Next generation DNA sequencing technologies. theory & prac-ce

Size: px
Start display at page:

Download "Next generation DNA sequencing technologies. theory & prac-ce"

Transcription

1 Next generation DNA sequencing technologies theory & prac-ce

2 Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing pipeline

3 PART I: NGS technologies Next- Genera-on sequencing (NGS) technologies overview

4 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977 A Maxam and W Gilbert "DNA seq by chemical degrada-on" F Sanger"DNA sequencing with chain- termina-ng inhibitors" 1984 DNA sequence of the Epstein- Barr virus, 170 kb 1987 Applied Biosystems - first automated sequencer 1991 Sequencing of human genome in Venter's lab 1996 P. Nyrén and M Ronaghi - pyrosequencing 2001 A drah sequence of the human genome 2003 human genome completed Life Sciences markets first NGS machine

5

6 Massive parallel sequencing 11/10/13

7 DNA Sequencing the next generation Commercially available technologies Roche 454 GSFLX -tanium Junior Illumina HiSeq2000/2500 MiSeq Life SOLiD 5500 Ion torrent/proton (Helicos BioSciences HeliScope) Pacific Biosciences PacBio RS 11/10/13

8 DNA Sequencing the next generation The newer technologies cons-tute various strategies that rely on a combina-on of Library/template prepara-on Parallel sequencing

9 Template preparation: STEP1

10 Template preparation Produce a non- biased source of nucleic acid material from the genome Current methods: randomly breaking genomic DNA into smaller sizes Ligate adaptors anach or immobilize the template to a solid surface or support the spa-ally separated template sites allows thousands to billions of sequencing reac-ons to be performed simultaneously

11 Template preparation Clonal amplifica-on Roche 454 Illumina HiSeq Life SOLiD Life Ion Torrent Single molecule sequencing Helicos BioSciences HeliScope Pacific Biosciences PacBio RS

12 Template preparation: Clonal amplification In solu-on emulsion PCR (empcr) Roche 454 Life SOLiD Solid phase Bridge PCR Illumina HiSeq Life SOLiD - wildfire 11/10/13

13 Template preparation: Clonal amplification empcr 11/10/13

14 Template preparation: SOLiD 454 Ion Torrent Jeroen Van Houdt - Genomics Core - UZ Leuven- KU Leuven 11/10/13

15 Template preparation: Clonal amplification Bridge PCR 11/10/13

16 Template preparation: Single molecule templates Heliscope PacBio 11/10/13

17 Sequencing Sequencing By Synthesis (SBS) Roche 454 Illumina HiSeq Life Ion Torrent (label- free) Helicos BioSciences HeliScope Pacific Biosciences PacBio RS Sequecing By Liga-on Life SOLiD 11/10/13

18 454 - Pyrosequencing Pico-tre plate Pyrosequencing 11/10/13

19 454 - Pyrosequencing 11/10/13

20 Ion torrent label free sequencing 11/10/13

21 HiSeq Heliscope

22 Sequencing PacBio single molecule 11/10/13

23 Sequencing by ligation 11/10/13

24 DNA Sequencing The major advance offered by NGS is the ability to cheaply produce an enormous volume of data The arrival of NGS technologies in the marketplace has changed the way we think about scien-fic approaches in basic, applied and clinical research NGS allows to study different aspects of the gene-c architecture at the whole genome scale 11/10/13

25 Whole-Genome SEQUENCING DNA SEQUENCING

26 Whole-Genome SEQUENCING

27 WGS - Copy number variation analysis

28 WGS - Structural variation analysis

29 Whole-Genome Sequencing (WGS) Copy number varia-on analysis Sequencing a genome at x Sequencing a genome at 1-3x Structural varia-on analysis Sequencing a genome at 5-10x Whole genome re- sequencing Sequencing a genome at >30x yeast, fruit fly, bacterial genomes, human

