14/12/2012. HLA typing - problem #1. Applications for NGS. HLA typing - problem #1 HLA typing - problem #2

Size: px
Start display at page:

Download "14/12/2012. HLA typing - problem #1. Applications for NGS. HLA typing - problem #1 HLA typing - problem #2"

Transcription

1 Routine HLA typing by Next Generation Sequencing Kaimo Hirv Center for Human Genetics and Laboratory Medicine Dr. Klein & Dr. Rost Lochhamer Str. 9 D-8 Martinsried Tel: 0800-GENETIK or [email protected] Applications for NGS HLA typing - problem # HLA Chimerism Analysis Registry Donor Search MRD Cord Blood Molecular Oncology HLA typing - problem # HLA typing - problem # - work-intensive - time-consuming - cost-intensive

2 HLA typing - problem # NGS Technologies Advantages of the NGS technology - clonal amplification less ambiguities - multiplexing high throughput - reduced sequencing costs per base Requirements - high number of samples - not time critical analysis - identical requests MiSeq Roche GS FLX Ion Torrent Read length 0 bp bp 00 bp Output/run GB 0,8 GB GB (8) Indexing > 00 0 > 00 Accuracy high-moderate high-moderate moderate Cost/run Tissue Antigens 009, 7, 9-0 of - 7 HLA Loci (A, B, C, DRB, DQB, DQA, DPB) - up to 8 DNA samples in one sequencing run Applications for NGS Registry HLA Chimerism Analysis Registry Donor Search MRD Cord Blood Molecular Oncology

3 GS FLX Titanium Chemistry Process Steps - Overview TS-Primer = Target-Specific Primer Library Preparation ACACTGACGACATGGTTCTACACSGCCTCTGYGGGGAGAAGCA. Rapid Library Construction * gdna. h. empcr h hands on h amplification. Sequencing h prep 9 h run Data output Tag Seq MID-Primer = Barcode Primer TS-Primer DNA Library Preparation Prepare double-stranded DNA library with adapters Emulsion Titrations** empcr dstdna with adaptors attached to bead Clonally amplified sstdna in emulsion Sequencing Prepare sequencing run Quality filtered bases Forward CGTATCGCCTCCCTCGCGCCATCAGACGAGTGCGTACACTGACGACATGGTTCTACA Adaptor-Sequence Key Seq MID Seq Tag Seq sstdna ready to sequence ACACTGACGACATGGTTCTACACSGCCTCTGYGGGGAGAAGCA... TGTGACTGCTGTACCAAGATGTGSCGGAGACYCCCCTCTTCGT... CGTATCGCCTCCCTCGCGCCATCAGACGAGTGCGTACACTGACGACATGGTTCTACACSGCCTCTGYGGGGAGAAGCA... * One library provides enough DNA for thousands of sequencing runs. ** Only one titration is required for each sample. Pos., Matrix Mastermix 80µl 8 Tubes in Spalte Pos., Matrix Forward MID 0µl 9 Tubes PCR Setup Pos., PCR 9 Forward Primer 0µl B-8 in 8 Spalten Pos., PCR 9 Reverse Primer 0µl C-8 in 8 Spalten 9 DNA samples + neg-control PCR-Plates x 8 Pos., Matrix Reverse MID 0µl 9 Tubes Pos. & leere PCR 8 Platten Pos., Matrix DNA 0µl 9 Tubes - workstation with 9 Probe Head - 8-well Thermocycler Pooling PCR Purification PCR-Platte x second workstation with 8 channels - third workstation with 8 channels - Agencourt AmPure XP system

