Analysis of DNA methylation: bisulfite libraries and SOLiD sequencing

Size: px
Start display at page:

Download "Analysis of DNA methylation: bisulfite libraries and SOLiD sequencing"

Transcription

1 Analysis of DNA methylation: bisulfite libraries and SOLiD sequencing

2

3 An easy view of the bisulfite approach CH3 genome TAGTACGTTGAT TAGTACGTTGAT read TAGTACGTTGAT TAGTATGTTGAT

4

5 Three main problems 1. We need some software specifically designed to align bisulfite reads 2. Loss of sensibility and specificity due to the reduced complexity (3 letters instead than 4) and to the increased size of the reference 3. Need of special strategies for making the shotgun libraries

6 Three main problems 1. We need some software specifically designed to align bisulfite reads 2. Loss of sensibility and specificity due to the reduced complexity (3 letters instead than 4) and to the increased size of the reference 3. Need of special strategies for making the shotgun libraries Before 5' ATGCTGCACTGACACGTGAT 3' 3' TACGACGTGACTGTGCACTA 5' After 5' ATGUTGUAUTGAUAUGTGAT 3' 3' TAUGAUGTGAUTGTGUAUTA 5'

7 Need of special strategies for making the shotgun libraries Lister R, Pelizzola M, Dowen RH, Hawkins RD, Hon G, Tonti-Filippini J, Nery JR, Lee L, Ye Z, Ngo QM, Edsall L, Antosiewicz-Bourget J, Stewart R, Ruotti V, Millar AH, Thomson JA, Ren B, Ecker JR: Human DNA methylomes at base resolution show widespread epigenomic differences. Nature 2009, 462:

8 CRIBI method for bisulfite libraries preparation - MeSS Methylome Solid Sequencing Lisa Marchioretto and Robin Targon DNA Nuclei Cells Bisulfite treatment Adaptor ligation PCR Sequencing

9 Optimization of the fragmentation and bisulfite treatment

10 Optimization of adaptor ligation Comparing to other Bis-seq methods, MeSS requires ten times less starting genomic DNA, avoids intermediate purification steps between enzymatic reactions, and allows an efficient amplification with fewer PCR cycles.

11 Loss of sensibility and specificity due to the reduced complexity (3 letters instead than 4) and to the increased size of the reference Directional cloning would half the mapping complexity Before 5' ATGCTGCACTGACACGTGAT 3' 3' TACGACGTGACTGTGCACTA 5' After 5' ATGUTGUAUTGAUAUGTGAT 3' 3' TAUGAUGTGAUTGTGUAUTA 5' SOLiD color space maintains the full set of 4 colors after C/U conversion >882_4_710_F3 T >882_4_840_F3 T >882_4_1657_F3 T >882_5_1275_F3 T >882_6_553_F3 T

12 software specifically designed to align bisulfite reads

13 Exaustive approach of bisulfite alignment STEP 1 Virtual bisulfite conversion of the genome Genome...ATGCTGCACTGACACGTGATGTCGTA... Converted AGT genome...atgttgtattgatatgtgatgttgta... STEP 2 Virtual bisulfite conversion of any C in the reads, remembering the original Read #1 Read #2 TGTTGTATTG TGTTGTATTG TGATGTCGTA TGATGTTGTA STEP 3 Alignment of three base sequences Converted genome Converted reads STEP 4/5 If original read had any C, check that also genome was C and label as Met Original genome Converted genome Converted read Original read...atgttgtattgatatgtgatgttgta... TGTTGTATTG TGATGTTGTA CH3 /...ATGCTGCACTGACACGTGATGTCGTA......ATGTTGTATTGATATGTGATGTTGTA... TGATGTTGTA TGATGTCGTA