30 Targeted re-sequencing DNA SEQUENCING

31 The beginning Random genome sequencing?????? Sanger sequencing Targeted bp

32 DNA Sequencing the next generation Library/template prepara-on Library enrichment for target Sequencing and imaging

33 Target enrichment strategies Random genome sequencing Hybrid Capture PCR based Sanger sequencing

34 Target enrichment strategies

35 Target enrichment strategies

36 Target enrichment strategies

37 Hybrid Capture In solu-on Agilent Nimblegen... Solid phase Agilent Nimblegen Febit...

38 Hybrid Capture In solu-on Rela-vely cheap High throughput is possible Small amounts of DNA sufficient Solid phase Straighworward method Flexible Higher amounts of DNA

39 PCR based approaches Uniplex Mul-plex Fluidigm Raindance Mul-plicon Longrange PCR products Raindance

40 RNA Sequencing Rapid expression profiling, transcriptome sequencing and small RNA s

41 RNA-seq

42 RNAseq: Gene Expression through sequencing Supports discovery, screening, and profiling Does not require prior gene knowledge or annota-on Unique combina-on of Qualita-ve and quan-ta-ve measurement Digital counts vs analog intensi-es Increased dynamic range and sensi-vity No probes or primers Any species - Even when reference genome not available Analyze gene expression

43 RNAseq: summary Coun-ng or Profiling 10 million total reads of 35 bp length from poly- A selected RNA will give performance bener than any microarray Studying Alterna-ve Splicing or quan-fying csnps for most transcripts Deeper profiling of 50 to 100 million reads, with read lengths of 50 to 100 bps, from poly- A selected RNA using mrna- Seq assay Complete Annota-on of an en-rely New Transcriptome ~500 Million reads of 100 bp read length from mul-ple -ssues Normalized stranded mrna- Seq & ncrnas Small RNA- Seq for micrornas

44 PART III: NGS workflow data collec-on and processing the exome sequencing pipeline

45 Whole Exome Sequencing The human genome Genome = 3Gb Exome = 30Mb exons Protein coding genes cons-tute only approximately 1% of the human genome It is es-mated that 85% of the muta-ons with large effects on disease- related traits can be found in exons or splice sites

46 Exome sequencing gdna 3 Gb Exome 38Mb NGS

47 The past, present & future exome capture Seq - 2.5Gbases total cost Jeroen Van Houdt - 1/01/2010 Genomics Core - UZ Leuven- KU Leuven 1/08/2010 1/01/2011

48 Exome sequencing capacity HiSeq specifica-ons: 2 flow cells 16 lanes (8 per flow cell) Gbases per flow cell 10 days for a single run Exome throughput 60x coverage per run 60x coverage per year

49 Exome sequencing

50 Data processing workflow Data forma ng & QC Mapping & QC Variant calling Variant annota-on Variant filtering/comparison

51 DATA GENERATION DATA PROCESSING DATA STORAGE INTERPRETATION RESULTS REPORTING & VALIDATION

52 DATA GENERATION Prepare sample library Perfom exome capture Perform sequencing

53 DATA GENERATION Prepare sample library Perfom exome capture Perform sequencing

54 DATA GENERATION Prepare sample library Perfom exome capture Perform sequencing

55 DATA GENERATION DATA PROCESSING DATA STORAGE Image processing Base calling Sequence Data Gb / exome

56

57 NGS data processing: overview 1 Mapping Duplicate marking Local realignment Base quality recalibra-on Analysis- ready mapped reads

58 DATA GENERATION DATA PROCESSING DATA STORAGE Image processing Base calling Sequence Data Gb / exome QC sequencing Mapping sequences QC capture exp

59 DATA PROCESSING QC NGS Mapping QC HC

60 DATA PROCESSING QC NGS Mapping QC HC

61 DATA GENERATION DATA PROCESSING DATA STORAGE Image processing Base calling Sequence Data Gb / exome QC sequencing Mapping sequences QC capture exp Mapping results 5 Gb / exome Variant Calling Variant Annota-on

