Overview of Next Generation Sequencing platform technologies

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Overview of Next Generation Sequencing platform technologies"

Transcription

1 Overview of Next Generation Sequencing platform technologies Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany

2 Outline 1. Technologies Illumina Roche / Projects and Applications whole Genome Re-sequencing Sequence Capture Amplicon Sequencing 3. Outlook

3 Max Planck Society 80 institutes and research facilities 20,435 people Budget 1,400 million euro in 2010 Max Planck Institute for molecular Genetics

4 Development of Sequencing Throughput Throughput per system [kilobases/day] 1000,000, ,000,000 10,000,000 1,000, , , Gel-based Systems Capillary Sequencing First Generation Capillary Sequencer Next Generation Sequencing Short-Read Sequencer Microwell Pyrosequencing Second Generation Capillary Sequencer Year Modified after MR Stratton et al. Nature 458, (2009)

5 Development of Sequencing Technologies Human Genome Project 1000 Genomes Project 96 sequences in parallel 3.2 billions of sequences per run

6 Sequencing Capacities at the MPI-MG 7 x Illumina 5 x Roche GS 3 x SOLiD 3 x Capillary Systems

7 IT Infrastructure Short Read Technologies TB GB Long Read Technologies 25 x 32 (64) Compute Server with 128 (512 GB) RAM 4 peta byte Storage Capacity

8 Technologies 1. Technologies Illumina Roche / Projects and Applications whole Genome Re-sequencing Sequence Capture Amplicon Sequencing 3. Outlook

9 Genome Sequencer FLX HiSeq 2000/ SOLiD de novo Sequencing Metagenome Analyses Amplicon Sequencing Full length Transcriptome Analyses Sequencing of target regions ChipSeq MeDipSeq mirna RNAseq Sequencing of target regions Whole genome resequencing

10 Principle Illumina Sequencing Library Preparation Cluster Generation Attachement of single molecules to surface Amplification to form clusters

11 3 5 Sequencing by Synthesis (SBS) Cycle 1: Add sequencing reagents A T C A G T C T G C T A C G A First base incorporated Remove unincorporated bases Detect signal Cycle 2-n: Add sequencing reagents and repeat G T C A G T A C C C G A T C G A T 5

12 Conversion of image data to DNA sequences Sequence Reads TCGGGAGTCCTAATGAGCCCGTAATCCCGTTAGTA TGAAGTCGGGAGTCCTAATGAGCCCGTAATCCCGTT CGAATGAAGTCGGGAGTCCTAATGAGCCCGTAATCC GAGCGAATGAAGTCGGGAGTCCTAATGAGCCCGTAA CGAGCGAATGAAGTCGGGAGTCCTAATGAGCCCGTA Referenzsequenz...CGAGCGAATGAAGTCGGGAGTCGTAATGAGCCCGTAATCCCGTTAGTA...

13 Facts Illumina Sequencing (HiSeq 2000) Input Material: Library Preparation: ~ 1.5 days Cluster Generation: ~ 1-3 µg DNA shotgun Sequencing ~ 10 ng ChipSeq Sequencing ~ 1 day Run Time/ Single read ~ 2 days (36 b) Read Length: Paired End ~ 10 days (2 x 100 b) Data Processing: ~ 1 day Output: Reads: Paired End ~ 500 Gb up to 4800 Mio

14 454 Sequencing Instrument 2. Load PicoTiter plate into instrument 3. Load Reagents in a single rack 4. Sequencing 1. Genome is loaded into a PicoTiter plate

15 Principle 454 Sequencing Emulsion Breaking Library Preparation Emulsion PCR Depositing DNA Beads into the PicoTiter Plate Pyrosequencing

16 Facts 454 Sequencing Input Material: Library Preparation : Emulsion PCR: Run Time: Data Processing: Output: ~ 0.5 µg DNA ~ 4 hours ~ 1 day 20 hours ~ 10 hours Titanium MB Reads: Titanium Read length: bases

17 Sequencing Pipeline Library Quantification Library Preparation Sequencing Bead Enrichment

18 Projects and Applications 1. Technologies Illumina Roche / Projects and Applications whole Genome Re-sequencing Sequence Capture Amplicon Sequencing 3. Outlook

19 Goals A public database of essentially all SNPs and detectable CNVs with allele frequency >1% in each of multiple human population samples Pioneer and evaluate methods for: Generating data from next-generation sequencing platforms Exchanging and combining data and analytical methods Discovering and genotyping SNPs and CNVs from nextgen data Imputation with and from next generation sequencing data 454, Illumina and AB SOLiD platforms Academic genome centers in US, UK, Germany, China and platform companies (Nature 2010, Science 2010 and Nature 2011)

20 OncoTrack, Methods for systematic next generation oncology biomarker development, is an international consortium of over 60 scientists, that has launched one of Europe s largest collaborative academicindustry research projects to develop and assess novel approaches for identification of new markers for colon cancer.