14 PASS implementation of bisulfite alignment Simulated test set Starting from 3 simulated hg19 reference genome which cytosines was randomly methylated on both DNA strands to obtain 3 cytosines methylation percent level ( 0%, 50% and 100% ) we have generated 6 test sets containing 1 million of reads each one (3 for colorspace and 3 for basespace data) using dwgsim (ref.) program. The same procedure is applied to obtain the not bisulfite threated DNA simulated test sets except for the unmodified hg19 reference genome as input of dwgsim program. Used parameters: [ -y 0 -z 0 -d 100 -S 2 -c 0 or 1 (for Illumina or SOLiD data) C -1 -N ] The per base/color/flow error rate and the rate of mutation is set to the default values (respectively: 0.02 and 0.001). All simulated test sets was produced using the same seed, so they are comparable for number of reads, position and strand to the human reference genome (hg19 ).

15 PASS implementation of bisulfite alignment General strategy 1. Find seeds in base space 2. Extend alignment in color space

16 SOLiD chemistry: ligation probes Ligation site, cleavage site & dye are spatially separated Cleavage site Ligation site Fluorescent dye interrogates base on 1st + 2nd position 2nd Base A C G T A T n n n z z z N=degenerate bases, Z=universal bases 45 = 1024 probes (256 probes per color) es t1as B Ligation Probes are Octamers A C G T 2-base encoding is based on ligation sequencing rather than sequencing by synthesis. It takes advantage of fluorescent labeled 8-mer probes that distinguish the two 3 prime most bases (AT in the figure). To have a full coverage, repeated cycles of ligation are done, using primers annealing to different positions of the adapter sequence (see next slides).

17 SOLiD 4-color ligation Ligation reaction universal seq primer ligase Y-probe XXnnnzzz 1µm 1µm bead bead P1 Primer XXnnnzzz X Xn n n z z z B-probe G-probe Template Sequence R-probe XXnnnzzz

18 SOLiD 4-color ligation Ligation reaction ligase Y-probe XXnnnzzz X Xn n n z z z B-probe G-probe XXnnnzzz R-probe XXnnnzzz ligase universal seq primer 1µm 1µm bead bead p xx P1 Primer Template Sequence

19 SOLiD 4-color ligation Visualization universal seq primer 1µm 1µm bead bead xx P1 Primer Template Sequence Y 1-2

20 SOLiD ligation-based sequencing chemistry (2) Image Cap unextended strands Cleave-off fluor

21 SOLiD 4-color ligation Cleavage universal seq primer 1µm 1µm bead bead xx P1 Primer p Template Sequence Y 1-2

22 SOLiD 4-color ligation Ligation (2nd cycle) ligase Y-probe XXnnnzzz X Xn n n z z z B-probe G-probe XXnnnzzz R-probe XXnnnzzz ligase universal seq primer 1µm 1µm bead bead xx Adapter Oligo Sequence xx Template Sequence Y 1-2

23 SOLiD 4-color ligation Visualization (2nd cycle) universal seq primer 1µm 1µm bead bead XX xx Adapter Oligo Sequence Template Sequence Y R

24 SOLiD 4-color ligation Cleavage (2nd cycle) universal seq primer 1µm 1µm bead bead XX xx Adapter Oligo Sequence p Template Sequence Y R

25 SOLiD 4-color ligation interrogates every 4th-5th base universal seq primer 1µm 1µm bead bead XX XX XX Adapter Oligo Sequence XX XX Template Sequence Y R R B G

26 SOLiD 4-color ligation Reset 1µm 1µm bead bead Adapter Oligo Sequence Template Sequence

27 SOLiD 4-color ligation (1st cycle after reset) universal seq primer n-1 p ligase Y-probe XXnnnzzz X Xn n n z z z B-probe G-probe XXnnnzzz R-probe XXnnnzzz ligase universal seq primer n-1 p 1µm 1µm bead bead xx Adapter Oligo Sequence Template Sequence

28 SOLiD 4-color ligation (1st cycle after reset) universal seq primer n-1 1µm 1µm bead bead xx Adapter Oligo Sequence Template Sequence R 0-1