4 PCR Purification Process Steps. Emulsion PCR gdna. DNA Library Construction *. h. empcr h hands on. Sequencing h prep Data output h amp 9 h run Mix denatured dstdna library with DNA Capture beads Emulsify DNA Capture beads and PCR reagents in waterin-oil microreactors Clonal amplification occurs inside microreactors Break microreactors and enrich for DNA- positive beads sstdna library Clonally-amplified sstdna attached to bead 0 Bead Enrichment Process Steps a. Bead Deposition into PicoTiterPlate gdna. DNA Library Construction *. h. empcr h hands on. Sequencing h prep Data output h amp 9 h run Well diameter average for PicoTiterPlate is 9 µm A single clonally amplified sstdna bead (0 µm diameter) is deposited per well. Layers of packing, enzyme and PPiase Beads are deposited Plate is loaded into instrument for sequencing - second workstation with integrated REMe system - enrichment rate ~ -0% Amplified sstdna library beads PTP ready for sequencing GS FLX Titanium Bead Deposition Loading Beads into PicoTiterPlate Each region can be loaded separately Several gaskets can be used (,, 8 and regions) for the same PTP type

5 Ambiguities Ambiguities - Results, n=7 Unambiguous Resultswith G Ambiguous HLA-A 0 0,0% 7 00% 0 0% HLA-B 0,% 7 98,%,% HLA-DRB 77,% 98 8,8% 0 0% B*:0 B*:0 B*:0 Exon Exon Exon Exon Exon Exon Unambiguous: e. g. DRB*0:0:0 B*: Exon Exon Ambiguities outside of exon and : B*:0:0G Ambiguities outside of exon : DRB*:0:0G cis-trans Ambiguities inside of exon and : B*:0:0G, *:0:0G / B*:0, *::0G B*07:0, *:0 / B*0:, *:0 B*:0, *0:0 / B*:, *0: Ambiguities Summary - HLA - HLA typing by Next Generation Sequencing is feasible in a routine usage - 80 samples can be typed for HLA-A, -B and -DRB / run - high resolution can be achieved - most of the results can be reported with suffix G - by high number of samples, the costs are at least comparable with Sanger sequencing - lab automation is needed for high throughput (high costs) - standards must be defined by HLA community Ehrlich et al. BMC Genomics 0

6 Center for Human Genetics and Laboratory Medicine, Dr. Klein & Dr. Rost Lochhamer Street 9 D-8 Martinsried Germany Tel: GENETIK or [email protected] Ehrlich et al. BMC Genomics 0

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long

More information

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

SEQUENCING. From Sample to Sequence-Ready

SEQUENCING. From Sample to Sequence-Ready SEQUENCING From Sample to Sequence-Ready ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES, NOT ONCE, BUT EVERY TIME The highest-quality amplicons more sensitive, accurate, and specific Full support for all major

More information

HISTO SPOT SSO System. The most convenient automated HLA typing system. BAG Health Care the experts for HLA and blood group diagnostics

HISTO SPOT SSO System. The most convenient automated HLA typing system. BAG Health Care the experts for HLA and blood group diagnostics HISTO SPOT SSO System The most convenient automated HLA typing system BAG Health Care the experts for HLA and blood group diagnostics HISTO SPOT SSO System for on call, high throughput and disease association

More information

BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls?

BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? Giovanni Luca Scaglione, PhD ------------------------ Laboratory of Clinical Molecular Diagnostics and Personalized Medicine, Institute

More information

How is genome sequencing done?

How is genome sequencing done? How is genome sequencing done? Using 454 Sequencing on the Genome Sequencer FLX System, DNA from a genome is converted into sequence data through four primary steps: Step One DNA sample preparation; Step

More information

HISTO SPOT SSO System. The most convenient automated HLA typing system. BAG Health Care the experts for HLA and blood group diagnostics

HISTO SPOT SSO System. The most convenient automated HLA typing system. BAG Health Care the experts for HLA and blood group diagnostics HISTO SPOT SSO System The most convenient automated HLA typing system BAG Health Care the experts for HLA and blood group diagnostics HISTO SPOT SSO System for on call, high throughput and disease association

More information

July 7th 2009 DNA sequencing

July 7th 2009 DNA sequencing July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer

More information

empcr Amplification Method Manual - Lib-A

empcr Amplification Method Manual - Lib-A GS Junior Titanium Series May 2010 (Rev. April 2011) For life science research only. Not for use in diagnostic procedures. 1. WORKFLOW The emulsion-based clonal amplification (empcr amplification) of a

More information

Genome Sequencer System. Amplicon Sequencing. Application Note No. 5 / February 2007. www.roche-applied-science.com

Genome Sequencer System. Amplicon Sequencing. Application Note No. 5 / February 2007. www.roche-applied-science.com Genome Sequencer System Application Note No. 5 / February 2007 Amplicon Sequencing www.roche-applied-science.com 1 Amplicon Sequencing Corresponding author: Tom Jarvie, 454 Life Sciences Corporation, Branford,

More information

Illumina TruSight HLA Sequencing Panel Automated on the Biomek FX P HLA SP Liquid Handler

Illumina TruSight HLA Sequencing Panel Automated on the Biomek FX P HLA SP Liquid Handler Illumina TruSight HLA Sequencing Panel Automated on the Biomek FX P HLA SP Liquid Handler Zach Smith, MS, Senior Applications Scientist, Beckman Coulter, Inc. Nate Baird, PhD, Scientist, Illumina Brad

More information

Next generation DNA sequencing technologies. theory & prac-ce

Next generation DNA sequencing technologies. theory & prac-ce Next generation DNA sequencing technologies theory & prac-ce Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing

More information

Data Analysis for Ion Torrent Sequencing

Data Analysis for Ion Torrent Sequencing IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page

More information

Introduction to next-generation sequencing data

Introduction to next-generation sequencing data Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977

More information

History of DNA Sequencing & Current Applications

History of DNA Sequencing & Current Applications History of DNA Sequencing & Current Applications Christopher McLeod President & CEO, 454 Life Sciences, A Roche Company IMPORTANT NOTICE Intended Use Unless explicitly stated otherwise, all Roche Applied

More information

FOR REFERENCE PURPOSES

FOR REFERENCE PURPOSES BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit

More information

Genomics Services @ GENterprise

Genomics Services @ GENterprise Genomics Services @ GENterprise since 1998 Mainz University spin-off privately financed 6-10 employees since 2006 Genomics Services @ GENterprise Sequencing Service (Sanger/3730, 454) Genome Projects (Bacteria,

More information

HISTO SPOT SSO System

HISTO SPOT SSO System HISTO SPOT SSO System for HLA Typing HISTO SPOT Kits MR.SPOT Processor HISTO MATCH Software Complete system certified for IvD use HISTO SPOT Features The HISTO SPOT SSO assay in combination with the MR.SPOT

More information

Overview of Next Generation Sequencing platform technologies

Overview of Next Generation Sequencing platform technologies Overview of Next Generation Sequencing platform technologies Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Outline 1. Technologies

More information

Multiplex your most important

Multiplex your most important Multiplex your most important genetic assays on one platform GenomeLab GeXP Genetic Analysis System Blood Banking Capillary Electrophoresis Centrifugation Flow Cytometry Genomics Lab Automation Lab Tools

More information

How To Use An Enzymatics Spark Dna Sample Prep Kit For Ion Torrent

How To Use An Enzymatics Spark Dna Sample Prep Kit For Ion Torrent SPARK DNA Sample Prep Kit Ion Torrent (SPK0002-V08) Frequently Asked Questions Under what circumstances would I use SPARK DNA Sample Prep Kit for Ion Torrent? Enzymatics SPARK DNA Sample Prep Kit for Ion

More information

Agencourt AMPure XP. Xtra Performance Post-PCR clean UP

Agencourt AMPure XP. Xtra Performance Post-PCR clean UP Agencourt AMPure XP Xtra Performance Post-PCR clean UP Applications o PCR o Genotyping, SNP detection o Fragment analysis o Sequencing (Sanger and Next generation) o Cloning o Primer walking Agencourt