62

63

64

65 DATA GENERATION DATA PROCESSING DATA STORAGE Image processing Base calling Sequence Data Gb / exome QC sequencing Mapping sequences QC capture exp Mapping results 5 Gb / exome Variant Calling Variant Annota-on Variant Calls 100Mb / exome

66 SNPs vs Indels INDEL SNP

67 exonic vs non-exonic stopgain SNV nonsynonymous SNV nonframeshih inser-on nonframeshih dele-on non- coding frameshih inser-on frameshih dele-on

68 Exonic synonymous SNV stoploss SNV stopgain SNV nonsynonymous SNV nonframeshih inser-on nonframeshih dele-on frameshih inser-on frameshih dele-on

69 Exonic stoploss SNV stopgain SNV nonframeshih inser-on nonframeshih dele-on frameshih inser-on frameshih dele-on

70 DATA GENERATION DATA PROCESSING DATA STORAGE Image processing Base calling Sequence Data Gb / exome QC sequencing Mapping sequences QC capture exp Mapping results 5 Gb / exome Variant Calling Variant Annota-on Variant Calls 100Mb / exome Variant Filtering Database known Variants Public & Private

71

72 DATA GENERATION DATA PROCESSING DATA STORAGE Image processing Base calling Sequence Data Gb / exome INTERPRETATION QC sequencing Mapping sequences QC capture exp Mapping results 5 Gb / exome RESULTS Validated variants in candidate genes Variant Calling Variant Annota-on Variant Calls 100Mb / exome REPORTING & VALIDATION Variant Filtering Database known Variants Public & Private

73 DNA Sequencing the next generation 11/10/13

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977

More information

Automated DNA sequencing 20/12/2009. Next Generation Sequencing

Automated DNA sequencing 20/12/2009. Next Generation Sequencing DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing

More information

July 7th 2009 DNA sequencing

July 7th 2009 DNA sequencing July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer

More information

Introduction to next-generation sequencing data

Introduction to next-generation sequencing data Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS

More information

NGS data analysis. Bernardo J. Clavijo

NGS data analysis. Bernardo J. Clavijo NGS data analysis Bernardo J. Clavijo 1 A brief history of DNA sequencing 1953 double helix structure, Watson & Crick! 1977 rapid DNA sequencing, Sanger! 1977 first full (5k) genome bacteriophage Phi X!

More information

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,

More information

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

RNAseq / ChipSeq / Methylseq and personalized genomics

RNAseq / ChipSeq / Methylseq and personalized genomics RNAseq / ChipSeq / Methylseq and personalized genomics 7711 Lecture Subhajyo) De, PhD Division of Biomedical Informa)cs and Personalized Biomedicine, Department of Medicine University of Colorado School

More information

Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office

Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office 2013 Laboratory Accreditation Program Audioconferences and Webinars Implementing Next Generation Sequencing (NGS) as a Clinical Tool in the Laboratory Nazneen Aziz, PhD Director, Molecular Medicine Transformation

More information

Introduction to NGS data analysis

Introduction to NGS data analysis Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High

More information

Overview of Next Generation Sequencing platform technologies

Overview of Next Generation Sequencing platform technologies Overview of Next Generation Sequencing platform technologies Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Outline 1. Technologies

More information

PreciseTM Whitepaper

PreciseTM Whitepaper Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis

More information

G E N OM I C S S E RV I C ES

G E N OM I C S S E RV I C ES GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E

More information

SEQUENCING. From Sample to Sequence-Ready

SEQUENCING. From Sample to Sequence-Ready SEQUENCING From Sample to Sequence-Ready ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES, NOT ONCE, BUT EVERY TIME The highest-quality amplicons more sensitive, accurate, and specific Full support for all major

More information

Next Generation Sequencing: Technology, Mapping, and Analysis

Next Generation Sequencing: Technology, Mapping, and Analysis Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took

More information

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing

More information

Single-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples

Single-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples DATA Sheet Single-Cell DNA Sequencing with the C 1 Single-Cell Auto Prep System Reveal hidden populations and genetic diversity within complex samples Single-cell sensitivity Discover and detect SNPs,