21 Protein Cell lines Tissues Mutations Methylation DNA mrna RNA mirna Sequencing Bioinformatics

22 total RNA Isolation RNAseq small RNA Depletion Mapping quality control dsdna generation using random hexamers expression profiling Illumina library preparation massive parallel sequencing

23 Sequence Capture GWAS Candidate Genes Whole Exome MB 35 MB 385 k Array, Nimblegen In-solution Enrichment 2.1 Mio Array, Nimblegen In-solution Enrichment

24 Targeted Resequencing: Project outline Identification patients Sample preparation Sequence capture Work-flow Next-Gen sequencing Functional characterization Follow-up sequencing Bioinformatics

25 Principle of sequence capture DNA Preparation Enrichment of target regions Sequencing genomic DNA Hybridization Fragments ( bp) Selection with streptavidin beads Ligation of adapters A1 SP1 Amplification and Quantification A2

26 Cleft lip with or without cleft palate (CL/P) Cooperation with M. Nöthen and E. Mangold Epidemiology of nonsyndromic CL/P Prevalence among live births ~ 1 : Risk for siblings 1 : 20 1 : 25 λ s Mangold E. et al. (2010), Nature Genetics

27 Cleft lip with or without cleft palate (CL/P) Resequencing as follow up of GWAS 3 Loci on chr 8 (640Kb), 10 (161Kb) and 17 (340Kb) in 20 affected individuals MID tagging and pooling of 10 samples Enrichment using the 2.1M NimbleGen array Sequencing on a Roche GS FLX system

28 Mapping

29 Cleft lip with or without cleft palate (CL/P) Preliminary Results unique variants (>10 x Coverage) variants not listed in dbsnp (hg19) 4 coding Variants Detection of structural Variations not yet finished

30 Mutation detection pipeline quality Concordance with Affymetrix Array "genome-wide human SNP array 6.0"

31 Amplicon Sequencing Aim Detection and quantification of new and known variants METHOD Amplification and sequencing of target regions Multiple alignments of sequences against a reference reference patient sequences

32 Amplicon Sequencing A A-primer (21 bp) key MID Sequence of interest Locus specific PCR amplification MID key B B-primer (21 bp) empcr Amplification and sequencing Long reads required to sequence through the locus specific primer, enable haplotyping over longer distances 100s to 1000s of amplicon clones sequenced simultaneously

33 Amplicon Sequencing IRON Study Interlaboratory Robustness of NGS

34 Amplicon Sequencing IRON Study Hematology Focus Group

35 Amplicon Sequencing IRON Study Results per each amplicon, the median coverage eached was 713-fold, ranging from 553-fold to 878-fold a total of 92 variants (44 distinct mutations and 10 SNPs) were observed in comparison to data available from Sanger sequencing, 454 amplicon deep-sequencing detected all mutations and SNPs that were previously known we here confirm in a multicenter analysis that ampliconbased deep-sequencing is technically feasible, achieves a high concordance across multiple laboratories, and therefore allows a broad and in-depth molecular characterization of hematological malignancies. Kohlmann et al. (2011), Leukemia

36 Sensitivity of mutation detection as a function of tumor cell content Querings et al. (2011), PlosOne

37 Outlook Establishment of small scale NGS systems Analysis of complete genomes Personalized medicine

38 Acknowledgments Sequencing Facility: Ilona Hauenschild Sonia Paturej Tina Moser Ina Lehmann Norbert Merges Daniela Roth Sabrina Rau Heiner Kuhl Sven Klages Martin Werber Hans Lehrach Bernhard Herrmann Hilger Ropers Martin Vingron Michal Schweiger Martin Kerick Markus Ralser

39 Thanks for your attention!

Next Generation Sequencing I: Technologies. Jim Noonan Department of Genetics

Next Generation Sequencing I: Technologies. Jim Noonan Department of Genetics Next Generation Sequencing I: Technologies Jim Noonan Department of Genetics Sequence as the readout for biological processes Determining the biological state of cells, tissues and organisms requires the

More information

Next Gen Sequencing Summary of the short course Next Gen Sequencing at Avans hogeschool, Breda. 24/04/2013 Next gen Sequencing technologies