More information

PreciseTM Whitepaper

PreciseTM Whitepaper Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis

More information

Universidade Estadual de Maringá

Universidade Estadual de Maringá Universidade Estadual de Maringá Disciplina: Biologia Molecular Sequenciamento de ácidos nucléicos Profa. Dra. Maria Aparecida Fernandez Maxan e Gilbert - quebra química Berg, Gilbert and Sanger dideoxinucleotideos

More information

Automated DNA sequencing 20/12/2009. Next Generation Sequencing

Automated DNA sequencing 20/12/2009. Next Generation Sequencing DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing

More information

Cluster Generation. Module 2: Overview

Cluster Generation. Module 2: Overview Cluster Generation Module 2: Overview Sequencing Workflow Sample Preparation Cluster Generation Sequencing Data Analysis 2 Cluster Generation 3 5 DNA (0.1-5.0 μg) Library preparation Single Cluster molecule

More information

Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office

Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office 2013 Laboratory Accreditation Program Audioconferences and Webinars Implementing Next Generation Sequencing (NGS) as a Clinical Tool in the Laboratory Nazneen Aziz, PhD Director, Molecular Medicine Transformation

More information

TruSeq Custom Amplicon v1.5

TruSeq Custom Amplicon v1.5 Data Sheet: Targeted Resequencing TruSeq Custom Amplicon v1.5 A new and improved amplicon sequencing solution for interrogating custom regions of interest. Highlights Figure 1: TruSeq Custom Amplicon Workflow

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing 38. Informationsgespräch der Blutspendezentralefür Wien, Niederösterreich und Burgenland Österreichisches Rotes Kreuz 22. November 2014, Parkhotel Schönbrunn Die Zukunft hat

More information

SUPPLEMENTARY METHODS

SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS Description of parameter selection for the automated calling algorithm The first analyses of the HLA data were performed with the haploid cell lines described by Horton et al. (1).

More information

Genomic DNA detection assay

Genomic DNA detection assay Genomic DNA detection assay Detection of genomic DNA by real-time PCR Contents CTRL Internal controls and gdna detection Contents Kit Contents 3 Reagents and Equipment to Be Supplied by User 3 Kit Storage

More information

TruSeq DNA Methylation Library Preparation Guide

TruSeq DNA Methylation Library Preparation Guide TruSeq DNA Methylation Library Preparation Guide Kit Contents 3 Consumables and Equipment 4 Preparation 5 Quality Control of Bisulfite-Converted DNA 6 TruSeq DNA Methylation Kit Protocol 7 Sequencing the

More information

Human Leukocyte Antigens - HLA

Human Leukocyte Antigens - HLA Human Leukocyte Antigens - HLA Human Leukocyte Antigens (HLA) are cell surface proteins involved in immune function. HLA molecules present antigenic peptides to generate immune defense reactions. HLA-class

More information

BIOO LIFE SCIENCE PRODUCTS

BIOO LIFE SCIENCE PRODUCTS BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit

More information

DNA Sequence Analysis

DNA Sequence Analysis DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide

More information

Single-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples

Single-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples DATA Sheet Single-Cell DNA Sequencing with the C 1 Single-Cell Auto Prep System Reveal hidden populations and genetic diversity within complex samples Single-cell sensitivity Discover and detect SNPs,

More information

Introduction Bioo Scientific

Introduction Bioo Scientific Next Generation Sequencing Catalog 2014-2015 Introduction Bioo Scientific Bioo Scientific is a global life science company headquartered in Austin, TX, committed to providing innovative products and superior

More information

BacReady TM Multiplex PCR System

BacReady TM Multiplex PCR System BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental

More information

NGS data analysis. Bernardo J. Clavijo

NGS data analysis. Bernardo J. Clavijo NGS data analysis Bernardo J. Clavijo 1 A brief history of DNA sequencing 1953 double helix structure, Watson & Crick! 1977 rapid DNA sequencing, Sanger! 1977 first full (5k) genome bacteriophage Phi X!

