Introduction to next-generation sequencing data

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Introduction to next-generation sequencing data"

Transcription

1 Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast

2 Outline History of DNA sequencing NGS or massively parallel sequencing How it works: Illumina sequencing by synthesis Library preparation Clonal amplification future single molecule Characteristics of the data: Quality control Base calling and quality (FastQ format) Phasing and homopolymers Trimming Implications of PCR Duplicates and bias Contamination

3 Sequencing time-line 2014 : Illumina HiSeq X10 - $1,000 Genome? Andy Vierstraete

4 Conventional DNA sequencing Dideoxy terminator Sanger method Fluorescent dyes Gel electrophoresis 1 lane = 1 sequence Capillary electrophoresis Primer Electropherogram "G" tube: All four dntp's, ddgtp and DNA polymerase "A" tube: All four dntp's, ddatp and DNA polymerase "T" tube: All four dntp's, ddttp and DNA polymerase "C" tube: All four dntp's, ddctp and DNA polymerase spring2003/obenrader/sanger_method_page.htm

5 Next Generation Sequencing (NGS) Process millions of sequencing reads in parallel Common concept is the analysis of millions of sequences associated with a solid surface (or in wells) Contrast with traditional gel electrophoresis Range of platforms available Illustrate with Illumina Ion Torrent (Life Technologies/Thermo Fisher)

6 NGS workflow Library preparation RNA DNA Fragmentation/size selection Addition of adaptors Template preparation: Single molecule clonal amplification Bridge PCR on a slide (cluster generation) Emulsion PCR Sequencing Reversible terminator (Illumina) Semiconductor (Ion Torrent) Single molecule (Nanopore)

7 Overview of DNA-Seq and RNA-Seq Genomic DNA cdna library AAAAAAA Extract RNA Fragmented DNA Library TACATTTGGGAAAAGTAAATTTGCTGAAAATAATCCCGGT AAGAAAGAAACACTTTTCATGTAATTAGCTTTTTTACATC AAACTTCAGAACCCAAAGTCATTGAGAATATTAGGGATCA CAGAACCACATGAGTCAGAATCATCAGAATATCCCACCAA AGGAGAAGGAAGGAGCAGAGGATTCAAAAGGAAATGGAAT GATGAATATGAAGAAATGTCAGAAATGAAAGAAGGGAAAG GAAATTGAATTCGATGAAATAAATGATACTTGCTTATCTG >10 million reads Exon 1 Exon 2 Reference sequence Massively parallel sequencing Align to reference sequence

8 Library preparation

9 Illumina: Cluster generation Clonal amplification achieved by generating clusters on the surface of a flow cell (slide) See SBS technology video at

10 Massively parallel sequencing Glowing dots on a glass slide mark cloned DNA being sequenced

11 Reading the sequence Wash over all 4 nucleotides each with a fluorescent dye Only one complementary nucleotide incorporated

12 Illumina: Sequencing by synthesis: Prepare libraries with different index sequences Pool and sequence together multiplexing

13 Platforms Illumina has several instruments Desktop-sized MiSeq that can complete smaller runs in under a day NextSeq 500 High throughput HiSeq 2500 Ion Torrent semi-conductor sequencing (Life Technologies) Fast, cheap entry level, output increasing rapidly Personal Genome Machine Proton HiSeq 2500 PGM 314 chip Proton P1 chip Total output 600/120 Gb up to 100Mb 10Gb Run time 11 days/27 hrs 2-4 hrs 2-4 hrs Output/day 55 Gb up to 200 Mb ~20 Gb Read length 2 x 100/150bp up to 400b up to 200bp # of single reads 3/0.6 Billion up to 0.6M up to 82 Million

14 Ion torrent Semiconductor sequencing Incorporation of a nucleotide changes ph Beads with template attached (prepared by emulsion PCR) No optics required! Detected on a semiconductor sequencing chip

15 Signal processing to optimise base calling Signal Decay Phase correction phasing is the rate at which single molecules within a cluster loose sync with each other. Incomplete Extension Limit read length Further discussion Ion torrent: Illumina:

16 Read length and quality Per base sequence quality Phred quality score: Q an integer mapping of p, the probability that the corresponding base call is incorrect Damien Gregory:

17 FASTQ format Nucleotide sequence and associated quality score (represented by ASCI characters) Illumina: Flowcell lane & tile X'-and Y coordinates of the cluster Index of multiplex GAGCAAAATTGTAGAAGAATTCAGGATCTCGTATGCCGTC +PSI179204_0007:4:1:1025:10482#0/1 C-:AC:?5:C-AAA-5>-,A5A>5:A?-DD?5A::>;><B P. J. A. Cock, C. J. Fields, N. Goto, M. L. Heuer and P. M. Rice, The Sanger FASTQ file format for sequences with quality scores, and the Solexa/Illumina FASTQ variants. Nucleic Acids Research, 2010, Vol. 38, No. 6, doi: /nar/gkp1137

18 Homopolymers (runs of the same nucleotide) Illumina: Flow all 4 nucleotides, incorporate single one Ion torrent: Sequential flows of individual unmodified nucleotides Ionogram (Ion torrent) EBI

19 Trimming Quality Ends Adaptors Clip adaptors (fastx clipper) Adaptor A Insert Adaptor B Adaptor A Adaptor B FASTX-toolkit by Assaf Gordon

20 Implications of PCR Duplicate reads Erroneous quantification or variant detection Uneven coverage Additional sequencing required to achieve minimal coverage

21 Single nucleotide resolution High specificity Show ZEB1 mutation ZEB1 exon 7 Mutation: c.1920g>t p.gln640his CAG = Gln CAT = His

22 Contamination Sample mix ups (!) - indexing Carry-over from previous run FastQ screen

23 Single molecule sequencing: Nanopore Single-stranded DNA polymer is passed through a protein nanopore Individual DNA bases on the strand are identified in sequence as the DNA molecule passes through Oxford Nanopore

24 Summary NGS works by sequencing millions of reads in parallel Library preparation Add adaptors to DNA of interest Requires clonal amplification (template preparation) Sequence data presented in FastQ format Quality control critical Errors inherent in the technology, eg. Phasing and homopolymers, PCR Trimming Contamination

25 To analyze NGS data effectively you need to understand the technology

July 7th 2009 DNA sequencing

July 7th 2009 DNA sequencing July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977

More information

Next Generation Sequencing for DUMMIES

Next Generation Sequencing for DUMMIES Next Generation Sequencing for DUMMIES Looking at a presentation without the explanation from the author is sometimes difficult to understand. This document contains extra information for some slides that

More information

NGS data analysis. Bernardo J. Clavijo

NGS data analysis. Bernardo J. Clavijo NGS data analysis Bernardo J. Clavijo 1 A brief history of DNA sequencing 1953 double helix structure, Watson & Crick! 1977 rapid DNA sequencing, Sanger! 1977 first full (5k) genome bacteriophage Phi X!

More information

Next generation DNA sequencing technologies. theory & prac-ce

Next generation DNA sequencing technologies. theory & prac-ce Next generation DNA sequencing technologies theory & prac-ce Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing

More information

FOR REFERENCE PURPOSES

FOR REFERENCE PURPOSES BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit

More information

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

Introduction to NGS data analysis

Introduction to NGS data analysis Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High

More information

Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office

Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office 2013 Laboratory Accreditation Program Audioconferences and Webinars Implementing Next Generation Sequencing (NGS) as a Clinical Tool in the Laboratory Nazneen Aziz, PhD Director, Molecular Medicine Transformation

More information

Data Analysis for Ion Torrent Sequencing

Data Analysis for Ion Torrent Sequencing IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page

More information

Ion Torrent Amplicon Sequencing

Ion Torrent Amplicon Sequencing APPLICATION NOTE Amplicon Sequencing Ion Torrent Amplicon Sequencing Introduction The ability to sequence a genome or a portion of a genome has enabled researchers to begin to understand how the genetic

More information

PreciseTM Whitepaper

PreciseTM Whitepaper Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis

More information

DNA Sequencing. Ben Langmead. Department of Computer Science

DNA Sequencing. Ben Langmead. Department of Computer Science DN Sequencing Ben Langmead Department of omputer Science You are free to use these slides. If you do, please sign the guestbook (www.langmead-lab.org/teaching-materials), or email me (ben.langmead@gmail.com)

