Next generation DNA sequencing technologies. theory & prac-ce
|
|
- Leon Charles
- 8 years ago
- Views:
Transcription
1 Next generation DNA sequencing technologies theory & prac-ce
2 Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing pipeline
3 PART I: NGS technologies Next- Genera-on sequencing (NGS) technologies overview
4 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977 A Maxam and W Gilbert "DNA seq by chemical degrada-on" F Sanger"DNA sequencing with chain- termina-ng inhibitors" 1984 DNA sequence of the Epstein- Barr virus, 170 kb 1987 Applied Biosystems - first automated sequencer 1991 Sequencing of human genome in Venter's lab 1996 P. Nyrén and M Ronaghi - pyrosequencing 2001 A drah sequence of the human genome 2003 human genome completed Life Sciences markets first NGS machine
5
6 Massive parallel sequencing 11/10/13
7 DNA Sequencing the next generation Commercially available technologies Roche 454 GSFLX -tanium Junior Illumina HiSeq2000/2500 MiSeq Life SOLiD 5500 Ion torrent/proton (Helicos BioSciences HeliScope) Pacific Biosciences PacBio RS 11/10/13
8 DNA Sequencing the next generation The newer technologies cons-tute various strategies that rely on a combina-on of Library/template prepara-on Parallel sequencing
9 Template preparation: STEP1
10 Template preparation Produce a non- biased source of nucleic acid material from the genome Current methods: randomly breaking genomic DNA into smaller sizes Ligate adaptors anach or immobilize the template to a solid surface or support the spa-ally separated template sites allows thousands to billions of sequencing reac-ons to be performed simultaneously
11 Template preparation Clonal amplifica-on Roche 454 Illumina HiSeq Life SOLiD Life Ion Torrent Single molecule sequencing Helicos BioSciences HeliScope Pacific Biosciences PacBio RS
12 Template preparation: Clonal amplification In solu-on emulsion PCR (empcr) Roche 454 Life SOLiD Solid phase Bridge PCR Illumina HiSeq Life SOLiD - wildfire 11/10/13
13 Template preparation: Clonal amplification empcr 11/10/13
14 Template preparation: SOLiD 454 Ion Torrent Jeroen Van Houdt - Genomics Core - UZ Leuven- KU Leuven 11/10/13
15 Template preparation: Clonal amplification Bridge PCR 11/10/13
16 Template preparation: Single molecule templates Heliscope PacBio 11/10/13
17 Sequencing Sequencing By Synthesis (SBS) Roche 454 Illumina HiSeq Life Ion Torrent (label- free) Helicos BioSciences HeliScope Pacific Biosciences PacBio RS Sequecing By Liga-on Life SOLiD 11/10/13
18 454 - Pyrosequencing Pico-tre plate Pyrosequencing 11/10/13
19 454 - Pyrosequencing 11/10/13
20 Ion torrent label free sequencing 11/10/13
21 HiSeq Heliscope
22 Sequencing PacBio single molecule 11/10/13
23 Sequencing by ligation 11/10/13
24 DNA Sequencing The major advance offered by NGS is the ability to cheaply produce an enormous volume of data The arrival of NGS technologies in the marketplace has changed the way we think about scien-fic approaches in basic, applied and clinical research NGS allows to study different aspects of the gene-c architecture at the whole genome scale 11/10/13
25 Whole-Genome SEQUENCING DNA SEQUENCING
26 Whole-Genome SEQUENCING
27 WGS - Copy number variation analysis
28 WGS - Structural variation analysis
29 Whole-Genome Sequencing (WGS) Copy number varia-on analysis Sequencing a genome at x Sequencing a genome at 1-3x Structural varia-on analysis Sequencing a genome at 5-10x Whole genome re- sequencing Sequencing a genome at >30x yeast, fruit fly, bacterial genomes, human