29 SOLiD 4-color ligation (2nd Round) universal seq primer n-1 1µm 1µm bead bead XX XX XX Adapter Oligo Sequence XX XX Template Sequence R R R B G

30 Sequential rounds of sequencing Multiple cycles per round 1µm 1µm bead bead Adapter Oligo Sequence Template Sequence universal seq primer 1-2 reset universal seq primer n reset universal seq primer n+3 reset 4-5 spacer 9-10 universal seq primer n spacer reset universal seq primer n spacer

31 Agenda Item Agenda Item Agenda Item SOLiD Chemistry Double Base Encoding

32 2 Base Pair Encoding Using 4 Dyes Red-probe 2nd Base A C G A T n n n z z z T A Blue-probe C es t1as B G T T n n n z z z T

33 2 base pair encoding reference alignment in color space A C G G T C G T C G T G T G C G T Base reference Color reference

34 2 base pair encoding reference alignment in color space A C G G T C G T C G T G T G C G T reference expected observed A C G G T C G C C G T G T G C G T A SNP to be real must be encoded by two color changes

35 Advantages of 2 base pair encoding Miscall A C G G T C G T C G T G T G C G T reference expected observed A C G G T C G C T A C A C A T A C 2nd Base A Single color change, represents sequencing error. C G T A es t1as B C G T

36 But there is more Only certain transitions are allowed for a real SNP Consider a triplet of bases, they define 2 colors. C A T There are only 3 possibilities for a change in the middle base, hence only 3 possibilities for the 2 colors to change to. Any of the other 6 possibilities for a 2-color change are not allowed and most probably represent measurement errors.

37 The Only Allowed Transitions C A T CGT Reverse Colors C C T C T T Other two colors (both orientations) Any other transitions would require the outer two bases to change

38 Not Allowed Transitions 2nd Base A C A T C G T A es t1as B C G T A G T T C T G T T C G C C C A C T G 1/3rd allowed vs 2/3rd not allowed

39 SOLiD Exact Call Chemistry (ECC) ECC allows to perform an extra run of ligations with 3-base encoding. This is used as a control of the accuracy, thus improving the quality of the sequence in color space. Also, it can return a sequence in base space with a good accuracy.

40 PASS implementation of bisulfite alignment (Davide Campagna) General strategy 1. Find seeds in base space 2. Extend alignment in color space 3. Rescue unaligned reads using a reference with the combination of methylated patterns

41

42

New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova

New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova New generation sequencing: current limits and future perspectives Giorgio Valle CRIBI Università di Padova Around 2004 the Race for the 1000$ Genome started A few questions... When? How? Why? Standard

More information

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,

More information

Description: Molecular Biology Services and DNA Sequencing

Description: Molecular Biology Services and DNA Sequencing Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:

More information

Introduction to next-generation sequencing data

Introduction to next-generation sequencing data Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS

More information

Next Generation Sequencing for DUMMIES

Next Generation Sequencing for DUMMIES Next Generation Sequencing for DUMMIES Looking at a presentation without the explanation from the author is sometimes difficult to understand. This document contains extra information for some slides that

More information

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

Illumina Sequencing Technology

Illumina Sequencing Technology Illumina Sequencing Technology Highest data accuracy, simple workflow, and a broad range of applications. Introduction Figure 1: Illumina Flow Cell Illumina sequencing technology leverages clonal array

More information

PreciseTM Whitepaper

PreciseTM Whitepaper Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis

More information

Illumina TruSeq DNA Adapters De-Mystified James Schiemer

Illumina TruSeq DNA Adapters De-Mystified James Schiemer 1 of 5 Illumina TruSeq DNA Adapters De-Mystified James Schiemer The key to sequencing random fragments of DNA is by the addition of short nucleotide sequences which allow any DNA fragment to: 1) Bind to

