] 1 Bioinformatics course 11/13/12 Sequencing 2 Bioinformatics course 11/13/12 Microarrays vs NGS Sequences do not need to be known
Personalized Medicine and IT
Personalized Medicine and IT Data-driven Medicine in the Age of Genomics www.intel.com/healthcare/bigdata Ketan Paranjape General Manager, Life Sciences Intel Corp. @Portlandketan 1 The Central Dogma of
MoBEDAC -- Integrated data and analysis for the indoor and built environment. Folker Meyer Argonne National Laboratory GSC 13 Shenzhen, China
MoBEDAC -- Integrated data and analysis for the indoor and built environment Folker Meyer Argonne National Laboratory GSC 13 Shenzhen, China NGS is causing paradigm shift Environmental clone libraries
Scaling from 1 PC to a super computer using Mascot
Scaling from 1 PC to a super computer using Mascot 1 Mascot - options for high throughput When is more processing power required? Options: Multiple Mascot installations Using a large Unix server Clusters
GC3 Use cases for the Cloud
GC3: Grid Computing Competence Center GC3 Use cases for the Cloud Some real world examples suited for cloud systems Antonio Messina Trieste, 24.10.2013 Who am I System Architect
OpenPower: IBM s Strategy for Best of Breed 64-bit Linux
HRG Harvard Research Group HRG Assessment: OpenPower: IBM s Strategy for Best of Breed 64-bit Linux Overview As users migrate from RISC/UNIX platforms to Linux, to which 64-bit architecture will they move
4. GS Reporter Application 65
Data Processing B Table of Contents Part B: Data Processing 2. GS Sequencer (Output Only; Not a DataRig Application) 42 2.1 GS Sequencer Application Output...42 2.1.1 datarunparams.parse...43 2.1.2 imagelog.parse...44
SAP HANA Enabling Genome Analysis
SAP HANA Enabling Genome Analysis Joanna L. Kelley, PhD Postdoctoral Scholar, Stanford University Enakshi Singh, MSc HANA Product Management, SAP Labs LLC Outline Use cases Genomics review Challenges in
Analysis of ChIP-seq data in Galaxy
Analysis of ChIP-seq data in Galaxy November, 2012 Local copy: https://galaxy.wi.mit.edu/ Joint project between BaRC and IT Main site: http://main.g2.bx.psu.edu/ 1 Font Conventions Bold and blue refers
Introduction Bioo Scientific
Next Generation Sequencing Catalog 2014-2015 Introduction Bioo Scientific Bioo Scientific is a global life science company headquartered in Austin, TX, committed to providing innovative products and superior