30 Targeted re-sequencing DNA SEQUENCING
31 The beginning Random genome sequencing?????? Sanger sequencing Targeted bp
32 DNA Sequencing the next generation Library/template prepara-on Library enrichment for target Sequencing and imaging
33 Target enrichment strategies Random genome sequencing Hybrid Capture PCR based Sanger sequencing
34 Target enrichment strategies
35 Target enrichment strategies
36 Target enrichment strategies
37 Hybrid Capture In solu-on Agilent Nimblegen... Solid phase Agilent Nimblegen Febit...
38 Hybrid Capture In solu-on Rela-vely cheap High throughput is possible Small amounts of DNA sufficient Solid phase Straighworward method Flexible Higher amounts of DNA
39 PCR based approaches Uniplex Mul-plex Fluidigm Raindance Mul-plicon Longrange PCR products Raindance
40 RNA Sequencing Rapid expression profiling, transcriptome sequencing and small RNA s
41 RNA-seq
42 RNAseq: Gene Expression through sequencing Supports discovery, screening, and profiling Does not require prior gene knowledge or annota-on Unique combina-on of Qualita-ve and quan-ta-ve measurement Digital counts vs analog intensi-es Increased dynamic range and sensi-vity No probes or primers Any species - Even when reference genome not available Analyze gene expression
43 RNAseq: summary Coun-ng or Profiling 10 million total reads of 35 bp length from poly- A selected RNA will give performance bener than any microarray Studying Alterna-ve Splicing or quan-fying csnps for most transcripts Deeper profiling of 50 to 100 million reads, with read lengths of 50 to 100 bps, from poly- A selected RNA using mrna- Seq assay Complete Annota-on of an en-rely New Transcriptome ~500 Million reads of 100 bp read length from mul-ple -ssues Normalized stranded mrna- Seq & ncrnas Small RNA- Seq for micrornas
44 PART III: NGS workflow data collec-on and processing the exome sequencing pipeline
45 Whole Exome Sequencing The human genome Genome = 3Gb Exome = 30Mb exons Protein coding genes cons-tute only approximately 1% of the human genome It is es-mated that 85% of the muta-ons with large effects on disease- related traits can be found in exons or splice sites
46 Exome sequencing gdna 3 Gb Exome 38Mb NGS
47 The past, present & future exome capture Seq - 2.5Gbases total cost Jeroen Van Houdt - 1/01/2010 Genomics Core - UZ Leuven- KU Leuven 1/08/2010 1/01/2011
48 Exome sequencing capacity HiSeq specifica-ons: 2 flow cells 16 lanes (8 per flow cell) Gbases per flow cell 10 days for a single run Exome throughput 60x coverage per run 60x coverage per year
49 Exome sequencing
50 Data processing workflow Data forma ng & QC Mapping & QC Variant calling Variant annota-on Variant filtering/comparison
51 DATA GENERATION DATA PROCESSING DATA STORAGE INTERPRETATION RESULTS REPORTING & VALIDATION
52 DATA GENERATION Prepare sample library Perfom exome capture Perform sequencing
53 DATA GENERATION Prepare sample library Perfom exome capture Perform sequencing
54 DATA GENERATION Prepare sample library Perfom exome capture Perform sequencing
55 DATA GENERATION DATA PROCESSING DATA STORAGE Image processing Base calling Sequence Data Gb / exome
56
57 NGS data processing: overview 1 Mapping Duplicate marking Local realignment Base quality recalibra-on Analysis- ready mapped reads
58 DATA GENERATION DATA PROCESSING DATA STORAGE Image processing Base calling Sequence Data Gb / exome QC sequencing Mapping sequences QC capture exp
59 DATA PROCESSING QC NGS Mapping QC HC
60 DATA PROCESSING QC NGS Mapping QC HC
61 DATA GENERATION DATA PROCESSING DATA STORAGE Image processing Base calling Sequence Data Gb / exome QC sequencing Mapping sequences QC capture exp Mapping results 5 Gb / exome Variant Calling Variant Annota-on
62
63
64
65 DATA GENERATION DATA PROCESSING DATA STORAGE Image processing Base calling Sequence Data Gb / exome QC sequencing Mapping sequences QC capture exp Mapping results 5 Gb / exome Variant Calling Variant Annota-on Variant Calls 100Mb / exome
66 SNPs vs Indels INDEL SNP
67 exonic vs non-exonic stopgain SNV nonsynonymous SNV nonframeshih inser-on nonframeshih dele-on non- coding frameshih inser-on frameshih dele-on
68 Exonic synonymous SNV stoploss SNV stopgain SNV nonsynonymous SNV nonframeshih inser-on nonframeshih dele-on frameshih inser-on frameshih dele-on
69 Exonic stoploss SNV stopgain SNV nonframeshih inser-on nonframeshih dele-on frameshih inser-on frameshih dele-on