More information

HISTOCOMPATIBILITY. and IMMUNOGENETICS. Prospectus

HISTOCOMPATIBILITY. and IMMUNOGENETICS. Prospectus HISTOCOMPATIBILITY and IMMUNOGENETICS Prospectus 2014 CONTENTS Page 1. Distribution Timetable 2 2. Confidentiality 2 3. Participation 2 3.1 Registration 2 3.2 Service s Expectations 2 3.3 Guidance on Participation

More information

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing

More information

Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing

Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAAC GTGCAC GTGAAC Wouter Coppieters Head of the genomics core facility GIGA center, University of Liège Bioruptor NGS: Unbiased DNA

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

GenScript BloodReady TM Multiplex PCR System

GenScript BloodReady TM Multiplex PCR System GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI

More information

Description: Molecular Biology Services and DNA Sequencing

Description: Molecular Biology Services and DNA Sequencing Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:

More information

The RNAi Consortium (TRC) Broad Institute

The RNAi Consortium (TRC) Broad Institute TRC Laboratory Protocols Protocol Title: One Step PCR Preparation of Samples for Illumina Sequencing Current Revision Date: 11/10/2012 RNAi Platform,, [email protected] Brief Description: This

More information

Concepts and methods in sequencing and genome assembly

Concepts and methods in sequencing and genome assembly BCM-2004 Concepts and methods in sequencing and genome assembly B. Franz LANG, Département de Biochimie Bureau: H307-15 Courrier électronique: [email protected] Outline 1. Concepts in DNA and RNA

More information

Targeted. sequencing solutions. Accurate, scalable, fast TARGETED

Targeted. sequencing solutions. Accurate, scalable, fast TARGETED Targeted TARGETED Sequencing sequencing solutions Accurate, scalable, fast Sequencing for every lab, every budget, every application Ion Torrent semiconductor sequencing Ion Torrent technology has pioneered

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

Handling next generation sequence data

Handling next generation sequence data Handling next generation sequence data a pilot to run data analysis on the Dutch Life Sciences Grid Barbera van Schaik Bioinformatics Laboratory - KEBB Academic Medical Center Amsterdam Very short intro

More information

Molecular and Cell Biology Laboratory (BIOL-UA 223) Instructor: Ignatius Tan Phone: 212-998-8295 Office: 764 Brown Email: ignatius.tan@nyu.

Molecular and Cell Biology Laboratory (BIOL-UA 223) Instructor: Ignatius Tan Phone: 212-998-8295 Office: 764 Brown Email: ignatius.tan@nyu. Molecular and Cell Biology Laboratory (BIOL-UA 223) Instructor: Ignatius Tan Phone: 212-998-8295 Office: 764 Brown Email: [email protected] Course Hours: Section 1: Mon: 12:30-3:15 Section 2: Wed: 12:30-3:15

More information

AxyPrep TM Mag PCR Clean-up Protocol

AxyPrep TM Mag PCR Clean-up Protocol AxyPrep TM Mag PCR Clean-up Protocol Intro The AxyPrep Mag PCR Clean-up kit utilizes a unique paramagnetic bead technology for rapid, high-throughput purification of PCR amplicons. Using this kit, PCR

More information

Real-time quantitative RT -PCR (Taqman)

Real-time quantitative RT -PCR (Taqman) Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR

More information

NimbleGen SeqCap EZ Library SR User s Guide Version 3.0

NimbleGen SeqCap EZ Library SR User s Guide Version 3.0 NimbleGen SeqCap EZ Library SR User s Guide Version 3.0 For life science research only. Not for use in diagnostic procedures. Copyright 2011 Roche NimbleGen, Inc. All Rights Reserved. Editions Version

More information

4. GS Reporter Application 65

4. GS Reporter Application 65 Data Processing B Table of Contents Part B: Data Processing 2. GS Sequencer (Output Only; Not a DataRig Application) 42 2.1 GS Sequencer Application Output...42 2.1.1 datarunparams.parse...43 2.1.2 imagelog.parse...44

More information

Rapid DNA Analysis DNA: the Ultimate Biometric? Advances in Molecular Processing and Analysis