More information

New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova

New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova New generation sequencing: current limits and future perspectives Giorgio Valle CRIBI Università di Padova Around 2004 the Race for the 1000$ Genome started A few questions... When? How? Why? Standard

More information

Data Analysis for Ion Torrent Sequencing

Data Analysis for Ion Torrent Sequencing IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page

More information

Next Generation Sequencing for DUMMIES

Next Generation Sequencing for DUMMIES Next Generation Sequencing for DUMMIES Looking at a presentation without the explanation from the author is sometimes difficult to understand. This document contains extra information for some slides that

More information

14/12/2012. HLA typing - problem #1. Applications for NGS. HLA typing - problem #1 HLA typing - problem #2

14/12/2012. HLA typing - problem #1. Applications for NGS. HLA typing - problem #1 HLA typing - problem #2 www.medical-genetics.de Routine HLA typing by Next Generation Sequencing Kaimo Hirv Center for Human Genetics and Laboratory Medicine Dr. Klein & Dr. Rost Lochhamer Str. 9 D-8 Martinsried Tel: 0800-GENETIK

More information

BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls?

BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? Giovanni Luca Scaglione, PhD ------------------------ Laboratory of Clinical Molecular Diagnostics and Personalized Medicine, Institute

More information

Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation

Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation PN 100-9879 A1 TECHNICAL NOTE Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation Introduction Cancer is a dynamic evolutionary process of which intratumor genetic and phenotypic

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing DNA sequence represents a single format onto which a broad range of biological phenomena can be projected for high-throughput data collection Over the past three years, massively

More information

TruSeq Custom Amplicon v1.5

TruSeq Custom Amplicon v1.5 Data Sheet: Targeted Resequencing TruSeq Custom Amplicon v1.5 A new and improved amplicon sequencing solution for interrogating custom regions of interest. Highlights Figure 1: TruSeq Custom Amplicon Workflow

More information

Computational Genomics. Next generation sequencing (NGS)

Computational Genomics. Next generation sequencing (NGS) Computational Genomics Next generation sequencing (NGS) Sequencing technology defies Moore s law Nature Methods 2011 Log 10 (price) Sequencing the Human Genome 2001: Human Genome Project 2.7G$, 11 years

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

Focusing on results not data comprehensive data analysis for targeted next generation sequencing

Focusing on results not data comprehensive data analysis for targeted next generation sequencing Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes

More information

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long

More information

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research March 17, 2011 Rendez-Vous Séquençage Presentation Overview Core Technology Review Sequence Enrichment Application

More information

Illumina Sequencing Technology

Illumina Sequencing Technology Illumina Sequencing Technology Highest data accuracy, simple workflow, and a broad range of applications. Introduction Figure 1: Illumina Flow Cell Illumina sequencing technology leverages clonal array

More information

School of Nursing. Presented by Yvette Conley, PhD

School of Nursing. Presented by Yvette Conley, PhD Presented by Yvette Conley, PhD What we will cover during this webcast: Briefly discuss the approaches introduced in the paper: Genome Sequencing Genome Wide Association Studies Epigenomics Gene Expression

More information

TGC AT YOUR SERVICE. Taking your research to the next generation

TGC AT YOUR SERVICE. Taking your research to the next generation TGC AT YOUR SERVICE Taking your research to the next generation 1. TGC At your service 2. Applications of Next Generation Sequencing 3. Experimental design 4. TGC workflow 5. Sample preparation 6. Illumina

More information

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold

More information

DNA Sequencing & The Human Genome Project

DNA Sequencing & The Human Genome Project DNA Sequencing & The Human Genome Project An Endeavor Revolutionizing Modern Biology Jutta Marzillier, Ph.D Lehigh University Biological Sciences November 13 th, 2013 Guess, who turned 60 earlier this

More information

IMBB 2013. Genomic DNA purifica8on

IMBB 2013. Genomic DNA purifica8on IMBB 2013 Genomic DNA purifica8on Why purify DNA? The purpose of DNA purifica8on from the cell/8ssue is to ensure it performs well in subsequent downstream applica8ons, e.g. Polymerase Chain Reac8on (PCR),

More information

Dal proge*o genoma umano ad oggi: evoluzione delle tecniche di sequenziamento, analisi genomica e proteomica e prospe9ve future!

