Universidade Estadual de Maringá

Transcription

1 Universidade Estadual de Maringá Disciplina: Biologia Molecular Sequenciamento de ácidos nucléicos Profa. Dra. Maria Aparecida Fernandez

2 Maxan e Gilbert - quebra química Berg, Gilbert and Sanger dideoxinucleotideos

3 1977 Maxan e Gilbert - quebra química

4

5 Berg, Gilbert and Sanger dideoxinucleotideos

6 Pareamento de fitas de DNA H Invertido e Complementar P H 2 C H2C P H 2 C P H2C P P H 2 C H2C P H

7 Sanger Method 1. A single strand of DNA to be sequenced (yellow) is hybridized to a 5 end labeled synthetic deoxynucleotide primer(brown). 2. The primer is elongated using DNA polymerase in four separate reaction mixtures containing four normal deoxynucleotide triphosphates (dntps) plus one of dideoxynucleotide triphosphate (ddntps) in a ratio of 100 :1.

8

9

10 Alto peso molecular Filme de raio X Auto-radiograma Leitura manual Baixo peso molecular TGGCTCGGCCTCAAGTCGAG GTTATCAGATCTGCAACTCAA

11 Reação de seqüênciamento

12 Fragmentos amplificados na reação de seqüênciamento

13 Eletroforese no seqüênciamento

14

15

16 Captura do fluorescente e processamento da informação

17

18

19

20 MegaBACE 1000 array Capillary Array Cathode (-) Anode (+) Capillaries Cuvette Window

21 MegaBACE System

22 MegaBACE System

23 MegaBACE Sequencing System LPA Linear polyacrilamide

24

25

26

27

28 Data Processing Raw data electrophoretically separated and collected signal Electropherogram processed sequence

29 Basecalling Raw data Converting raw data to processed sequence

30 Basecalling Baseline subtraction Signal from all four channels adjusted to the same baseline

31 Basecalling Spectral separation Spectral overlap removed by the application of cross-talk values

32 Basecalling Mobility correction Differences in migration due to terminators corrected by mobility file (ABI) or basecaller (MegaBACE)

33 Basecalling Base assignment Nucleotide sequence assigned by a peak in the proper space

34 Electropherogram view

35 Sequence view

36

37 Peak spacing

38

39 ESD Fasta Sc Text fabd Start PointStop Point Confidence Adjustment

40 MegaBACE Sequence Analyzer v3.0 Viewing Ambiguous Bases in Ambiguous Mode

41

42

43 New DNA Sequencing Methods 1. Sequencing by MALDI-TF Mass Spectrometry 2. Sequencing by Hybridization 3. Pyrosequencing 4. Nanopore Sequencing 5. Atomic-Force Microscopy 6. Single-Molecule Fluorescence Microscopy

44 Sequencing by MALDI-TF Mass Spectrometry MW spectrum of 33-mer 5 -ACT AAT GGC AGT TCA TTG CAT GAA TTT TAA AAG-3

45 DNA Sequencing by Hybridization This strategy involved annealing a labeled unknown DNA fragment to a complete array of short oligonucleotides (e.g. all 65,336 combinations of 8mers) and deciphering the unknown sequence from the annealing pattern.

46

47 Emulsion Based Clonal Amplification A + PCR Reagents B Mix DNA Library & capture beads (limited dilution) + Emulsion il Create Water-in-oil emulsion Micro-reactors Break micro-reactors Isolate DNA containing beads Perform emulsion PCR Generation of millions of clonally amplified sequencing templates on each bead No cloning and colony picking

48 Depositing DNA Beads into the PicoTiter Plate Load beads into PicoTiter Plate Load Enzyme Beads Centrifuge Step 44 μm

49 Elegant ptics Design - No Alignment or Focus Ever! PicoTiterPlate Wells Reagent Flow Sequencing By Synthesis Photons Generated are Captured by Camera Sequencing Image Created

50 454 Sequencing Instrument 2. Load PicoTiter plate into instrument 3. Load Reagents in a single rack 4. Sequence Entire Genome at once, in real-time 1. Genome is loaded into a PicoTiter plate

51

52

53 Summary of Pyrosequencing Pyrosequencing is to sequence DNA by enzymatic DNA synthesis, and the DNA sequence is determined the from the signal peak of released photons during the synthesis.

54 454 Sequencing: BaseCalling Count the photons generated for each flow Base call using signal thresholds Delivery of one nucleotide per flow ensures accurate base calling 4-mer Flow rder T A C G Measures the presence or absence of each nucleotide at any given position 3-mer KEY (TCAG) 2-mer 1-mer

55 Three Examples of Read Length E. coli (51% GC) C. jejuni (30%GC) T. thermophilus (69% GC)

56 PIRSEQUENCIADRES