70 DATA GENERATION DATA PROCESSING DATA STORAGE Image processing Base calling Sequence Data Gb / exome QC sequencing Mapping sequences QC capture exp Mapping results 5 Gb / exome Variant Calling Variant Annota-on Variant Calls 100Mb / exome Variant Filtering Database known Variants Public & Private
71
72 DATA GENERATION DATA PROCESSING DATA STORAGE Image processing Base calling Sequence Data Gb / exome INTERPRETATION QC sequencing Mapping sequences QC capture exp Mapping results 5 Gb / exome RESULTS Validated variants in candidate genes Variant Calling Variant Annota-on Variant Calls 100Mb / exome REPORTING & VALIDATION Variant Filtering Database known Variants Public & Private
73 DNA Sequencing the next generation 11/10/13
Next Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
More informationAutomated DNA sequencing 20/12/2009. Next Generation Sequencing
DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing
More informationJuly 7th 2009 DNA sequencing
July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer
More informationIntroduction to next-generation sequencing data
Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS
More informationNGS data analysis. Bernardo J. Clavijo
NGS data analysis Bernardo J. Clavijo 1 A brief history of DNA sequencing 1953 double helix structure, Watson & Crick! 1977 rapid DNA sequencing, Sanger! 1977 first full (5k) genome bacteriophage Phi X!
More informationIntroduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
More informationGenetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
More informationRNAseq / ChipSeq / Methylseq and personalized genomics
RNAseq / ChipSeq / Methylseq and personalized genomics 7711 Lecture Subhajyo) De, PhD Division of Biomedical Informa)cs and Personalized Biomedicine, Department of Medicine University of Colorado School
More informationNazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office
2013 Laboratory Accreditation Program Audioconferences and Webinars Implementing Next Generation Sequencing (NGS) as a Clinical Tool in the Laboratory Nazneen Aziz, PhD Director, Molecular Medicine Transformation
More informationIntroduction to NGS data analysis
Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High
More informationOverview of Next Generation Sequencing platform technologies
Overview of Next Generation Sequencing platform technologies Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Outline 1. Technologies
More informationPreciseTM Whitepaper
Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis
More informationG E N OM I C S S E RV I C ES
GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E
More informationSEQUENCING. From Sample to Sequence-Ready
SEQUENCING From Sample to Sequence-Ready ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES, NOT ONCE, BUT EVERY TIME The highest-quality amplicons more sensitive, accurate, and specific Full support for all major
More informationNext Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took
More informationShouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center
Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing
More informationSingle-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples
DATA Sheet Single-Cell DNA Sequencing with the C 1 Single-Cell Auto Prep System Reveal hidden populations and genetic diversity within complex samples Single-cell sensitivity Discover and detect SNPs,
More informationNew generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova
New generation sequencing: current limits and future perspectives Giorgio Valle CRIBI Università di Padova Around 2004 the Race for the 1000$ Genome started A few questions... When? How? Why? Standard
More informationData Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
More informationNext Generation Sequencing for DUMMIES
Next Generation Sequencing for DUMMIES Looking at a presentation without the explanation from the author is sometimes difficult to understand. This document contains extra information for some slides that
More information14/12/2012. HLA typing - problem #1. Applications for NGS. HLA typing - problem #1 HLA typing - problem #2
www.medical-genetics.de Routine HLA typing by Next Generation Sequencing Kaimo Hirv Center for Human Genetics and Laboratory Medicine Dr. Klein & Dr. Rost Lochhamer Str. 9 D-8 Martinsried Tel: 0800-GENETIK
More informationBRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls?
BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? Giovanni Luca Scaglione, PhD ------------------------ Laboratory of Clinical Molecular Diagnostics and Personalized Medicine, Institute
More informationSingle-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation
PN 100-9879 A1 TECHNICAL NOTE Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation Introduction Cancer is a dynamic evolutionary process of which intratumor genetic and phenotypic
More informationNext Generation Sequencing
Next Generation Sequencing DNA sequence represents a single format onto which a broad range of biological phenomena can be projected for high-throughput data collection Over the past three years, massively
More informationTruSeq Custom Amplicon v1.5
Data Sheet: Targeted Resequencing TruSeq Custom Amplicon v1.5 A new and improved amplicon sequencing solution for interrogating custom regions of interest. Highlights Figure 1: TruSeq Custom Amplicon Workflow
More informationComputational Genomics. Next generation sequencing (NGS)
Computational Genomics Next generation sequencing (NGS) Sequencing technology defies Moore s law Nature Methods 2011 Log 10 (price) Sequencing the Human Genome 2001: Human Genome Project 2.7G$, 11 years
More informationHow many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
More informationFocusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
More informationThe Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics
The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long
More informationAdvances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage
Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research March 17, 2011 Rendez-Vous Séquençage Presentation Overview Core Technology Review Sequence Enrichment Application
More informationIllumina Sequencing Technology
Illumina Sequencing Technology Highest data accuracy, simple workflow, and a broad range of applications. Introduction Figure 1: Illumina Flow Cell Illumina sequencing technology leverages clonal array
More informationSchool of Nursing. Presented by Yvette Conley, PhD
Presented by Yvette Conley, PhD What we will cover during this webcast: Briefly discuss the approaches introduced in the paper: Genome Sequencing Genome Wide Association Studies Epigenomics Gene Expression
More informationTGC AT YOUR SERVICE. Taking your research to the next generation
TGC AT YOUR SERVICE Taking your research to the next generation 1. TGC At your service 2. Applications of Next Generation Sequencing 3. Experimental design 4. TGC workflow 5. Sample preparation 6. Illumina
More informationAppendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
More informationDNA Sequencing & The Human Genome Project
DNA Sequencing & The Human Genome Project An Endeavor Revolutionizing Modern Biology Jutta Marzillier, Ph.D Lehigh University Biological Sciences November 13 th, 2013 Guess, who turned 60 earlier this
More informationIMBB 2013. Genomic DNA purifica8on
IMBB 2013 Genomic DNA purifica8on Why purify DNA? The purpose of DNA purifica8on from the cell/8ssue is to ensure it performs well in subsequent downstream applica8ons, e.g. Polymerase Chain Reac8on (PCR),
More informationDal proge*o genoma umano ad oggi: evoluzione delle tecniche di sequenziamento, analisi genomica e proteomica e prospe9ve future!
Dal proge*o genoma umano ad oggi: evoluzione delle tecniche di sequenziamento, analisi genomica e proteomica e prospe9ve future! David Horner Dipar.mento di Bioscienze Università degli Studi di Milano
More informationConcepts and methods in sequencing and genome assembly
BCM-2004 Concepts and methods in sequencing and genome assembly B. Franz LANG, Département de Biochimie Bureau: H307-15 Courrier électronique: Franz.Lang@Umontreal.ca Outline 1. Concepts in DNA and RNA
More informationCore Facility Genomics
Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray
More informationNGS Technologies for Genomics and Transcriptomics
NGS Technologies for Genomics and Transcriptomics Massimo Delledonne Department of Biotechnologies - University of Verona http://profs.sci.univr.it/delledonne 13 years and $3 billion required for the Human
More informationNew Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.
