The Structure and Function of DNA

Size: px
Start display at page:

Download "The Structure and Function of DNA"


1 Chapter 0 The Structure and Function of PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey, and Jane B. Reece Lectures by Edward J. Zalisko Animation: and RNA Structure Right click slide / select Play : STRUCTURE AND REPLICATION was known to be a chemical in cells by the end of the nineteenth century, has the capacity to store genetic information, and can be copied and passed from generation to generation. The discovery of as the hereditary material ushered in the new field of molecular biology, the study of heredity at the molecular level. Animation: Hershey-Chase Experiment Right click slide / select Play and RNA Structure Figure 0. and RNA are nucleic acids. Phosphate group Nitrogenous base They consist of chemical units called nucleotides. A nucleotide polymer is a polynucleotide. Sugar nucleotide Nitrogenous base (can be A, G, C, or T) Thymine (T) Nucleotides are joined by covalent bonds between the sugar of one nucleotide and the phosphate of the next, forming a sugar-phosphate backbone. double helix Phosphate group Sugar (deoxyribose) nucleotide Polynucleotide Sugar-phosphate backbone

2 Figure 0.a Phosphate group Nitrogenous base Figure 0. RNA polynucleotide Cytosine Sugar nucleotide Nitrogenous base (can be A, G, C, or T) Thymine (T) Guanine Adenine Uracil Phosphate group Sugar (deoxyribose) Phosphate nucleotide Sugar (ribose) Polynucleotide Sugar-phosphate backbone and RNA Structure Watson and Crick s Discovery of the Double Helix The sugar in is deoxyribose. Thus, the full name for is deoxyribonucleic acid. James Watson and Francis Crick determined that is a double helix. Watson and Crick used X-ray crystallography data to reveal the basic shape of. Rosalind Franklin produced the X-ray image of. and RNA Structure Figure 0.3b The four nucleotides found in differ in their nitrogenous bases. These bases are thymine (T), cytosine (C), adenine (A), and guanine (G). RNA has uracil (U) in place of thymine. Rosalind Franklin X-ray images of

3 Figure 0.3a Watson and Crick s Discovery of the Double Helix bases pair in a complementary fashion: adenine (A) pairs with thymine (T) and cytosine (C) pairs with guanine (G). James Watson (left) and Francis Crick Watson and Crick s Discovery of the Double Helix Figure 0.5 The model of is like a rope ladder twisted into a spiral. Hydrogen bond The ropes at the sides represent the sugarphosphate backbones. Each wooden rung represents a pair of bases connected by hydrogen bonds. (a) Ribbon model (b) Atomic model (c) Computer model Figure Twist Blast Animation: Structure of Double Helix Select Play

4 Figure 0.6 Parental (old) molecule Daughter (new) strand Parental (old) strand Blast Animation: Hydrogen Bonds in Select Play Daughter molecules (double helices) Replication Replication When a cell reproduces, a complete copy of the must pass from one generation to the next. Watson and Crick s model for suggested that replicates by a template mechanism. can be damaged by X-rays and ultraviolet light. polymerases are enzymes, make the covalent bonds between the nucleotides of a new strand, and are involved in repairing damaged. Replication replication ensures that all the body cells in multicellular organisms carry the same genetic information. 4 Bioflix Animation: Replication

5 Replication replication in eukaryotes begins at specific sites on a double helix (called origins of replication) and proceeds in both directions. Animation: Lagging Strand Right click slide / select Play Figure 0.7 Origin of replication Parental strands Origin of replication Origin of replication Parental strand Daughter strand Bubble Animation: Origins of Replication Right click slide / select Play Two daughter molecules THE FLOW OF GENETIC INFORMATION FROM TO RNA TO PROTEIN provides instructions to a cell and an organism as a whole. 5 Animation: Leading Strand Right click slide / select Play