Dal proge*o genoma umano ad oggi: evoluzione delle tecniche di sequenziamento, analisi genomica e proteomica e prospe9ve future! Dal proge*o genoma umano ad oggi: evoluzione delle tecniche di sequenziamento, analisi genomica e proteomica e prospe9ve future! David Horner Dipar.mento di Bioscienze Università degli Studi di Milano

More information

Concepts and methods in sequencing and genome assembly

Concepts and methods in sequencing and genome assembly BCM-2004 Concepts and methods in sequencing and genome assembly B. Franz LANG, Département de Biochimie Bureau: H307-15 Courrier électronique: Franz.Lang@Umontreal.ca Outline 1. Concepts in DNA and RNA

More information

Core Facility Genomics

Core Facility Genomics Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray

More information

NGS Technologies for Genomics and Transcriptomics

NGS Technologies for Genomics and Transcriptomics NGS Technologies for Genomics and Transcriptomics Massimo Delledonne Department of Biotechnologies - University of Verona http://profs.sci.univr.it/delledonne 13 years and $3 billion required for the Human

More information

New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.

New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc. New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System

More information

Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe

Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. To published results faster With proven scalability To the forefront of discovery To limitless applications

More information

History of DNA Sequencing & Current Applications

History of DNA Sequencing & Current Applications History of DNA Sequencing & Current Applications Christopher McLeod President & CEO, 454 Life Sciences, A Roche Company IMPORTANT NOTICE Intended Use Unless explicitly stated otherwise, all Roche Applied

More information

Introduction Bioo Scientific

Introduction Bioo Scientific Next Generation Sequencing Catalog 2014-2015 Introduction Bioo Scientific Bioo Scientific is a global life science company headquartered in Austin, TX, committed to providing innovative products and superior

More information

How is genome sequencing done?

How is genome sequencing done? How is genome sequencing done? Using 454 Sequencing on the Genome Sequencer FLX System, DNA from a genome is converted into sequence data through four primary steps: Step One DNA sample preparation; Step

More information

An Introduction to Next-Generation Sequencing for in vitro Fertilization

An Introduction to Next-Generation Sequencing for in vitro Fertilization An Introduction to Next-Generation Sequencing for in vitro Fertilization www.illumina.com/ivfprimer Table of Contents Part I. Welcome to Next-Generation Sequencing 3 NGS for in vitro Fertilization 3 Part

More information

NEXT GENERATION SEQUENCING

NEXT GENERATION SEQUENCING NEXT GENERATION SEQUENCING Dr. R. Piazza SANGER SEQUENCING + DNA NEXT GENERATION SEQUENCING Flowcell NEXT GENERATION SEQUENCING Library di DNA Genomic DNA NEXT GENERATION SEQUENCING NEXT GENERATION SEQUENCING

More information

Services. Updated 05/31/2016

Services. Updated 05/31/2016 Updated 05/31/2016 Services 1. Whole exome sequencing... 2 2. Whole Genome Sequencing (WGS)... 3 3. 16S rrna sequencing... 4 4. Customized gene panels... 5 5. RNA-Seq... 6 6. qpcr... 7 7. HLA typing...