New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System
More informationGo where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe
Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. To published results faster With proven scalability To the forefront of discovery To limitless applications
More informationHistory of DNA Sequencing & Current Applications
History of DNA Sequencing & Current Applications Christopher McLeod President & CEO, 454 Life Sciences, A Roche Company IMPORTANT NOTICE Intended Use Unless explicitly stated otherwise, all Roche Applied
More informationIntroduction Bioo Scientific
Next Generation Sequencing Catalog 2014-2015 Introduction Bioo Scientific Bioo Scientific is a global life science company headquartered in Austin, TX, committed to providing innovative products and superior
More informationHow is genome sequencing done?
How is genome sequencing done? Using 454 Sequencing on the Genome Sequencer FLX System, DNA from a genome is converted into sequence data through four primary steps: Step One DNA sample preparation; Step
More informationAn Introduction to Next-Generation Sequencing for in vitro Fertilization
An Introduction to Next-Generation Sequencing for in vitro Fertilization www.illumina.com/ivfprimer Table of Contents Part I. Welcome to Next-Generation Sequencing 3 NGS for in vitro Fertilization 3 Part
More informationNEXT GENERATION SEQUENCING
NEXT GENERATION SEQUENCING Dr. R. Piazza SANGER SEQUENCING + DNA NEXT GENERATION SEQUENCING Flowcell NEXT GENERATION SEQUENCING Library di DNA Genomic DNA NEXT GENERATION SEQUENCING NEXT GENERATION SEQUENCING
More informationServices. Updated 05/31/2016
Updated 05/31/2016 Services 1. Whole exome sequencing... 2 2. Whole Genome Sequencing (WGS)... 3 3. 16S rrna sequencing... 4 4. Customized gene panels... 5 5. RNA-Seq... 6 6. qpcr... 7 7. HLA typing...
More informationAGILENT S BIOINFORMATICS ANALYSIS SOFTWARE
ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
More informationThe NGS IT notes. George Magklaras PhD RHCE
The NGS IT notes George Magklaras PhD RHCE Biotechnology Center of Oslo & The Norwegian Center of Molecular Medicine University of Oslo, Norway http://www.biotek.uio.no http://www.ncmm.uio.no http://www.no.embnet.org
More informationThe author(s) shown below used Federal funds provided by the U.S. Department of Justice and prepared the following final report:
The author(s) shown below used Federal funds provided by the U.S. Department of Justice and prepared the following final report: Document Title: Author(s): Resolution of DNA Mixtures and Analysis of Degraded
More informationTargeted. sequencing solutions. Accurate, scalable, fast TARGETED
Targeted TARGETED Sequencing sequencing solutions Accurate, scalable, fast Sequencing for every lab, every budget, every application Ion Torrent semiconductor sequencing Ion Torrent technology has pioneered
More informationMicrobial Oceanomics using High-Throughput DNA Sequencing
Microbial Oceanomics using High-Throughput DNA Sequencing Ramiro Logares Institute of Marine Sciences, CSIC, Barcelona 9th RES Users'Conference 23 September 2015 Importance of microbes in the sunlit ocean
More informationAssuring the Quality of Next-Generation Sequencing in Clinical Laboratory Practice. Supplementary Guidelines
Assuring the Quality of Next-Generation Sequencing in Clinical Laboratory Practice Next-generation Sequencing: Standardization of Clinical Testing (Nex-StoCT) Workgroup Principles and Guidelines Supplementary
More informationGenotyping by sequencing and data analysis. Ross Whetten North Carolina State University
Genotyping by sequencing and data analysis Ross Whetten North Carolina State University Stein (2010) Genome Biology 11:207 More New Technology on the Horizon Genotyping By Sequencing Timeline 2007 Complexity
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID papillary renal cell carcinoma (translocation-associated) PRCC Human This gene
More informationTechniques in Molecular Biology (to study the function of genes)
Techniques in Molecular Biology (to study the function of genes) Analysis of nucleic acids: Polymerase chain reaction (PCR) Gel electrophoresis Blotting techniques (Northern, Southern) Gene expression
More informationFOR REFERENCE PURPOSES
BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit
More informationGenomeStudio Data Analysis Software