More information

Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University

Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University Genotyping by sequencing and data analysis Ross Whetten North Carolina State University Stein (2010) Genome Biology 11:207 More New Technology on the Horizon Genotyping By Sequencing Timeline 2007 Complexity

More information

An Overview of DNA Sequencing

An Overview of DNA Sequencing An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure

More information

Concepts and methods in sequencing and genome assembly

Concepts and methods in sequencing and genome assembly BCM-2004 Concepts and methods in sequencing and genome assembly B. Franz LANG, Département de Biochimie Bureau: H307-15 Courrier électronique: Franz.Lang@Umontreal.ca Outline 1. Concepts in DNA and RNA

More information

Illumina Sequencing Technology

Illumina Sequencing Technology Illumina Sequencing Technology Highest data accuracy, simple workflow, and a broad range of applications. Introduction Figure 1: Illumina Flow Cell Illumina sequencing technology leverages clonal array

More information

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing

More information

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

DNA Sequence Analysis

DNA Sequence Analysis DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide

More information

MiSeq: Imaging and Base Calling

MiSeq: Imaging and Base Calling MiSeq: Imaging and Page Welcome Navigation Presenter Introduction MiSeq Sequencing Workflow Narration Welcome to MiSeq: Imaging and. This course takes 35 minutes to complete. Click Next to continue. Please

More information

Computational Genomics. Next generation sequencing (NGS)

Computational Genomics. Next generation sequencing (NGS) Computational Genomics Next generation sequencing (NGS) Sequencing technology defies Moore s law Nature Methods 2011 Log 10 (price) Sequencing the Human Genome 2001: Human Genome Project 2.7G$, 11 years

More information

Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne

Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne Sanger Sequencing and Quality Assurance Zbigniew Rudzki Department of Pathology University of Melbourne Sanger DNA sequencing The era of DNA sequencing essentially started with the publication of the enzymatic

More information

Automated DNA sequencing 20/12/2009. Next Generation Sequencing

Automated DNA sequencing 20/12/2009. Next Generation Sequencing DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing

More information

eculab MolecuLab 45 DNA Sequencing - A Classroom Exercise Student Manual 950 Walnut Ridge Drive Hartland, WI 53029-9388 USA

eculab MolecuLab 45 DNA Sequencing - A Classroom Exercise Student Manual 950 Walnut Ridge Drive Hartland, WI 53029-9388 USA Mo eculab DNA Sequencing - A Classroom Exercise Student Manual 950 Walnut Ridge Drive Hartland, WI 53029-9388 USA Revision 11/2011 Student Manual BACKGROUND DNA sequencing technology was developed in the

More information

SEQUENCING. From Sample to Sequence-Ready

SEQUENCING. From Sample to Sequence-Ready SEQUENCING From Sample to Sequence-Ready ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES, NOT ONCE, BUT EVERY TIME The highest-quality amplicons more sensitive, accurate, and specific Full support for all major

More information

BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls?

BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? Giovanni Luca Scaglione, PhD ------------------------ Laboratory of Clinical Molecular Diagnostics and Personalized Medicine, Institute

More information

Introduction to NGS Technologies

Introduction to NGS Technologies Introduction to NGS Technologies Ignacio Medina im411@cam.ac.uk Head of Computational Biology Lab HPC Service, University of Cambridge, UK EMBL-EBI Scientific collaborator Genome Campus, Hinxton, Cambridge,

More information

Introduction Bioo Scientific

Introduction Bioo Scientific Next Generation Sequencing Catalog 2014-2015 Introduction Bioo Scientific Bioo Scientific is a global life science company headquartered in Austin, TX, committed to providing innovative products and superior

More information

DNA Sequencing & The Human Genome Project

DNA Sequencing & The Human Genome Project DNA Sequencing & The Human Genome Project An Endeavor Revolutionizing Modern Biology Jutta Marzillier, Ph.D Lehigh University Biological Sciences November 13 th, 2013 Guess, who turned 60 earlier this

More information

1/12 Dideoxy DNA Sequencing

1/12 Dideoxy DNA Sequencing 1/12 Dideoxy DNA Sequencing Dideoxy DNA sequencing utilizes two steps: PCR (polymerase chain reaction) amplification of DNA using dideoxy nucleoside triphosphates (Figures 1 and 2)and denaturing polyacrylamide