More information

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

The NGS IT notes. George Magklaras PhD RHCE

The NGS IT notes. George Magklaras PhD RHCE The NGS IT notes George Magklaras PhD RHCE Biotechnology Center of Oslo & The Norwegian Center of Molecular Medicine University of Oslo, Norway http://www.biotek.uio.no http://www.ncmm.uio.no http://www.no.embnet.org

More information

The author(s) shown below used Federal funds provided by the U.S. Department of Justice and prepared the following final report:

The author(s) shown below used Federal funds provided by the U.S. Department of Justice and prepared the following final report: The author(s) shown below used Federal funds provided by the U.S. Department of Justice and prepared the following final report: Document Title: Author(s): Resolution of DNA Mixtures and Analysis of Degraded

More information

Targeted. sequencing solutions. Accurate, scalable, fast TARGETED

Targeted. sequencing solutions. Accurate, scalable, fast TARGETED Targeted TARGETED Sequencing sequencing solutions Accurate, scalable, fast Sequencing for every lab, every budget, every application Ion Torrent semiconductor sequencing Ion Torrent technology has pioneered

More information

Microbial Oceanomics using High-Throughput DNA Sequencing

Microbial Oceanomics using High-Throughput DNA Sequencing Microbial Oceanomics using High-Throughput DNA Sequencing Ramiro Logares Institute of Marine Sciences, CSIC, Barcelona 9th RES Users'Conference 23 September 2015 Importance of microbes in the sunlit ocean

More information

Assuring the Quality of Next-Generation Sequencing in Clinical Laboratory Practice. Supplementary Guidelines

Assuring the Quality of Next-Generation Sequencing in Clinical Laboratory Practice. Supplementary Guidelines Assuring the Quality of Next-Generation Sequencing in Clinical Laboratory Practice Next-generation Sequencing: Standardization of Clinical Testing (Nex-StoCT) Workgroup Principles and Guidelines Supplementary

More information

Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University

Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University Genotyping by sequencing and data analysis Ross Whetten North Carolina State University Stein (2010) Genome Biology 11:207 More New Technology on the Horizon Genotyping By Sequencing Timeline 2007 Complexity

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID papillary renal cell carcinoma (translocation-associated) PRCC Human This gene

More information

Techniques in Molecular Biology (to study the function of genes)

Techniques in Molecular Biology (to study the function of genes) Techniques in Molecular Biology (to study the function of genes) Analysis of nucleic acids: Polymerase chain reaction (PCR) Gel electrophoresis Blotting techniques (Northern, Southern) Gene expression

More information

FOR REFERENCE PURPOSES

FOR REFERENCE PURPOSES BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit

More information

GenomeStudio Data Analysis Software

GenomeStudio Data Analysis Software GenomeStudio Analysis Software Illumina has created a comprehensive suite of data analysis tools to support a wide range of genetic analysis assays. This single software package provides data visualization

More information

Athanasia Pavlopoulou University of Thessaly, Lamia June 2015

Athanasia Pavlopoulou University of Thessaly, Lamia June 2015 Athanasia Pavlopoulou University of Thessaly, Lamia June 2015 Early DNA Sequencing Technologies Early efforts at DNA sequencing were: o tedious o time consuming o labor intensive Frederick Sanger (Sanger

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

Next Generation Sequencing data Analysis at Genoscope. Jean-Marc Aury

Next Generation Sequencing data Analysis at Genoscope. Jean-Marc Aury Next Generation Sequencing data Analysis at Genoscope Jean-Marc Aury Introduction Presentation of Genoscope and NGS activities Overview of sequencing technologies Sequencing and assembly of prokaryotic

More information

Biotechnology: DNA Technology & Genomics

Biotechnology: DNA Technology & Genomics Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

How Sequencing Experiments Fail

How Sequencing Experiments Fail How Sequencing Experiments Fail v1.0 Simon Andrews simon.andrews@babraham.ac.uk Classes of Failure Technical Tracking Library Contamination Biological Interpretation Something went wrong with a machine

More information

8/7/2012. Experimental Design & Intro to NGS Data Analysis. Examples. Agenda. Shoe Example. Breast Cancer Example. Rat Example (Experimental Design)

8/7/2012. Experimental Design & Intro to NGS Data Analysis. Examples. Agenda. Shoe Example. Breast Cancer Example. Rat Example (Experimental Design) Experimental Design & Intro to NGS Data Analysis Ryan Peters Field Application Specialist Partek, Incorporated Agenda Experimental Design Examples ANOVA What assays are possible? NGS Analytical Process