GenomeStudio Analysis Software Illumina has created a comprehensive suite of data analysis tools to support a wide range of genetic analysis assays. This single software package provides data visualization
More informationAthanasia Pavlopoulou University of Thessaly, Lamia June 2015
Athanasia Pavlopoulou University of Thessaly, Lamia June 2015 Early DNA Sequencing Technologies Early efforts at DNA sequencing were: o tedious o time consuming o labor intensive Frederick Sanger (Sanger
More informationRecombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
More informationNext Generation Sequencing data Analysis at Genoscope. Jean-Marc Aury
Next Generation Sequencing data Analysis at Genoscope Jean-Marc Aury Introduction Presentation of Genoscope and NGS activities Overview of sequencing technologies Sequencing and assembly of prokaryotic
More informationBiotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
More informationIntroduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
More informationHow Sequencing Experiments Fail
How Sequencing Experiments Fail v1.0 Simon Andrews simon.andrews@babraham.ac.uk Classes of Failure Technical Tracking Library Contamination Biological Interpretation Something went wrong with a machine
More information8/7/2012. Experimental Design & Intro to NGS Data Analysis. Examples. Agenda. Shoe Example. Breast Cancer Example. Rat Example (Experimental Design)
Experimental Design & Intro to NGS Data Analysis Ryan Peters Field Application Specialist Partek, Incorporated Agenda Experimental Design Examples ANOVA What assays are possible? NGS Analytical Process
More informationA Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
More informationData Analysis & Management of High-throughput Sequencing Data. Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute
Data Analysis & Management of High-throughput Sequencing Data Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute Current Issues Current Issues The QSEQ file Number files per
More informationNext Generation Sequencing: Adjusting to Big Data. Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013
Next Generation Sequencing: Adjusting to Big Data Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013 Outline Human Genome Project Next-Generation Sequencing Personalized Medicine
More informationNECC History. Karl V. Steiner 2011 Annual NECC Meeting, Orono, Maine March 15, 2011
NECC History Karl V. Steiner 2011 Annual NECC Meeting, Orono, Maine March 15, 2011 EPSCoR Cyberinfrastructure Workshop First regional NENI (now NECC) Workshop held in Vermont in August 2007 Workshop heldinkentucky
More informationNext Generation Sequencing; Technologies, applications and data analysis
; Technologies, applications and data analysis Course 2542 Dr. Martie C.M. Verschuren Research group Analysis techniques in Life Science, Breda Prof. dr. Johan T. den Dunnen Leiden Genome Technology Center,
More informationDiscovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat
Bioinformatique et Séquençage Haut Débit, Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat 1 RNA Transcription to RNA and subsequent
More informationTranscription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
More informationThe Chinese University of Hong Kong igem 2010 Bacterial based storage and encryp2on device
The Chinese University of Hong Kong igem 2010 Bacterial based storage and encryp2on device Bacterial based informaaon storage device Bancro4 s group (2001) Mount Sinai School of Meducube Yachie s group
More informationQ&A: Kevin Shianna on Ramping up Sequencing for the New York Genome Center
Q&A: Kevin Shianna on Ramping up Sequencing for the New York Genome Center Name: Kevin Shianna Age: 39 Position: Senior vice president, sequencing operations, New York Genome Center, since July 2012 Experience
More informationGenomeStudio Data Analysis Software
GenomeStudio Data Analysis Software Illumina has created a comprehensive suite of data analysis tools to support a wide range of genetic analysis assays. This single software package provides data visualization
More informationData Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms
Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Introduction Mate pair sequencing enables the generation of libraries with insert sizes in the range of several kilobases (Kb).