More information

Concepts and methods in sequencing and genome assembly

Concepts and methods in sequencing and genome assembly BCM-2004 Concepts and methods in sequencing and genome assembly B. Franz LANG, Département de Biochimie Bureau: H307-15 Courrier électronique: [email protected] Outline 1. Concepts in DNA and RNA

More information

Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University

Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University Genotyping by sequencing and data analysis Ross Whetten North Carolina State University Stein (2010) Genome Biology 11:207 More New Technology on the Horizon Genotyping By Sequencing Timeline 2007 Complexity

More information

SOLiD System accuracy with the Exact Call Chemistry module

SOLiD System accuracy with the Exact Call Chemistry module WHITE PPER 55 Series SOLiD System SOLiD System accuracy with the Exact all hemistry module ONTENTS Principles of Exact all hemistry Introduction Encoding of base sequences with Exact all hemistry Demonstration

More information

Reduced Representation Bisulfite-Seq A Brief Guide to RRBS

Reduced Representation Bisulfite-Seq A Brief Guide to RRBS April 17, 2013 Reduced Representation Bisulfite-Seq A Brief Guide to RRBS What is RRBS? Typically, RRBS samples are generated by digesting genomic DNA with the restriction endonuclease MspI. This is followed

More information

Extensible Sequence (XSQ) File Format Specification 1.0.1

Extensible Sequence (XSQ) File Format Specification 1.0.1 Extensible Sequence (XSQ) File Format Specification 1.0.1 Table of Contents 1 INTRODUCTION... 1 2 FILE FORMAT... 1 3 GENERALIZATIONS AND EXTENDED SPECIFICATION... 11 4 FIGURES... 13 1 Introduction This

More information

How is genome sequencing done?

How is genome sequencing done? How is genome sequencing done? Using 454 Sequencing on the Genome Sequencer FLX System, DNA from a genome is converted into sequence data through four primary steps: Step One DNA sample preparation; Step

More information

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research March 17, 2011 Rendez-Vous Séquençage Presentation Overview Core Technology Review Sequence Enrichment Application

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977

More information

Biotechnology: DNA Technology & Genomics

Biotechnology: DNA Technology & Genomics Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long

More information

A Guide to LAMP primer designing (PrimerExplorer V4)

A Guide to LAMP primer designing (PrimerExplorer V4) A Guide to LAMP primer designing (PrimerExplorer V4) Eiken Chemical Co., Ltd. _ Contents Key factors in designing LAMP primers 1. The LAMP primer 2. 2 Key factors in the LAMP primer design 3. The steps

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

Single Nucleotide Polymorphisms (SNPs)

Single Nucleotide Polymorphisms (SNPs) Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

Introduction To Epigenetic Regulation: How Can The Epigenomics Core Services Help Your Research? Maria (Ken) Figueroa, M.D. Core Scientific Director

Introduction To Epigenetic Regulation: How Can The Epigenomics Core Services Help Your Research? Maria (Ken) Figueroa, M.D. Core Scientific Director Introduction To Epigenetic Regulation: How Can The Epigenomics Core Services Help Your Research? Maria (Ken) Figueroa, M.D. Core Scientific Director Gene expression depends upon multiple factors Gene Transcription

More information

DNA Sequence Analysis

DNA Sequence Analysis DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide

More information

Universidade Estadual de Maringá

Universidade Estadual de Maringá Universidade Estadual de Maringá Disciplina: Biologia Molecular Sequenciamento de ácidos nucléicos Profa. Dra. Maria Aparecida Fernandez Maxan e Gilbert - quebra química Berg, Gilbert and Sanger dideoxinucleotideos

More information

Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform

Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Introduction, 2 Sample Prep Workflow, 3 Best Practices, 4 DNA Input Recommendations, 6

More information

TruSeq Custom Amplicon v1.5

TruSeq Custom Amplicon v1.5 Data Sheet: Targeted Resequencing TruSeq Custom Amplicon v1.5 A new and improved amplicon sequencing solution for interrogating custom regions of interest. Highlights Figure 1: TruSeq Custom Amplicon Workflow

More information

Welcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation.

Welcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation. Introduction to SMRTbell Template Preparation 100 338 500 01 1. SMRTbell Template Preparation 1.1 Introduction to SMRTbell Template Preparation Welcome to Pacific Biosciences' Introduction to SMRTbell

More information

July 7th 2009 DNA sequencing

July 7th 2009 DNA sequencing July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer

More information

Real-Time PCR Vs. Traditional PCR

Real-Time PCR Vs. Traditional PCR Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives

More information

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR Roche Applied Science Technical Note No. LC 18/2004 Purpose of this Note Assay Formats for Use in Real-Time PCR The LightCycler Instrument uses several detection channels to monitor the amplification of

More information

Data Analysis for Ion Torrent Sequencing

Data Analysis for Ion Torrent Sequencing IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page

More information

Reading DNA Sequences:

Reading DNA Sequences: Reading DNA Sequences: 18-th Century Mathematics for 21-st Century Technology Michael Waterman University of Southern California Tsinghua University DNA Genetic information of an organism Double helix,

More information

Reduced Representation Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform

Reduced Representation Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Reduced Representation Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Introduction, 3 Sample Prep Workflow, 4 Best Practices, 5 DNA Input Recommendations,

More information

Computational Genomics. Next generation sequencing (NGS)

Computational Genomics. Next generation sequencing (NGS) Computational Genomics Next generation sequencing (NGS) Sequencing technology defies Moore s law Nature Methods 2011 Log 10 (price) Sequencing the Human Genome 2001: Human Genome Project 2.7G$, 11 years

More information

Introduction Bioo Scientific

Introduction Bioo Scientific Next Generation Sequencing Catalog 2014-2015 Introduction Bioo Scientific Bioo Scientific is a global life science company headquartered in Austin, TX, committed to providing innovative products and superior

More information

- In 1976 1977, Allan Maxam and walter Gilbert devised the first method for sequencing DNA fragments containing up to ~ 500 nucleotides.

- In 1976 1977, Allan Maxam and walter Gilbert devised the first method for sequencing DNA fragments containing up to ~ 500 nucleotides. DNA Sequencing - DNA sequencing includes several methods and technologies that are used for determining the order of the nucleotide bases adenine, guanine, cytosine, and thymine in a molecule of DNA. -

More information

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh

More information

Nucleic Acid Techniques in Bacterial Systematics

Nucleic Acid Techniques in Bacterial Systematics Nucleic Acid Techniques in Bacterial Systematics Edited by Erko Stackebrandt Department of Microbiology University of Queensland St Lucia, Australia and Michael Goodfellow Department of Microbiology University

More information

Next Generation Sequencing: Technology, Mapping, and Analysis

Next Generation Sequencing: Technology, Mapping, and Analysis Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University [email protected] http://tandem.bu.edu/ The Human Genome Project took

More information

TIANquick Mini Purification Kit

TIANquick Mini Purification Kit TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer

More information

Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website

Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website Biomolecular Core Facility AI Dupont Hospital for Children, Rockland Center One, Room 214 Core: (302) 651-6712, Office: (302) 651-6707, [email protected] Katia Sol-Church, Ph.D., Director Jennifer Frenck

More information

Mitochondrial DNA Analysis

Mitochondrial DNA Analysis Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)

More information

Design of conditional gene targeting vectors - a recombineering approach

Design of conditional gene targeting vectors - a recombineering approach Recombineering protocol #4 Design of conditional gene targeting vectors - a recombineering approach Søren Warming, Ph.D. The purpose of this protocol is to help you in the gene targeting vector design

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

Innovations in Molecular Epidemiology

Innovations in Molecular Epidemiology Innovations in Molecular Epidemiology Molecular Epidemiology Measure current rates of active transmission Determine whether recurrent tuberculosis is attributable to exogenous reinfection Determine whether