Next Gen Sequencing Summary of the short course Next Gen Sequencing at Avans hogeschool, Breda. 24/04/2013 Next gen Sequencing technologies Next Gen Sequencing Summary of the short course Next Gen Sequencing at Avans hogeschool, Breda 24/04/2013 Next gen Sequencing technologies 1 2nd Gen Sequencing Summary of the short course Next Gen Sequencing

More information

Introduction to NGS Technologies

Introduction to NGS Technologies Introduction to NGS Technologies Ignacio Medina im411@cam.ac.uk Head of Computational Biology Lab HPC Service, University of Cambridge, UK EMBL-EBI Scientific collaborator Genome Campus, Hinxton, Cambridge,

More information

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long

More information

SOLUTIONS FOR NEXT-GENERATION SEQUENCING

SOLUTIONS FOR NEXT-GENERATION SEQUENCING SOLUTIONS FOR NEXT-GENERATION SEQUENCING GENOMICS CELL BIOLOGY PROTEOMICS AUTOMATION enabling next-generation research From Samples To Publication, Millennium Science Enables Your Next-Gen Sequencing Workflow

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Molecular Methods Sylvain Forêt March 2010 http://dayhoff.anu.edu.au/~sf/next_gen_seq 1 Introduction 2 Sanger 3 Illumina 4 454 5 SOLiD 6 Summary The Genomic Age Recent landmarks

More information

Next generation DNA sequencing technologies. theory & prac-ce

Next generation DNA sequencing technologies. theory & prac-ce Next generation DNA sequencing technologies theory & prac-ce Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing

More information

G E N OM I C S S E RV I C ES

G E N OM I C S S E RV I C ES GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E

More information

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research March 17, 2011 Rendez-Vous Séquençage Presentation Overview Core Technology Review Sequence Enrichment Application

More information

Automated DNA sequencing 20/12/2009. Next Generation Sequencing

Automated DNA sequencing 20/12/2009. Next Generation Sequencing DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing

More information

July 7th 2009 DNA sequencing

July 7th 2009 DNA sequencing July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Matthew D. Clark PhD Group leader Genomics, The Genome Analysis Centre Norwich, UK Costs & disrup,ve technologies 454 & polony Solexa & SOLiD End of the gold rush? GAII HiSeq

More information

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

Introduction to next-generation sequencing data

Introduction to next-generation sequencing data Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS

More information

COURSE OF BIOINFORMATICS

COURSE OF BIOINFORMATICS COURSE OF BIOINFORMATICS a.a. 2015-2016 Bioinformatic Analysis of Next Generation Sequencing Data What is massively parallel sequencing? Next-generation sequencing (NGS), also known as high-throughput

More information

SEQUENCING. From Sample to Sequence-Ready

SEQUENCING. From Sample to Sequence-Ready SEQUENCING From Sample to Sequence-Ready ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES, NOT ONCE, BUT EVERY TIME The highest-quality amplicons more sensitive, accurate, and specific Full support for all major

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977

More information

History of DNA Sequencing & Current Applications

History of DNA Sequencing & Current Applications History of DNA Sequencing & Current Applications Christopher McLeod President & CEO, 454 Life Sciences, A Roche Company IMPORTANT NOTICE Intended Use Unless explicitly stated otherwise, all Roche Applied

More information

Next Generation Sequencing. Tobias Österlund

Next Generation Sequencing. Tobias Österlund Next Generation Sequencing Tobias Österlund tobiaso@chalmers.se NGS part of the course Week 4 Friday 12/2 15.15-17.00 NGS lecture 1: Introduction to NGS, alignment, assembly Week 6 Thursday 25/2 08.00-09.45

More information

Core Facility Genomics

Core Facility Genomics Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray

More information

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,

More information

Data Analysis for Ion Torrent Sequencing

Data Analysis for Ion Torrent Sequencing IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page

More information

NGS data analysis. Bernardo J. Clavijo

NGS data analysis. Bernardo J. Clavijo NGS data analysis Bernardo J. Clavijo 1 A brief history of DNA sequencing 1953 double helix structure, Watson & Crick! 1977 rapid DNA sequencing, Sanger! 1977 first full (5k) genome bacteriophage Phi X!

More information

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing

More information

BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls?

BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? Giovanni Luca Scaglione, PhD ------------------------ Laboratory of Clinical Molecular Diagnostics and Personalized Medicine, Institute

More information

Equipment Price Units. Synergy HT Multi-Detection Microplate Reader

Equipment Price Units. Synergy HT Multi-Detection Microplate Reader Equipment Run Charges Equipment Price Units ABI 7900HT Real-time PCR $20.00 per run Agilent Bioanalyzer 2100 $12.00 per run Auto MACs $10.00 per Genome Sequencer FLX 454 $1,000.00 per run Gentle MACs Dissociator

More information

DNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute for Age Research - Fritz Lipmann Institute (FLI)

DNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute for Age Research - Fritz Lipmann Institute (FLI) DNA-Sequencing Technologies & Devices Matthias Platzer Genome Analysis Leibniz Institute for Age Research - Fritz Lipmann Institute (FLI) Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006

More information

Single-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples

Single-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples DATA Sheet Single-Cell DNA Sequencing with the C 1 Single-Cell Auto Prep System Reveal hidden populations and genetic diversity within complex samples Single-cell sensitivity Discover and detect SNPs,

More information

Genomics Services @ GENterprise

Genomics Services @ GENterprise Genomics Services @ GENterprise since 1998 Mainz University spin-off privately financed 6-10 employees since 2006 Genomics Services @ GENterprise Sequencing Service (Sanger/3730, 454) Genome Projects (Bacteria,

More information

The Digital Biology TM. Company. Targeted DNA Sequencing Solutions It Pays To Be On Target

The Digital Biology TM. Company. Targeted DNA Sequencing Solutions It Pays To Be On Target The Digital Biology TM Company Targeted DNA Sequencing Solutions It Pays To Be On Target Proven Platform RainDance TM Technologies is pioneering digital biology and powering ground-breaking human genetics

More information

Services. Updated 05/31/2016

Services. Updated 05/31/2016 Updated 05/31/2016 Services 1. Whole exome sequencing... 2 2. Whole Genome Sequencing (WGS)... 3 3. 16S rrna sequencing... 4 4. Customized gene panels... 5 5. RNA-Seq... 6 6. qpcr... 7 7. HLA typing...

More information

INTRODUCTION TO NEXT-GENERATION SEQUENCING

INTRODUCTION TO NEXT-GENERATION SEQUENCING INTRODUCTION TO NEXT-GENERATION SEQUENCING Louis Letourneau, eng. and Mathieu Bourgey, Ph.D CAGEKID Cancer Genomics Workshop March 18 th - 21 st CAGEKID M12 Meeting - 6 May 2011 My work Many facets of

More information

Introduction To Epigenetic Regulation: How Can The Epigenomics Core Services Help Your Research? Maria (Ken) Figueroa, M.D. Core Scientific Director

Introduction To Epigenetic Regulation: How Can The Epigenomics Core Services Help Your Research? Maria (Ken) Figueroa, M.D. Core Scientific Director Introduction To Epigenetic Regulation: How Can The Epigenomics Core Services Help Your Research? Maria (Ken) Figueroa, M.D. Core Scientific Director Gene expression depends upon multiple factors Gene Transcription

More information

14/12/2012. HLA typing - problem #1. Applications for NGS. HLA typing - problem #1 HLA typing - problem #2

14/12/2012. HLA typing - problem #1. Applications for NGS. HLA typing - problem #1 HLA typing - problem #2 www.medical-genetics.de Routine HLA typing by Next Generation Sequencing Kaimo Hirv Center for Human Genetics and Laboratory Medicine Dr. Klein & Dr. Rost Lochhamer Str. 9 D-8 Martinsried Tel: 0800-GENETIK

More information

Sequencing power for every scale. Systems for every application, for every lab.

Sequencing power for every scale. Systems for every application, for every lab. Sequencing power for every scale. Systems for every application, for every lab. Proven sequencing technology. Accelerate your research. Achieve your next breakthrough. What started as novel Illumina chemistry,

More information

Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office

Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office 2013 Laboratory Accreditation Program Audioconferences and Webinars Implementing Next Generation Sequencing (NGS) as a Clinical Tool in the Laboratory Nazneen Aziz, PhD Director, Molecular Medicine Transformation

More information

Introduction to Illumina Next Generation Sequencing Technology

Introduction to Illumina Next Generation Sequencing Technology The Nancy and Stephen Grand Israel National Center for Personalized Medicine (G-INCPM) Introduction to Illumina Next Generation Sequencing Technology Shmulik Motola, PhD March 2016 DNA Sequencing a process

More information

New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova

New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova New generation sequencing: current limits and future perspectives Giorgio Valle CRIBI Università di Padova Around 2004 the Race for the 1000$ Genome started A few questions... When? How? Why? Standard

More information

GS Junior System The power of next-generation sequencing in your hands

GS Junior System The power of next-generation sequencing in your hands GS Junior System The power of next-generation sequencing in your hands A Complete Sequencing Solution All on your benchtop The GS Junior System includes: GS Junior Instrument, high-performance desktop

More information

Overview. KAPAHiFi HotStart is the engineered KAPAHiFi DNA Polymerase with an antibody-based hot start technology and improved buffer system.