More information

Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling

Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling Lectures 1 and 8 15 February 7, 2013 This is a review of the material from lectures 1 and 8 14. Note that the material from lecture 15 is not relevant for the final exam. Today we will go over the material

More information

Next Generation Sequencing: Technology, Mapping, and Analysis

Next Generation Sequencing: Technology, Mapping, and Analysis Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took

More information

PLNT2530 Unit 6e DNA Sequencing

PLNT2530 Unit 6e DNA Sequencing PLNT2530 Unit 6e DNA Sequencing Unless otherwise cited or referenced, all content of this presenataion is licensed under the Creative Commons License Attribution Share-Alike 2.5 Canada 1 High-throughput

More information

An Introduction to Next-Generation Sequencing for in vitro Fertilization

An Introduction to Next-Generation Sequencing for in vitro Fertilization An Introduction to Next-Generation Sequencing for in vitro Fertilization www.illumina.com/ivfprimer Table of Contents Part I. Welcome to Next-Generation Sequencing 3 NGS for in vitro Fertilization 3 Part

More information

INTRODUCTION TO NGS VARIANT CALLING ANALYSIS

INTRODUCTION TO NGS VARIANT CALLING ANALYSIS Hospital Universitari Vall d Hebron Institut de Recerca - VHIR Institut d Investigació Sanitària de l Instituto de Salud Carlos III (ISCIII) INTRODUCTION TO NGS VARIANT CALLING ANALYSIS Bioinformàtica

More information

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,

More information

Overview of Next Generation Sequencing platform technologies

Overview of Next Generation Sequencing platform technologies Overview of Next Generation Sequencing platform technologies Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Outline 1. Technologies

More information

- In 1976 1977, Allan Maxam and walter Gilbert devised the first method for sequencing DNA fragments containing up to ~ 500 nucleotides.

- In 1976 1977, Allan Maxam and walter Gilbert devised the first method for sequencing DNA fragments containing up to ~ 500 nucleotides. DNA Sequencing - DNA sequencing includes several methods and technologies that are used for determining the order of the nucleotide bases adenine, guanine, cytosine, and thymine in a molecule of DNA. -

More information

The Biotechnology Education Company

The Biotechnology Education Company EDVTEK P.. Box 1232 West Bethesda, MD 20827-1232 The Biotechnology 106 EDV-Kit # Principles of DNA Sequencing Experiment bjective: The objective of this experiment is to develop an understanding of DNA

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing DNA sequence represents a single format onto which a broad range of biological phenomena can be projected for high-throughput data collection Over the past three years, massively

More information

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites.

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites. 1. A recombinant DNA molecules is one that is a. produced through the process of crossing over that occurs in meiosis b. constructed from DNA from different sources c. constructed from novel combinations

More information

How is genome sequencing done?

How is genome sequencing done? How is genome sequencing done? Using 454 Sequencing on the Genome Sequencer FLX System, DNA from a genome is converted into sequence data through four primary steps: Step One DNA sample preparation; Step

More information

Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing

Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAAC GTGCAC GTGAAC Wouter Coppieters Head of the genomics core facility GIGA center, University of Liège Bioruptor NGS: Unbiased DNA

More information

14/12/2012. HLA typing - problem #1. Applications for NGS. HLA typing - problem #1 HLA typing - problem #2

14/12/2012. HLA typing - problem #1. Applications for NGS. HLA typing - problem #1 HLA typing - problem #2 www.medical-genetics.de Routine HLA typing by Next Generation Sequencing Kaimo Hirv Center for Human Genetics and Laboratory Medicine Dr. Klein & Dr. Rost Lochhamer Str. 9 D-8 Martinsried Tel: 0800-GENETIK

More information

How Sequencing Experiments Fail

How Sequencing Experiments Fail How Sequencing Experiments Fail v1.0 Simon Andrews simon.andrews@babraham.ac.uk Classes of Failure Technical Tracking Library Contamination Biological Interpretation Something went wrong with a machine

More information

Troubleshooting Sequencing Data

Troubleshooting Sequencing Data Troubleshooting Sequencing Data Troubleshooting Sequencing Data No recognizable sequence (see page 7-10) Insufficient Quantitate the DNA. Increase the amount of DNA in the sequencing reactions. See page