Rapid DNA Analysis DNA: the Ultimate Biometric? Advances in Molecular Processing and Analysis Rapid DNA Analysis DNA: the Ultimate Biometric? Advances in Molecular Processing and Analysis Presentation at NSF Workshop on Fundamental Research Challenges for Trustworthy Biometrics Dr. Joan Bienvenue

More information

Illumina Sequencing Technology

Illumina Sequencing Technology Illumina Sequencing Technology Highest data accuracy, simple workflow, and a broad range of applications. Introduction Figure 1: Illumina Flow Cell Illumina sequencing technology leverages clonal array

More information

HISTO TYPE SSP Immunogenetic Diagnostics. Robust and fast - validated Taq Polymerase included

HISTO TYPE SSP Immunogenetic Diagnostics. Robust and fast - validated Taq Polymerase included HISTO TYPE SSP Immunogenetic Diagnostics Robust and fast - validated Taq Polymerase included BAG Health Care the experts for HLA and blood group diagnostics HISTO TYPE SSP Diagnostics Highly standardised

More information

SOLID PHASE REVERSIBLE IMMOBILIZATION HIGH PERFORMANCE NUCLEIC ACID ISOLATION AND PURIFICATION

SOLID PHASE REVERSIBLE IMMOBILIZATION HIGH PERFORMANCE NUCLEIC ACID ISOLATION AND PURIFICATION R-BR5Y94 Agencourt SPRI Technology with Beckman Coulter Automation SOLID PHASE REVERSIBLE IMMOBILIZATION SOLID PHASE REVERSIBLE IMMOBILIZATION What Agencourt SPRI Is Solid Phase Reversible Immobilization

More information

Application Note. Single Cell PCR Preparation

Application Note. Single Cell PCR Preparation Application Note Single Cell PCR Preparation From Automated Screening to the Molecular Analysis of Single Cells The AmpliGrid system is a highly sensitive tool for the analysis of single cells. In combination

More information

EFI ACCREDITATION PROGRAM. INSTRUCTIONS TO APPLICANT - PACKET A and C: APPLICATION FOR ACCREDITATION AND RENEWAL OF ACCREDITATION

EFI ACCREDITATION PROGRAM. INSTRUCTIONS TO APPLICANT - PACKET A and C: APPLICATION FOR ACCREDITATION AND RENEWAL OF ACCREDITATION EFI ACCREDITATION PROGRA INSTRUCTIONS TO APPLICANT - PACKET A and C: APPLICATION FOR ACCREDITATION AND RENEWAL OF ACCREDITATION Please read all instructions carefully and review the enclosed EFI standards

More information

Automated Nucleic Acid Extraction WorkStation Faster, cleaner,

Automated Nucleic Acid Extraction WorkStation Faster, cleaner, Automated Nucleic Acid Extraction WorkStation Faster, cleaner, more consistent nucleic acid extraction The Thermo Scientific Automated Nucleic Acid Extraction WorkStation is a turn-key solution that provides

More information

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,

More information

510K Summary. This summary of 510(k) safety and effectiveness information is being submitted in accordance with the requirements of 21 CFR 807.92.

510K Summary. This summary of 510(k) safety and effectiveness information is being submitted in accordance with the requirements of 21 CFR 807.92. 510K Summary This summary of 510(k) safety and effectiveness information is being submitted in accordance with the requirements of 21 CFR 807.92. Submitter: Contact: One Lambda, Incorporated 21001 Kittridge

More information

Single Nucleotide Polymorphisms (SNPs)

Single Nucleotide Polymorphisms (SNPs) Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded

More information

Welcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation.

Welcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation. Introduction to SMRTbell Template Preparation 100 338 500 01 1. SMRTbell Template Preparation 1.1 Introduction to SMRTbell Template Preparation Welcome to Pacific Biosciences' Introduction to SMRTbell

More information

GeneXpert Technology. Indira Soundiram 2012

GeneXpert Technology. Indira Soundiram 2012 GeneXpert Technology Indira Soundiram 2012 A Better Way to Platform Design GeneXpert Infinity-48 GeneXpert Module GX-I GX-II GX-IV GX-XVI 2 Defining Molecular Diagnostics Any Test Any Time Any Sample Any

More information

Application Guide... 2

Application Guide... 2 Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied

More information

Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit

Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit Product Bulletin Human Identification Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit The Quantifiler kits produce reliable and reproducible results, helping to

More information

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research March 17, 2011 Rendez-Vous Séquençage Presentation Overview Core Technology Review Sequence Enrichment Application

More information

ChIP TROUBLESHOOTING TIPS

ChIP TROUBLESHOOTING TIPS ChIP TROUBLESHOOTING TIPS Creative Diagnostics Abstract ChIP dissects the spatial and temporal dynamics of the interactions between chromatin and its associated factors CD Creative Diagnostics info@creative-

More information

Development of a Workflow to Detect Sequence Variants in the BRCA1 and BRCA2 Genes

Development of a Workflow to Detect Sequence Variants in the BRCA1 and BRCA2 Genes Your Innovative Research BRCA1 and BRCA2 Variant Detection Development of a Workflow to Detect Sequence Variants in the BRCA1 and BRCA2 Genes The oncogenetics group in the DNA Diagnostics division of the

More information

How To Get Rid Of Small Dna Fragments

How To Get Rid Of Small Dna Fragments AxyPrep TM Mag FragmentSelect-I Protocol (Fragment Size Selection for Illumina Genome Analyzer and Life Technologies SoLiD) Introduction The AxyPrep Mag FragmentSelect-I purification kit utilizes a unique

More information

Next Generation Sequencing for DUMMIES

Next Generation Sequencing for DUMMIES Next Generation Sequencing for DUMMIES Looking at a presentation without the explanation from the author is sometimes difficult to understand. This document contains extra information for some slides that

More information

ab185916 Hi-Fi cdna Synthesis Kit

ab185916 Hi-Fi cdna Synthesis Kit ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1

More information

Enhancing PCR & STR Experiments. Sharron Ohgi Senior Research Associate [email protected]

Enhancing PCR & STR Experiments. Sharron Ohgi Senior Research Associate sohgi@biomatrica.com Enhancing PCR & STR Experiments Sharron Ohgi Senior Research Associate [email protected] Outline PCR experiments Sample challenges Introducing Biomatrica s PCRboost o Performance examples o Summary

More information

LightCycler 480 Real-Time PCR System

LightCycler 480 Real-Time PCR System Roche Applied Science LightCycler 480 Real-Time PCR System Planned introduction of the LightCycler 480 System: September 2005 Rapid by nature, accurate by design The LightCycler 480 Real-Time PCR System

More information

Services. Updated 05/31/2016

Services. Updated 05/31/2016 Updated 05/31/2016 Services 1. Whole exome sequencing... 2 2. Whole Genome Sequencing (WGS)... 3 3. 16S rrna sequencing... 4 4. Customized gene panels... 5 5. RNA-Seq... 6 6. qpcr... 7 7. HLA typing...

More information

USER GUIDE. Encore PART NOS. 8041 and 8042. SP Rapid Library Systems

USER GUIDE. Encore PART NOS. 8041 and 8042. SP Rapid Library Systems USER GUIDE Encore PART NOS. 8041 and 8042 SP Rapid Library Systems Patents, Licensing and Trademarks 2012 2013 NuGEN Technologies, Inc. All rights reserved. The Encore, Ovation and Applause families of

More information

BR-10150B. Bringing power and flexibility down to size. BIOMEK NX LABORATORY AUTOMATION WORKSTATION

BR-10150B. Bringing power and flexibility down to size. BIOMEK NX LABORATORY AUTOMATION WORKSTATION BR-10150B Bringing power and flexibility down to size. BIOMEK NX P LABORATORY AUTOMATION WORKSTATION Small footprint Easy fit on standard lab benches Many configurations to suit application needs Biomek