Overview. KAPAHiFi HotStart is the engineered KAPAHiFi DNA Polymerase with an antibody-based hot start technology and improved buffer system. Overview KAPAHiFi HotStart is the engineered KAPAHiFi DNA Polymerase with an antibody-based hot start technology and improved buffer system. KAPAHiFi HotStart exhibits: World leading fidelity confirmed

More information

The author(s) shown below used Federal funds provided by the U.S. Department of Justice and prepared the following final report:

The author(s) shown below used Federal funds provided by the U.S. Department of Justice and prepared the following final report: The author(s) shown below used Federal funds provided by the U.S. Department of Justice and prepared the following final report: Document Title: Author(s): Resolution of DNA Mixtures and Analysis of Degraded

More information

PLNT2530 Unit 6e DNA Sequencing

PLNT2530 Unit 6e DNA Sequencing PLNT2530 Unit 6e DNA Sequencing Unless otherwise cited or referenced, all content of this presenataion is licensed under the Creative Commons License Attribution Share-Alike 2.5 Canada 1 High-throughput

More information

New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.

New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc. New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System

More information

PreciseTM Whitepaper

PreciseTM Whitepaper Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis

More information

Targeted. sequencing solutions. Accurate, scalable, fast TARGETED

Targeted. sequencing solutions. Accurate, scalable, fast TARGETED Targeted TARGETED Sequencing sequencing solutions Accurate, scalable, fast Sequencing for every lab, every budget, every application Ion Torrent semiconductor sequencing Ion Torrent technology has pioneered

More information

Ankyrin 3 Genetic Association Studies of Bipolar Disorders

Ankyrin 3 Genetic Association Studies of Bipolar Disorders Ankyrin 3 Genetic Association Studies of Bipolar Disorders Wade Berrettini, MD, PhD The Karl E. Rickels Professor of Psychiatry and Director of the Center for Neurobiology and Behavior, Department of Psychiatry

More information

DNA Sequence Analysis

DNA Sequence Analysis DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide

More information

Ion Torrent Systems Research Applications and Developments for PGM and Proton Sequencers

Ion Torrent Systems Research Applications and Developments for PGM and Proton Sequencers Ion Torrent Systems Research Applications and Developments for PGM and Proton Sequencers Mathieu Larivière Life Technologies Field Application Scientist Next Generation Sequencing 1 Introduction to PGM

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing DNA sequence represents a single format onto which a broad range of biological phenomena can be projected for high-throughput data collection Over the past three years, massively

More information

Introduction Bioo Scientific

Introduction Bioo Scientific Next Generation Sequencing Catalog 2014-2015 Introduction Bioo Scientific Bioo Scientific is a global life science company headquartered in Austin, TX, committed to providing innovative products and superior

More information

12/6/12. Dr. Sanjeeva Srivastava. IIT Bombay 2. Genomics Transcriptomics Why proteomics? Proteomics Course NPTEL

12/6/12. Dr. Sanjeeva Srivastava. IIT Bombay 2. Genomics Transcriptomics Why proteomics? Proteomics Course NPTEL Dr. Sanjeeva Srivastava IIT Bombay Genomics Transcriptomics Why proteomics? IIT Bombay 2 1 IIT Bombay 3 Genome: The entire sequence of an organism s hereditary information, including both coding and non-coding

More information

The MiniSeq System. Explore the possibilities.

The MiniSeq System. Explore the possibilities. The MiniSeq System. Explore the possibilities. Discover demonstrated NGS workflows for molecular biology applications. Let your work flow with Illumina NGS. The MiniSeq System delivers powerful and cost-effective

More information

Genome Sequencer System. Amplicon Sequencing. Application Note No. 5 / February 2007. www.roche-applied-science.com

Genome Sequencer System. Amplicon Sequencing. Application Note No. 5 / February 2007. www.roche-applied-science.com Genome Sequencer System Application Note No. 5 / February 2007 Amplicon Sequencing www.roche-applied-science.com 1 Amplicon Sequencing Corresponding author: Tom Jarvie, 454 Life Sciences Corporation, Branford,