More information

FOR REFERENCE PURPOSES

FOR REFERENCE PURPOSES BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit

More information

Cluster Generation. Module 2: Overview

Cluster Generation. Module 2: Overview Cluster Generation Module 2: Overview Sequencing Workflow Sample Preparation Cluster Generation Sequencing Data Analysis 2 Cluster Generation 3 5 DNA (0.1-5.0 μg) Library preparation Single Cluster molecule

More information

ZR DNA Sequencing Clean-up Kit

ZR DNA Sequencing Clean-up Kit INSTRUCTION MANUAL ZR DNA Sequencing Clean-up Kit Catalog Nos. D40 & D4051 Highlights Simple 2 Minute Bind, Wash, Elute Procedure Flexible 6-20 µl Elution Volumes Allow for Direct Loading of Samples with

More information

Real-time qpcr Assay Design Software www.qpcrdesign.com

Real-time qpcr Assay Design Software www.qpcrdesign.com Real-time qpcr Assay Design Software www.qpcrdesign.com Your Blueprint For Success Informational Guide 2199 South McDowell Blvd Petaluma, CA 94954-6904 USA 1.800.GENOME.1(436.6631) 1.415.883.8400 1.415.883.8488

More information

DNA Sequencing Overview

DNA Sequencing Overview DNA Sequencing Overview DNA sequencing involves the determination of the sequence of nucleotides in a sample of DNA. It is presently conducted using a modified PCR reaction where both normal and labeled

More information

The Biotechnology Education Company

The Biotechnology Education Company EDVTEK P.. Box 1232 West Bethesda, MD 20827-1232 The Biotechnology 106 EDV-Kit # Principles of DNA Sequencing Experiment bjective: The objective of this experiment is to develop an understanding of DNA

More information

Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe

Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. To published results faster With proven scalability To the forefront of discovery To limitless applications

More information

CUSTOM DNA SEQUENCING SERVICES

CUSTOM DNA SEQUENCING SERVICES CUSTOM DNA SEQUENCING SERVICES Satisfied Customers are our Driving Force We never stop exceeding your Expectations Value Read Service Single read sequencing of plasmid inserts or PCR products in tube and

More information

ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053

ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053 INSTRUCTION MANUAL ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053 Highlights Simple 10 Minute Bind, Wash, Elute Procedure Flexible 15-20 µl Elution Volumes Allow for Direct Loading of Samples

More information

Genome Sequencer System. Amplicon Sequencing. Application Note No. 5 / February 2007. www.roche-applied-science.com

Genome Sequencer System. Amplicon Sequencing. Application Note No. 5 / February 2007. www.roche-applied-science.com Genome Sequencer System Application Note No. 5 / February 2007 Amplicon Sequencing www.roche-applied-science.com 1 Amplicon Sequencing Corresponding author: Tom Jarvie, 454 Life Sciences Corporation, Branford,

More information

Chapter 6 DNA Replication

Chapter 6 DNA Replication Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore

More information

SEQUENCING. From Sample to Sequence-Ready

SEQUENCING. From Sample to Sequence-Ready SEQUENCING From Sample to Sequence-Ready ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES, NOT ONCE, BUT EVERY TIME The highest-quality amplicons more sensitive, accurate, and specific Full support for all major

More information

Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne

Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne Sanger Sequencing and Quality Assurance Zbigniew Rudzki Department of Pathology University of Melbourne Sanger DNA sequencing The era of DNA sequencing essentially started with the publication of the enzymatic

More information

Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office

Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office 2013 Laboratory Accreditation Program Audioconferences and Webinars Implementing Next Generation Sequencing (NGS) as a Clinical Tool in the Laboratory Nazneen Aziz, PhD Director, Molecular Medicine Transformation