More information

New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova

New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova New generation sequencing: current limits and future perspectives Giorgio Valle CRIBI Università di Padova Around 2004 the Race for the 1000$ Genome started A few questions... When? How? Why? Standard

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

PCR Polymerase Chain Reaction

PCR Polymerase Chain Reaction Biological Sciences Initiative HHMI PCR Polymerase Chain Reaction PCR is an extremely powerful technique used to amplify any specific piece of DNA of interest. The DNA of interest is selectively amplified

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

G E N OM I C S S E RV I C ES

G E N OM I C S S E RV I C ES GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E

More information

Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms

Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Introduction Mate pair sequencing enables the generation of libraries with insert sizes in the range of several kilobases (Kb).

More information

Upgrade to the gold standard for high-fidelity PCR

Upgrade to the gold standard for high-fidelity PCR 3 Thermo Scientific Phusion and Phire DNA Polymerases Accurate, fast and powerful Polymerases for better PCR Extremely accurate, fast and robust amplification Instant activation hot start technology Direct

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing 38. Informationsgespräch der Blutspendezentralefür Wien, Niederösterreich und Burgenland Österreichisches Rotes Kreuz 22. November 2014, Parkhotel Schönbrunn Die Zukunft hat

More information

Analysis of DNA methylation: bisulfite libraries and SOLiD sequencing

Analysis of DNA methylation: bisulfite libraries and SOLiD sequencing Analysis of DNA methylation: bisulfite libraries and SOLiD sequencing An easy view of the bisulfite approach CH3 genome TAGTACGTTGAT TAGTACGTTGAT read TAGTACGTTGAT TAGTATGTTGAT Three main problems 1.

More information

Sequencing power for every scale. Systems for every application, for every lab.

Sequencing power for every scale. Systems for every application, for every lab. Sequencing power for every scale. Systems for every application, for every lab. Proven sequencing technology. Accelerate your research. Achieve your next breakthrough. What started as novel Illumina chemistry,

More information

Cluster Generation. Module 2: Overview

Cluster Generation. Module 2: Overview Cluster Generation Module 2: Overview Sequencing Workflow Sample Preparation Cluster Generation Sequencing Data Analysis 2 Cluster Generation 3 5 DNA (0.1-5.0 μg) Library preparation Single Cluster molecule

More information

3 rd Generation Sequencing Technologies. Roger E. Bumgarner

3 rd Generation Sequencing Technologies. Roger E. Bumgarner 3 rd Generation Sequencing Technologies Roger E. Bumgarner rogerb@uw.edu Brief review First generation sequencing technologies Sanger and Maxim Gilbert methods Used either chemical or enzymatic methods

More information

Sanger Sequencing. Troubleshooting Guide. Failed sequence

Sanger Sequencing. Troubleshooting Guide. Failed sequence Sanger Sequencing Troubleshooting Guide Below are examples of the main problems experienced in ABI Sanger sequencing. Possible causes for failure and their solutions are listed below each example. The

More information

A Brief Guide to Interpreting the DNA Sequencing Electropherogram Version 3.0

A Brief Guide to Interpreting the DNA Sequencing Electropherogram Version 3.0 A Brief Guide to Interpreting the DNA Sequencing Electropherogram Version 3.0 Plant-Microbe Genomics Facility The Ohio State University 484 W.12 th Ave., Columbus, OH 43210 Ph: 614/247-6204 FAX: 614/247-8696

More information

History of DNA Sequencing & Current Applications

History of DNA Sequencing & Current Applications History of DNA Sequencing & Current Applications Christopher McLeod President & CEO, 454 Life Sciences, A Roche Company IMPORTANT NOTICE Intended Use Unless explicitly stated otherwise, all Roche Applied

More information

Description: Molecular Biology Services and DNA Sequencing

Description: Molecular Biology Services and DNA Sequencing Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:

More information

Chapter 20: Biotechnology: DNA Technology & Genomics

Chapter 20: Biotechnology: DNA Technology & Genomics Biotechnology Chapter 20: Biotechnology: DNA Technology & Genomics The BIG Questions How can we use our knowledge of DNA to: o Diagnose disease or defect? o Cure disease or defect? o Change/improve organisms?