More information

A Primer of Genome Science THIRD

A Primer of Genome Science THIRD A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:

More information

Data Analysis & Management of High-throughput Sequencing Data. Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute

Data Analysis & Management of High-throughput Sequencing Data. Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute Data Analysis & Management of High-throughput Sequencing Data Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute Current Issues Current Issues The QSEQ file Number files per

More information

Next Generation Sequencing: Adjusting to Big Data. Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013

Next Generation Sequencing: Adjusting to Big Data. Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013 Next Generation Sequencing: Adjusting to Big Data Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013 Outline Human Genome Project Next-Generation Sequencing Personalized Medicine

More information

NECC History. Karl V. Steiner 2011 Annual NECC Meeting, Orono, Maine March 15, 2011

NECC History. Karl V. Steiner 2011 Annual NECC Meeting, Orono, Maine March 15, 2011 NECC History Karl V. Steiner 2011 Annual NECC Meeting, Orono, Maine March 15, 2011 EPSCoR Cyberinfrastructure Workshop First regional NENI (now NECC) Workshop held in Vermont in August 2007 Workshop heldinkentucky

More information

Next Generation Sequencing; Technologies, applications and data analysis

Next Generation Sequencing; Technologies, applications and data analysis ; Technologies, applications and data analysis Course 2542 Dr. Martie C.M. Verschuren Research group Analysis techniques in Life Science, Breda Prof. dr. Johan T. den Dunnen Leiden Genome Technology Center,

More information

Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat

Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat Bioinformatique et Séquençage Haut Débit, Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat 1 RNA Transcription to RNA and subsequent

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

The Chinese University of Hong Kong igem 2010 Bacterial based storage and encryp2on device

The Chinese University of Hong Kong igem 2010 Bacterial based storage and encryp2on device The Chinese University of Hong Kong igem 2010 Bacterial based storage and encryp2on device Bacterial based informaaon storage device Bancro4 s group (2001) Mount Sinai School of Meducube Yachie s group

More information

Q&A: Kevin Shianna on Ramping up Sequencing for the New York Genome Center

Q&A: Kevin Shianna on Ramping up Sequencing for the New York Genome Center Q&A: Kevin Shianna on Ramping up Sequencing for the New York Genome Center Name: Kevin Shianna Age: 39 Position: Senior vice president, sequencing operations, New York Genome Center, since July 2012 Experience

More information

GenomeStudio Data Analysis Software

GenomeStudio Data Analysis Software GenomeStudio Data Analysis Software Illumina has created a comprehensive suite of data analysis tools to support a wide range of genetic analysis assays. This single software package provides data visualization

More information

Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms

Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Introduction Mate pair sequencing enables the generation of libraries with insert sizes in the range of several kilobases (Kb).

More information

Key Principles and Clinical Applications of "Next-Generation" DNA Sequencing

Key Principles and Clinical Applications of Next-Generation DNA Sequencing Review Cancer Prevention Research Key Principles and Clinical Applications of "Next-Generation" DNA Sequencing Jason M. Rizzo and Michael J. Buck Abstract Demand for fast, inexpensive, and accurate DNA

More information

The Steps. 1. Transcription. 2. Transferal. 3. Translation

The Steps. 1. Transcription. 2. Transferal. 3. Translation Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order

More information

Analysis of NGS Data

Analysis of NGS Data Analysis of NGS Data Introduction and Basics Folie: 1 Overview of Analysis Workflow Images Basecalling Sequences denovo - Sequencing Assembly Annotation Resequencing Alignments Comparison to reference

More information

An example of bioinformatics application on plant breeding projects in Rijk Zwaan

An example of bioinformatics application on plant breeding projects in Rijk Zwaan An example of bioinformatics application on plant breeding projects in Rijk Zwaan Xiangyu Rao 17-08-2012 Introduction of RZ Rijk Zwaan is active worldwide as a vegetable breeding company that focuses on