More information

The Techniques of Molecular Biology: Forensic DNA Fingerprinting

The Techniques of Molecular Biology: Forensic DNA Fingerprinting Revised Fall 2011 The Techniques of Molecular Biology: Forensic DNA Fingerprinting The techniques of molecular biology are used to manipulate the structure and function of molecules such as DNA and proteins

More information

Difficult DNA Templates Sequencing. Primer Walking Service

Difficult DNA Templates Sequencing. Primer Walking Service Difficult DNA Templates Sequencing Primer Walking Service Result 16/18s (ITS 5.8s) rrna Sequencing Phylogenetic tree 16s rrna Region ITS rrna Region ITS and 26s rrna Region Order and Result Cloning Service

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.

1. Molecular computation uses molecules to represent information and molecular processes to implement information processing. Chapter IV Molecular Computation These lecture notes are exclusively for the use of students in Prof. MacLennan s Unconventional Computation course. c 2013, B. J. MacLennan, EECS, University of Tennessee,

More information

Troubleshooting for PCR and multiplex PCR

Troubleshooting for PCR and multiplex PCR Page 1 of 5 Page designed and maintained by Octavian Henegariu (Email: Tavi's Yale email or Tavi's Yahoo email). As I am currently pursuing a new junior faculty position, the Yale URL and email may change

More information

Next generation DNA sequencing technologies. theory & prac-ce

Next generation DNA sequencing technologies. theory & prac-ce Next generation DNA sequencing technologies theory & prac-ce Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing

More information

Genome-wide measurements of protein-dna interaction by chromatin immunoprecipitation

Genome-wide measurements of protein-dna interaction by chromatin immunoprecipitation Genome-wide measurements of protein-dna interaction by chromatin immunoprecipitation D. Puthier. laboratoire INSERM, Aix-Marseille Université, TAGC/INSERM U928, Parc Scientifique de Luminy case 928 Outline

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information

New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.

New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc. New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System

More information

DNA. Discovery of the DNA double helix

DNA. Discovery of the DNA double helix DNA Replication DNA Discovery of the DNA double helix A. 1950 s B. Rosalind Franklin - X-ray photo of DNA. C. Watson and Crick - described the DNA molecule from Franklin s X-ray. What is DNA? Question:

More information

An Overview of DNA Sequencing

An Overview of DNA Sequencing An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure

More information

Recombinant DNA Unit Exam

Recombinant DNA Unit Exam Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the

More information

PrimeSTAR HS DNA Polymerase

PrimeSTAR HS DNA Polymerase Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction

More information

restriction enzymes 350 Home R. Ward: Spring 2001

restriction enzymes 350 Home R. Ward: Spring 2001 restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually

More information

DNA Core Facility: DNA Sequencing Guide

DNA Core Facility: DNA Sequencing Guide DNA Core Facility: DNA Sequencing Guide University of Missouri-Columbia 216 Life Sciences Center Columbia, MO 65211 http://biotech.missouri.edu/dnacore/ Table of Contents 1. Evaluating Sequencing Data..

More information

1/12 Dideoxy DNA Sequencing

1/12 Dideoxy DNA Sequencing 1/12 Dideoxy DNA Sequencing Dideoxy DNA sequencing utilizes two steps: PCR (polymerase chain reaction) amplification of DNA using dideoxy nucleoside triphosphates (Figures 1 and 2)and denaturing polyacrylamide

More information

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns

More information

Complete Genomics Sequencing

Complete Genomics Sequencing TECHNOLOGY OVERVIEW Complete Genomics Sequencing Introduction With advances in nanotechnology, high-throughput instruments, and large-scale computing, it has become possible to sequence a complete human

More information

Dye-Blob message: Example: Generally, this is due to incomplete excess dye removal of the cycle sequence reaction.