More information

TruSeq Custom Amplicon v1.5

TruSeq Custom Amplicon v1.5 Data Sheet: Targeted Resequencing TruSeq Custom Amplicon v1.5 A new and improved amplicon sequencing solution for interrogating custom regions of interest. Highlights Figure 1: TruSeq Custom Amplicon Workflow

More information

Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation

Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation PN 100-9879 A1 TECHNICAL NOTE Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation Introduction Cancer is a dynamic evolutionary process of which intratumor genetic and phenotypic

More information

restriction enzymes 350 Home R. Ward: Spring 2001

restriction enzymes 350 Home R. Ward: Spring 2001 restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually

More information

TECHNOLOGY PATENTS IN THE (CONTINUED)... 16

TECHNOLOGY PATENTS IN THE (CONTINUED)... 16 CHAPTER ONE: INTRODUCTION... 1 STUDY GOALS AND OBJECTIVES... 1 REASONS FOR DOING THIS STUDY... 1 SCOPE AND FORMAT... 1 METHODOLOGY AND INFORMATION SOURCES... 2 INTENDED AUDIENCE... 2 ANALYST CREDENTIALS...

More information

454 Sequencing System Guidelines for Amplicon Experimental Design

454 Sequencing System Guidelines for Amplicon Experimental Design 454 Sequencing System Guidelines for Amplicon Experimental Design July 2011 Instrument / Kit GS Junior / Junior GS FLX+ / XL+ GS FLX+ / XLR70 GS FLX / XLR70 For life science research only. Not for use

More information

Next Generation Sequencing data Analysis at Genoscope

Next Generation Sequencing data Analysis at Genoscope Next Generation Sequencing data Analysis at Genoscope Genoscope (National Sequencing center) Among the largest sequencing center in Europe Part of the CEA Institut de Génomique since 05/2007 Provide high-throughput

More information

Next Generation Sequencing: Technology, Mapping, and Analysis

Next Generation Sequencing: Technology, Mapping, and Analysis Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took

More information

LightCycler 480 Real-Time PCR System: Innovative Solutions for High-Throughput PCR

LightCycler 480 Real-Time PCR System: Innovative Solutions for High-Throughput PCR LightCycler 480 Real-Time PCR System: Innovative Solutions for High-Throughput PCR Options for High-Throughput PCR Robotics Automated plate loading Ready-to-use and stable reagents Increasing throughput

More information

TECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298

TECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298 DIAGNOSTICS BUSINESS ANALYSIS SERIES: TECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298 By ADAMS BUSINESS ASSOCIATES MAY 2014. May 2014 ABA 298 1 Technologies, Products & Services

More information

DNA Sequencing & The Human Genome Project

DNA Sequencing & The Human Genome Project DNA Sequencing & The Human Genome Project An Endeavor Revolutionizing Modern Biology Jutta Marzillier, Ph.D Lehigh University Biological Sciences November 13 th, 2013 Guess, who turned 60 earlier this

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

HTG EdgeSeq System Workflow Overview

HTG EdgeSeq System Workflow Overview HTG EdgeSeq System Workflow Overview The HTG EdgeSeq system is an automated chemistry and workflow solution based on HTG Molecular Diagnostics (HTG) extraction-free sample preparation technology and quantitative

More information

Admera Health RUO Services

Admera Health RUO Services Admera Health RUO Services Updated 12/05/2016 Services 1. Whole Exome Sequencing (WES)... 2 2. Whole Genome Sequencing (WGS)... 3 3. RNA-Seq... 4 4. 16S rrna sequencing... 5 5. Metatranscriptomics... 6

More information

Fishing for variants in the deep end of the gene pool: OGT s custom bait designs

Fishing for variants in the deep end of the gene pool: OGT s custom bait designs Fishing for variants in the deep end of the gene pool: OGT s custom bait designs Jolyon Holdstock, Simon Hughes and Daniel Swan Abstract Oxford Gene Technology (OGT) has extensive expertise in probe design

More information

Ion Torrent Amplicon Sequencing

Ion Torrent Amplicon Sequencing APPLICATION NOTE Amplicon Sequencing Ion Torrent Amplicon Sequencing Introduction The ability to sequence a genome or a portion of a genome has enabled researchers to begin to understand how the genetic

More information

Next-Generation Sequencing

Next-Generation Sequencing Next-Generation Sequencing SURVEY RESULTS October 2013 CONDUCTED BY: Study Background & Purpose In October 2013, Bio-IT World conducted a survey within the biotechnology and pharmaceutical sector on Next