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information

Next Generation Sequencing; Technologies, applications and data analysis

Next Generation Sequencing; Technologies, applications and data analysis ; Technologies, applications and data analysis Course 2542 Dr. Martie C.M. Verschuren Research group Analysis techniques in Life Science, Breda Prof. dr. Johan T. den Dunnen Leiden Genome Technology Center,

More information

Real-time quantitative RT -PCR (Taqman)

Real-time quantitative RT -PCR (Taqman) Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR

More information

UCLA Team Sequences Cell Line, Puts Open Source Software Framework into Production

UCLA Team Sequences Cell Line, Puts Open Source Software Framework into Production Page 1 of 6 UCLA Team Sequences Cell Line, Puts Open Source Software Framework into Production February 05, 2010 Newsletter: BioInform BioInform - February 5, 2010 By Vivien Marx Scientists at the department

More information

High Performance Compu2ng Facility

High Performance Compu2ng Facility High Performance Compu2ng Facility Center for Health Informa2cs and Bioinforma2cs Accelera2ng Scien2fic Discovery and Innova2on in Biomedical Research at NYULMC through Advanced Compu2ng Efstra'os Efstathiadis,

More information

Overview sequence projects

Overview sequence projects Overview sequence projects Bioassist NGS meeting 15-01-2010 Barbera van Schaik KEBB - Bioinformatics Laboratory b.d.vanschaik@amc.uva.nl NGS at the Academic Medical Center Sequence facility Laboratory

More information

GeneSifter: Next Generation Data Management and Analysis for Next Generation Sequencing

GeneSifter: Next Generation Data Management and Analysis for Next Generation Sequencing for Next Generation Sequencing Dale Baskin, N. Eric Olson, Laura Lucas, Todd Smith 1 Abstract Next generation sequencing technology is rapidly changing the way laboratories and researchers approach the

More information

Delivering the power of the world s most successful genomics platform

Delivering the power of the world s most successful genomics platform Delivering the power of the world s most successful genomics platform NextCODE Health is bringing the full power of the world s largest and most successful genomics platform to everyday clinical care NextCODE

More information

Human Genome and Human Genome Project. Louxin Zhang

Human Genome and Human Genome Project. Louxin Zhang Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular

More information

Disease gene identification with exome sequencing

Disease gene identification with exome sequencing Disease gene identification with exome sequencing Christian Gilissen Dept. of Human Genetics Radboud University Nijmegen Medical Centre c.gilissen@antrg.umcn.nl Contents Infrastructure Exome sequencing

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

DNA Sequencing and PCR Markets

DNA Sequencing and PCR Markets Brochure More information from http://www.researchandmarkets.com/reports/41864/ DNA Sequencing and PCR Markets Description: DNA sequencing and polymerase chain reaction (PCR) are two major technology platforms

More information

Human Genome Organization: An Update. Genome Organization: An Update

Human Genome Organization: An Update. Genome Organization: An Update Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion

More information

Nicolas Pons INRA Ins(tut Micalis Plateforme MetaQuant Jouy- en- Josas, France

Nicolas Pons INRA Ins(tut Micalis Plateforme MetaQuant Jouy- en- Josas, France Nicolas Pons INRA Ins(tut Micalis Plateforme MetaQuant Jouy- en- Josas, France Special Science Online Collec-on: Dealing with Data (feb 2011) DNA Protein TTGTGGATAACCTCAAAACTTTTCTCTTTCTGACCTGTGGAAAACTTTTTCGTTTTATGATAGAATCAGAGGACAAGAATAAAGA!

More information

DNA Sequence Analysis

DNA Sequence Analysis DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide

More information

An Overview of DNA Sequencing

An Overview of DNA Sequencing An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure

More information

Welcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation.

Welcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation. Introduction to SMRTbell Template Preparation 100 338 500 01 1. SMRTbell Template Preparation 1.1 Introduction to SMRTbell Template Preparation Welcome to Pacific Biosciences' Introduction to SMRTbell

More information