More information

Analysis of mixtures using next generation sequencing of mitochondrial DNA hypervariable regions

Analysis of mixtures using next generation sequencing of mitochondrial DNA hypervariable regions 208 FORENSIC SCIENCE Croat Med J. 2015;56:208-17 doi: 10.3325/cmj.2015.56.208 Analysis of mixtures using next generation sequencing of mitochondrial DNA hypervariable regions Hanna Kim 1, Henry A. Erlich

More information

Reliable PCR Components for Molecular Diagnostic Assays

Reliable PCR Components for Molecular Diagnostic Assays Reliable PCR Components for Molecular Diagnostic Assays Terri McDonnell, MBA, PMP Senior Program Manager, Molecular Diagnostics March 2014 In this webinar we will: Discuss requirements for amplification

More information

Next Generation Sequencing: Technology, Mapping, and Analysis

Next Generation Sequencing: Technology, Mapping, and Analysis Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University [email protected] http://tandem.bu.edu/ The Human Genome Project took

More information

Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011

Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011 Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)

More information

TCRG TCRA/D IGH IGK/L

TCRG TCRA/D IGH IGK/L Assays immunoseq Assay The inquiry to insight solution for profiling T- and B-cell s Immunosequencing solutions for multiple species and loci Illuminate the adaptive immune system with bias-controlled

More information

The Danish Bone Marrow Donor Registry DBMDR

The Danish Bone Marrow Donor Registry DBMDR The DBMDR Vision To achieve and maintain a position as an internationally recognized hematopoietic stem cell donor registry with respect to high quality of donor data base and HLA typing, individualized,

More information

NGS Technologies for Genomics and Transcriptomics

NGS Technologies for Genomics and Transcriptomics NGS Technologies for Genomics and Transcriptomics Massimo Delledonne Department of Biotechnologies - University of Verona http://profs.sci.univr.it/delledonne 13 years and $3 billion required for the Human

More information

Idaho Technology Food Security Systems. System Components. Idaho Technology. Food Security and Pathogen Detection

Idaho Technology Food Security Systems. System Components. Idaho Technology. Food Security and Pathogen Detection Incorporated in 1990, has years of experience developing exciting instruments, software at Inc. Part of s Incorporated in 1990, has years of experience developing exciting instruments, software at Inc.

More information

Easy Collection and Extraction of BioSamples Ahlstrom GenCollect Ahlstrom GenCollect Color

Easy Collection and Extraction of BioSamples Ahlstrom GenCollect Ahlstrom GenCollect Color Easy Collection and Extraction of BioSamples Ahlstrom GenCollect Ahlstrom GenCollect Color Ahlstrom GenCollect and Ahlstrom GenCollect Color Collection of biosamples COST Storage at ambient temperature

More information

Algorithms for Next Generation Sequencing Data Analysis

Algorithms for Next Generation Sequencing Data Analysis UNIVERSITÀ DEGLI STUDI DI MILANO - BICOCCA FACOLTÀ DI SCIENZE MATEMATICHE, FISICHE E NATURALI DIPARTIMENTO DI INFORMATICA, SISTEMISTICA E COMUNICAZIONE DOTTORATO DI RICERCA IN INFORMATICA - CICLO XXV Ph.D.

More information

Bioanalyzer Applications for

Bioanalyzer Applications for Bioanalyzer Applications for Next-Gen Sequencing: Updates and Tips March 1 st, 2011 Charmian Cher, Ph.D Field Applications Scientist Page 1 Agenda 1 2 3 Next-gen sequencing library preparation workflow

More information

HBV Quantitative Real Time PCR Kit

HBV Quantitative Real Time PCR Kit Revision No.: ZJ0002 Issue Date: Aug 7 th, 2008 HBV Quantitative Real Time PCR Kit Cat. No.: HD-0002-01 For Use with LightCycler 1.0/LightCycler2.0/LightCycler480 (Roche) Real Time PCR Systems (Pls ignore

More information