More informationKey Principles and Clinical Applications of "Next-Generation" DNA Sequencing
Review Cancer Prevention Research Key Principles and Clinical Applications of "Next-Generation" DNA Sequencing Jason M. Rizzo and Michael J. Buck Abstract Demand for fast, inexpensive, and accurate DNA
More informationThe Steps. 1. Transcription. 2. Transferal. 3. Translation
Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order
More informationAnalysis of NGS Data
Analysis of NGS Data Introduction and Basics Folie: 1 Overview of Analysis Workflow Images Basecalling Sequences denovo - Sequencing Assembly Annotation Resequencing Alignments Comparison to reference
More informationAn example of bioinformatics application on plant breeding projects in Rijk Zwaan
An example of bioinformatics application on plant breeding projects in Rijk Zwaan Xiangyu Rao 17-08-2012 Introduction of RZ Rijk Zwaan is active worldwide as a vegetable breeding company that focuses on
More information2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
More informationNext Generation Sequencing; Technologies, applications and data analysis
; Technologies, applications and data analysis Course 2542 Dr. Martie C.M. Verschuren Research group Analysis techniques in Life Science, Breda Prof. dr. Johan T. den Dunnen Leiden Genome Technology Center,
More informationReal-time quantitative RT -PCR (Taqman)
Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR
More informationUCLA Team Sequences Cell Line, Puts Open Source Software Framework into Production
Page 1 of 6 UCLA Team Sequences Cell Line, Puts Open Source Software Framework into Production February 05, 2010 Newsletter: BioInform BioInform - February 5, 2010 By Vivien Marx Scientists at the department
More informationHigh Performance Compu2ng Facility
High Performance Compu2ng Facility Center for Health Informa2cs and Bioinforma2cs Accelera2ng Scien2fic Discovery and Innova2on in Biomedical Research at NYULMC through Advanced Compu2ng Efstra'os Efstathiadis,
More informationOverview sequence projects
Overview sequence projects Bioassist NGS meeting 15-01-2010 Barbera van Schaik KEBB - Bioinformatics Laboratory b.d.vanschaik@amc.uva.nl NGS at the Academic Medical Center Sequence facility Laboratory
More informationGeneSifter: Next Generation Data Management and Analysis for Next Generation Sequencing
for Next Generation Sequencing Dale Baskin, N. Eric Olson, Laura Lucas, Todd Smith 1 Abstract Next generation sequencing technology is rapidly changing the way laboratories and researchers approach the
More informationDelivering the power of the world s most successful genomics platform
Delivering the power of the world s most successful genomics platform NextCODE Health is bringing the full power of the world s largest and most successful genomics platform to everyday clinical care NextCODE
More informationHuman Genome and Human Genome Project. Louxin Zhang
Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular
More informationDisease gene identification with exome sequencing
Disease gene identification with exome sequencing Christian Gilissen Dept. of Human Genetics Radboud University Nijmegen Medical Centre c.gilissen@antrg.umcn.nl Contents Infrastructure Exome sequencing
More informationDNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
More informationCCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
More informationDNA Sequencing and PCR Markets
Brochure More information from http://www.researchandmarkets.com/reports/41864/ DNA Sequencing and PCR Markets Description: DNA sequencing and polymerase chain reaction (PCR) are two major technology platforms
More informationHuman Genome Organization: An Update. Genome Organization: An Update
Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion
More informationNicolas Pons INRA Ins(tut Micalis Plateforme MetaQuant Jouy- en- Josas, France
Nicolas Pons INRA Ins(tut Micalis Plateforme MetaQuant Jouy- en- Josas, France Special Science Online Collec-on: Dealing with Data (feb 2011) DNA Protein TTGTGGATAACCTCAAAACTTTTCTCTTTCTGACCTGTGGAAAACTTTTTCGTTTTATGATAGAATCAGAGGACAAGAATAAAGA!
More informationDNA Sequence Analysis
DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide
More informationAn Overview of DNA Sequencing
An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure
More informationWelcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation.
Introduction to SMRTbell Template Preparation 100 338 500 01 1. SMRTbell Template Preparation 1.1 Introduction to SMRTbell Template Preparation Welcome to Pacific Biosciences' Introduction to SMRTbell
More information