Dye-Blob message: Example: Generally, this is due to incomplete excess dye removal of the cycle sequence reaction. When sequence data is uploaded to ilab, an email is sent notifying the user that data is ready. The staff of the DNA facility has the ability to edit this message to include specific remarks about how

More information

2006 7.012 Problem Set 3 KEY

2006 7.012 Problem Set 3 KEY 2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each

More information

Agencourt AMPure XP. Xtra Performance Post-PCR clean UP

Agencourt AMPure XP. Xtra Performance Post-PCR clean UP Agencourt AMPure XP Xtra Performance Post-PCR clean UP Applications o PCR o Genotyping, SNP detection o Fragment analysis o Sequencing (Sanger and Next generation) o Cloning o Primer walking Agencourt

More information

ONLINE SUPPLEMENTAL MATERIAL. Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue

ONLINE SUPPLEMENTAL MATERIAL. Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue ONLINE SUPPLEMENTAL MATERIAL Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue Sungmi Park 1, Ko-Ting Lu 1, Xuebo Liu 1, Tapan K. Chatterjee 2, Steven M. Rudich 3, Neal

More information

How Sequencing Experiments Fail

How Sequencing Experiments Fail How Sequencing Experiments Fail v1.0 Simon Andrews [email protected] Classes of Failure Technical Tracking Library Contamination Biological Interpretation Something went wrong with a machine

More information

Getting Started Guide

Getting Started Guide Primer Express Software Version 3.0 Getting Started Guide Before You Begin Designing Primers and Probes for Quantification Assays Designing Primers and Probes for Allelic Discrimination Assays Ordering

More information

Design high specificity CRISPR-Cas9 grnas: principles and tools. Heidi Huang, PhD

Design high specificity CRISPR-Cas9 grnas: principles and tools. Heidi Huang, PhD Design high specificity CRISPR-Cas9 grnas: principles and tools Heidi Huang, PhD Webinar Agenda 1 2 3 4 Introduction of CRISPR-Cas9 grna Design Resources and Services Q&A 2 What is CRISPR? CRISPR Clustered

More information

NGS data analysis. Bernardo J. Clavijo

NGS data analysis. Bernardo J. Clavijo NGS data analysis Bernardo J. Clavijo 1 A brief history of DNA sequencing 1953 double helix structure, Watson & Crick! 1977 rapid DNA sequencing, Sanger! 1977 first full (5k) genome bacteriophage Phi X!

More information

DNA-functionalized hydrogels for confined membrane-free in vitro transcription/translation

DNA-functionalized hydrogels for confined membrane-free in vitro transcription/translation Electronic Supplementary Material (ESI) for Lab on a Chip. This journal is The Royal Society of Chemistry 2014 DNA-functionalized hydrogels for confined membrane-free in vitro transcription/translation

More information

Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3

Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3 Table of Contents I. Description... 2 II. Kit Components... 2 III. Storage... 2 IV. 1st Strand cdna Synthesis Reaction... 3 V. RT-PCR, Real-time RT-PCR... 4 VI. Application... 5 VII. Preparation of RNA

More information

Mir-X mirna First-Strand Synthesis Kit User Manual

Mir-X mirna First-Strand Synthesis Kit User Manual User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.

More information

Procedures For DNA Sequencing

Procedures For DNA Sequencing Procedures For DNA Sequencing Plant-Microbe Genomics Facility (PMGF) Ohio State University 420 Biological Sciences Building 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204 FAX: 614/292-6337

More information

Overview of Next Generation Sequencing platform technologies

Overview of Next Generation Sequencing platform technologies Overview of Next Generation Sequencing platform technologies Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Outline 1. Technologies

More information

PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR. Results Interpretation Guide

PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR. Results Interpretation Guide PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR Results Interpretation Guide Pathogen Detection Systems by Real Time PCR Microbial offers real time PCR based systems for the detection of pathogenic bacteria

More information

DNA Replication in Prokaryotes

DNA Replication in Prokaryotes OpenStax-CNX module: m44488 1 DNA Replication in Prokaryotes OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,

More information