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

Electrophoresis, cleaning up on spin-columns, labeling of PCR products and preparation extended products for sequencing

Electrophoresis, cleaning up on spin-columns, labeling of PCR products and preparation extended products for sequencing Electrophoresis, cleaning up on spin-columns, labeling of PCR products and preparation extended products for sequencing PAGE electrophoresis Polyacrylamide gel electrophoresis (PAGE) is used for separating

More information

Bioanalyzer Applications for

Bioanalyzer Applications for Bioanalyzer Applications for Next-Gen Sequencing: Updates and Tips March 1 st, 2011 Charmian Cher, Ph.D Field Applications Scientist Page 1 Agenda 1 2 3 Next-gen sequencing library preparation workflow

More information

New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.

New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc. New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System

More information

Upgrade to the gold standard for high-fidelity PCR

Upgrade to the gold standard for high-fidelity PCR 3 Thermo Scientific Phusion and Phire DNA s Accurate, fast and powerful s for better PCR Extremely accurate, fast and robust amplification Instant activation hot start technology Direct loading on gels

More information

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University Egypt Interpretation of sequence results An overview on

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

NGS Technologies for Genomics and Transcriptomics

NGS Technologies for Genomics and Transcriptomics NGS Technologies for Genomics and Transcriptomics Massimo Delledonne Department of Biotechnologies - University of Verona http://profs.sci.univr.it/delledonne 13 years and $3 billion required for the Human

More information

Universidade Estadual de Maringá

Universidade Estadual de Maringá Universidade Estadual de Maringá Disciplina: Biologia Molecular Sequenciamento de ácidos nucléicos Profa. Dra. Maria Aparecida Fernandez Maxan e Gilbert - quebra química Berg, Gilbert and Sanger dideoxinucleotideos

More information

Sequencing the Human Genome

Sequencing the Human Genome Revised and Updated Edvo-Kit #339 Sequencing the Human Genome 339 Experiment Objective: In this experiment, students will read DNA sequences obtained from automated DNA sequencing techniques. The data

More information

JetSeq DNA Library Preparation Kit. Product Manual

JetSeq DNA Library Preparation Kit. Product Manual JetSeq DNA Library Preparation Kit Product Manual 2 Product Manual bioline.com/jetseq JetSeq DNA Library Preparation Kit JetSeq DNA Library Preparation Kit TABLE OF CONTENTS 1 Kit contents 04 2 Description

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

Parallel Compression and Decompression of DNA Sequence Reads in FASTQ Format

Parallel Compression and Decompression of DNA Sequence Reads in FASTQ Format , pp.91-100 http://dx.doi.org/10.14257/ijhit.2014.7.4.09 Parallel Compression and Decompression of DNA Sequence Reads in FASTQ Format Jingjing Zheng 1,* and Ting Wang 1, 2 1,* Parallel Software and Computational

More information

Introduction. Preparation of Template DNA

Introduction. Preparation of Template DNA Procedures and Recommendations for DNA Sequencing at the Plant-Microbe Genomics Facility Ohio State University Biological Sciences Building Room 420, 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204;

More information

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...

More information

Genomic Services and Development Unit User Manual

Genomic Services and Development Unit User Manual Public Health England National Infection Service Genomic Services and Development Unit User Manual BW0056.10 Authorised by: C. Arnold Effective Date: 28/01/16 About Public Health England Public Health

More information

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research March 17, 2011 Rendez-Vous Séquençage Presentation Overview Core Technology Review Sequence Enrichment Application

More information

Athanasia Pavlopoulou University of Thessaly, Lamia June 2015

Athanasia Pavlopoulou University of Thessaly, Lamia June 2015 Athanasia Pavlopoulou University of Thessaly, Lamia June 2015 Early DNA Sequencing Technologies Early efforts at DNA sequencing were: o tedious o time consuming o labor intensive Frederick Sanger (Sanger

More information

The RNAi Consortium (TRC) Broad Institute

The RNAi Consortium (TRC) Broad Institute TRC Laboratory Protocols Protocol Title: One Step PCR Preparation of Samples for Illumina Sequencing Current Revision Date: 11/10/2012 RNAi Platform,, trc_info@broadinstitute.org Brief Description: This