More information

INTRODUCTION TO NGS VARIANT CALLING ANALYSIS

INTRODUCTION TO NGS VARIANT CALLING ANALYSIS Hospital Universitari Vall d Hebron Institut de Recerca - VHIR Institut d Investigació Sanitària de l Instituto de Salud Carlos III (ISCIII) INTRODUCTION TO NGS VARIANT CALLING ANALYSIS Bioinformàtica

More information

Genomic Applications on Cray supercomputers: Next Generation Sequencing Workflow. Barry Bolding. Cray Inc Seattle, WA

Genomic Applications on Cray supercomputers: Next Generation Sequencing Workflow. Barry Bolding. Cray Inc Seattle, WA Genomic Applications on Cray supercomputers: Next Generation Sequencing Workflow Barry Bolding Cray Inc Seattle, WA 1 CUG 2013 Paper Genomic Applications on Cray supercomputers: Next Generation Sequencing

More information

Leading Genomics. Diagnostic. Discove. Collab. harma. Shanghai Cambridge, MA Reykjavik

Leading Genomics. Diagnostic. Discove. Collab. harma. Shanghai Cambridge, MA Reykjavik Leading Genomics Diagnostic harma Discove Collab Shanghai Cambridge, MA Reykjavik Global leadership for using the genome to create better medicine WuXi NextCODE provides a uniquely proven and integrated

More information

Understanding the Microbiome: Metatranscriptomics. Marcus Claesson APC Microbiome Symposium 2015

Understanding the Microbiome: Metatranscriptomics. Marcus Claesson APC Microbiome Symposium 2015 Understanding the Microbiome: Metatranscriptomics Marcus Claesson APC Microbiome Symposium 2015 Metatranscriptomics Definition (genetics, ecology) A branch of transcriptomics that studies and correlates,

More information

Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools.

Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools. Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools. Empowering microbial genomics. Extensive methods. Expansive possibilities. In microbiome studies

More information

Delivering the power of the world s most successful genomics platform

Delivering the power of the world s most successful genomics platform Delivering the power of the world s most successful genomics platform NextCODE Health is bringing the full power of the world s largest and most successful genomics platform to everyday clinical care NextCODE

More information

Introduction to NGS data analysis

Introduction to NGS data analysis Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High

More information

Next Generation Sequencing for DUMMIES

Next Generation Sequencing for DUMMIES Next Generation Sequencing for DUMMIES Looking at a presentation without the explanation from the author is sometimes difficult to understand. This document contains extra information for some slides that

More information

Disease gene identification with exome sequencing

Disease gene identification with exome sequencing Disease gene identification with exome sequencing Christian Gilissen Dept. of Human Genetics Radboud University Nijmegen Medical Centre c.gilissen@antrg.umcn.nl Contents Infrastructure Exome sequencing

More information

Oncology Insights Enabled by Knowledge Base-Guided Panel Design and the Seamless Workflow of the GeneReader NGS System

Oncology Insights Enabled by Knowledge Base-Guided Panel Design and the Seamless Workflow of the GeneReader NGS System White Paper Oncology Insights Enabled by Knowledge Base-Guided Panel Design and the Seamless Workflow of the GeneReader NGS System Abstract: This paper describes QIAGEN s philosophy and process for developing

More information

Consistent Assay Performance Across Universal Arrays and Scanners

Consistent Assay Performance Across Universal Arrays and Scanners Technical Note: Illumina Systems and Software Consistent Assay Performance Across Universal Arrays and Scanners There are multiple Universal Array and scanner options for running Illumina DASL and GoldenGate

More information

Next Generation Sequencing. mapping mutations in congenital heart disease

Next Generation Sequencing. mapping mutations in congenital heart disease Next Generation Sequencing mapping mutations in congenital heart disease AV Postma PhD Academic Medical Center Amsterdam, the Netherlands Overview talk Congenital heart disease and genetics Next generation

More information

UKB_WCSGAX: UK Biobank 500K Samples Genotyping Data Generation by the Affymetrix Research Services Laboratory. April, 2015

UKB_WCSGAX: UK Biobank 500K Samples Genotyping Data Generation by the Affymetrix Research Services Laboratory. April, 2015 UKB_WCSGAX: UK Biobank 500K Samples Genotyping Data Generation by the Affymetrix Research Services Laboratory April, 2015 1 Contents Overview... 3 Rare Variants... 3 Observation... 3 Approach... 3 ApoE

More information

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1 CAP 5510-8 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Genomic Mapping & Mapping Databases High resolution, genome-wide maps of DNA markers. Integrated maps, genome catalogs and comprehensive

More information

GeneSifter: Next Generation Data Management and Analysis for Next Generation Sequencing