More information

Reduced Representation Bisulfite-Seq A Brief Guide to RRBS

Reduced Representation Bisulfite-Seq A Brief Guide to RRBS April 17, 2013 Reduced Representation Bisulfite-Seq A Brief Guide to RRBS What is RRBS? Typically, RRBS samples are generated by digesting genomic DNA with the restriction endonuclease MspI. This is followed

More information

Recombinant DNA and Biotechnology

Recombinant DNA and Biotechnology Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study

More information

Targeted. sequencing solutions. Accurate, scalable, fast TARGETED

Targeted. sequencing solutions. Accurate, scalable, fast TARGETED Targeted TARGETED Sequencing sequencing solutions Accurate, scalable, fast Sequencing for every lab, every budget, every application Ion Torrent semiconductor sequencing Ion Torrent technology has pioneered

More information

Sequencing Library qpcr Quantification Guide

Sequencing Library qpcr Quantification Guide Sequencing Library qpcr Quantification Guide FOR RESEARCH USE ONLY Introduction 3 Quantification Workflow 4 Best Practices 5 Consumables and Equipment 6 Select Control Template 8 Dilute qpcr Control Template

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter

More information

DNA Sequencing Handbook

DNA Sequencing Handbook Genomics Core 147 Biotechnology Building Ithaca, New York 14853-2703 Phone: (607) 254-4857; Fax (607) 254-4847 Web: http://cores.lifesciences.cornell.edu/brcinfo/ Email: DNA_Services@cornell.edu DNA Sequencing

More information

Algorithms for Next Generation Sequencing Data Analysis

Algorithms for Next Generation Sequencing Data Analysis UNIVERSITÀ DEGLI STUDI DI MILANO - BICOCCA FACOLTÀ DI SCIENZE MATEMATICHE, FISICHE E NATURALI DIPARTIMENTO DI INFORMATICA, SISTEMISTICA E COMUNICAZIONE DOTTORATO DI RICERCA IN INFORMATICA - CICLO XXV Ph.D.

More information

1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.

1. Molecular computation uses molecules to represent information and molecular processes to implement information processing. Chapter IV Molecular Computation These lecture notes are exclusively for the use of students in Prof. MacLennan s Unconventional Computation course. c 2013, B. J. MacLennan, EECS, University of Tennessee,

More information

Reading DNA Sequences:

Reading DNA Sequences: Reading DNA Sequences: 18-th Century Mathematics for 21-st Century Technology Michael Waterman University of Southern California Tsinghua University DNA Genetic information of an organism Double helix,

More information

Illumina TruSeq DNA Adapters De-Mystified James Schiemer

Illumina TruSeq DNA Adapters De-Mystified James Schiemer 1 of 5 Illumina TruSeq DNA Adapters De-Mystified James Schiemer The key to sequencing random fragments of DNA is by the addition of short nucleotide sequences which allow any DNA fragment to: 1) Bind to

More information

Single-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples

Single-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples DATA Sheet Single-Cell DNA Sequencing with the C 1 Single-Cell Auto Prep System Reveal hidden populations and genetic diversity within complex samples Single-cell sensitivity Discover and detect SNPs,

More information

Procedures For DNA Sequencing

Procedures For DNA Sequencing Procedures For DNA Sequencing Plant-Microbe Genomics Facility (PMGF) Ohio State University 420 Biological Sciences Building 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204 FAX: 614/292-6337

More information

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold

More information

BIOO LIFE SCIENCE PRODUCTS

BIOO LIFE SCIENCE PRODUCTS BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit

More information

BIOTECHNOLOGY. What can we do with DNA?

BIOTECHNOLOGY. What can we do with DNA? BIOTECHNOLOGY What can we do with DNA? Biotechnology Manipulation of biological organisms or their components for research and industrial purpose Usually manipulate DNA itself How to study individual gene?

More information

Genomics 92 (2008) 255 264. Contents lists available at ScienceDirect. Genomics. journal homepage: www.elsevier.com/locate/ygeno

Genomics 92 (2008) 255 264. Contents lists available at ScienceDirect. Genomics. journal homepage: www.elsevier.com/locate/ygeno Genomics 92 (2008) 255 264 Contents lists available at ScienceDirect Genomics journal homepage: www.elsevier.com/locate/ygeno Review Applications of next-generation sequencing technologies in functional

More information