GeneSifter: Next Generation Data Management and Analysis for Next Generation Sequencing for Next Generation Sequencing Dale Baskin, N. Eric Olson, Laura Lucas, Todd Smith 1 Abstract Next generation sequencing technology is rapidly changing the way laboratories and researchers approach the

More information

Course Directors George L Kumar PhD, MBA Vice President of Marketing and Scientific Affairs Targos Inc Bayhill Drive San Bruno, CA USA

Course Directors George L Kumar PhD, MBA Vice President of Marketing and Scientific Affairs Targos Inc Bayhill Drive San Bruno, CA USA NSH Molecular Pathology Technology & Methods Forum: IN-SITU HYBRIDIZATION, MICROARRAY AND NEXT-GENERATION SEQUENCING IN CLINICAL DIAGNOSTICS 26-28 October 2015, Location: Emory Conference Center. Atlanta,

More information

Exome sequencing at the CCG. NGS an der Schnittstelle von Grundlagen- und translationaler Forschung"

Exome sequencing at the CCG. NGS an der Schnittstelle von Grundlagen- und translationaler Forschung Exome sequencing at the CCG NGS an der Schnittstelle von Grundlagen- und translationaler Forschung" Peter Nürnberg TMF-Workshop Berlin, 7.12.2012 University of Cologne The exome sequencing pipeline library

More information

Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing

Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAAC GTGCAC GTGAAC Wouter Coppieters Head of the genomics core facility GIGA center, University of Liège Bioruptor NGS: Unbiased DNA

More information

Rapid Aneuploidy and CNV Detection in Single Cells using the MiSeq System

Rapid Aneuploidy and CNV Detection in Single Cells using the MiSeq System i Technical Note: Reproductive Health Rapid Aneuploidy and CNV Detection in Single Cells using the MiSeq System Comparison between data generated from single cells using 24sure array-based screening and

More information

A Primer of Genome Science THIRD

A Primer of Genome Science THIRD A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:

More information

An Overview of DNA Sequencing

An Overview of DNA Sequencing An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure

More information

Next Generation Sequencing; Technologies, applications and data analysis

Next Generation Sequencing; Technologies, applications and data analysis ; Technologies, applications and data analysis Course 2542 Dr. Martie C.M. Verschuren Research group Analysis techniques in Life Science, Breda Prof. dr. Johan T. den Dunnen Leiden Genome Technology Center,

More information

Bioanalyzer Applications for

Bioanalyzer Applications for Bioanalyzer Applications for Next-Gen Sequencing: Updates and Tips March 1 st, 2011 Charmian Cher, Ph.D Field Applications Scientist Page 1 Agenda 1 2 3 Next-gen sequencing library preparation workflow

More information

Next Gen Sequencing Technologies. 454 SOLiD Illumina (Used to be Solexa)

Next Gen Sequencing Technologies. 454 SOLiD Illumina (Used to be Solexa) Next Gen Sequencing Technologies 454 SOLiD Illumina (Used to be Solexa) Sequencing by synthesis (SBS): 454 pyrosequencing Metzker, Nat. Rev Genetics. 2010 Margulies et al. 2005, Nature 400-500bp reads,

More information

The University is comprised of seven colleges and offers 19. including more than 5000 graduate students.

The University is comprised of seven colleges and offers 19. including more than 5000 graduate students. UNC CHARLOTTE A doctoral, research-intensive university, UNC Charlotte is the largest institution of higher education in the Charlotte region. The University is comprised of seven colleges and offers 19

More information

NGS Technologies for Genomics and Transcriptomics

NGS Technologies for Genomics and Transcriptomics NGS Technologies for Genomics and Transcriptomics Massimo Delledonne Department of Biotechnologies - University of Verona http://profs.sci.univr.it/delledonne 13 years and $3 billion required for the Human

More information

Illumina Sequencing Technology

Illumina Sequencing Technology Illumina Sequencing Technology Highest data accuracy, simple workflow, and a broad range of applications. Introduction Figure 1: Illumina Flow Cell Illumina sequencing technology leverages clonal array

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

Focusing on results not data comprehensive data analysis for targeted next generation sequencing

Focusing on results not data comprehensive data analysis for targeted next generation sequencing Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

SNP genotyping. Gene expression. And now Solexa sequencing.

SNP genotyping. Gene expression. And now Solexa sequencing. SNP genotyping. Gene expression. And now Solexa sequencing. Let s find the answers together. It s your research. You question. You test. You want answers quickly, accurately, and at a good value. Illumina

More information