6 How an Organism s Genotype Determines Its Phenotype An organism s genotype is its genetic makeup, the sequence of nucleotide bases in. Figure 0.8- The phenotype is the organism s physical traits, which arise from the actions of a wide variety of proteins. Cytoplasm How an Organism s Genotype Determines Its Phenotype specifies the synthesis of proteins in two stages: Figure 0.8- TRANSCRIPTION. transcription, the transfer of genetic information from into an RNA molecule and. translation, the transfer of information from RNA into a protein. RNA Cytoplasm Figure TRANSCRIPTION RNA Cytoplasm 6 TRANSLATION Bioflix Animation: Protein Synthesis Protein

7 From Nucleotides to Amino Acids: An Overview From Nucleotides to Amino Acids: An Overview Genetic information in is transcribed into RNA, then translated into polypeptides, which then fold into proteins. Experiments have verified that the flow of information from gene to protein is based on a triplet code. A codon is a triplet of bases, which codes for one amino acid. From Nucleotides to Amino Acids: An Overview The Genetic Code What is the language of nucleic acids? In, it is the linear sequence of nucleotide bases. A typical gene consists of thousands of nucleotides in a specific sequence. When a segment of is transcribed, the result is an RNA molecule. The genetic code is the set of rules that convert a nucleotide sequence in RNA to an amino acid sequence. Of the 64 triplets, 6 code for amino acids and 3 are stop codons, instructing the ribosomes to end the polypeptide. RNA is then translated into a sequence of amino acids in a polypeptide. Figure 0.0 Figure 0. Second base of RNA codon U C A G Gene Gene Gene 3 strand TRANSCRIPTION RNA TRANSLATION Codon Polypeptide Amino acid molecule First base of RNA codon UUU UUC U UUA UUG CUU CUC C CUA CUG AUU AUC A AUA AUG GUU GUC G GUA GUG Phenylalanine (Phe) Leucine (Leu) Leucine (Leu) Isoleucine (Ile) Met or start Valine (Val) UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Serine (Ser) Proline (Pro) AAC Threonine (Thr) AAA AAG GAU Alanine (Ala) UAU UAC UAA UAG CAU CAC CAA CAG AAU GAC GAA GAG Tyrosine (Tyr) Stop Stop Histidine (His) Glutamine (Gln) Asparagine (Asn) Lysine (Lys) Aspartic acid (Asp) Glutamic acid (Glu) UGU UGC Cysteine (Cys) U C UGA Stop A UGG Tryptophan (Trp) G CGU U CGC Arginine C CGA (Arg) A CGG G AGU Serine U AGC (Ser) C AGA Arginine A AGG (Arg) G GGU U GGC Glycine C GGA (Gly) A GGG G Third base of RNA codon 7

8 The Genetic Code Transcription: From to RNA Because diverse organisms share a common genetic code, it is possible to program one species to produce a protein from another species by transplanting. RNA nucleotides are linked by the transcription enzyme. Figure 0. Animation: Transcription Right click slide / select Play Transcription: From to RNA Figure 0.3a Transcription makes RNA from a template, uses a process that resembles the synthesis of a strand during replication, and substitutes uracil (U) for thymine (T). Newly made RNA RNA nucleotides RNA polymerase Direction of transcription Template strand of (a) A close-up view of transcription 8

9 Figure 0.3b Termination of Transcription Promoter Initiation of gene Terminator During the third phase of transcription, called termination, RNA Elongation reaches a special sequence of bases in the template called a terminator, signaling the end of the gene, 3 Termination Growing RNA polymerase detaches from the RNA and the gene, and Completed RNA the strands rejoin. (b) Transcription of a gene Initiation of Transcription The Processing of Eukaryotic RNA The start transcribing signal is a nucleotide sequence called a promoter, which is located in the at the beginning of the gene and a specific place where attaches. The first phase of transcription is initiation, in which attaches to the promoter and RNA synthesis begins. In the cells of prokaryotes, RNA transcribed from a gene immediately functions as messenger RNA (), the molecule that is translated into protein. The eukaryotic cell localizes transcription in the nucleus and modifies, or processes, the RNA transcripts in the nucleus before they move to the cytoplasm for translation by ribosomes. RNA Elongation The Processing of Eukaryotic RNA During the second phase of transcription, called elongation, the RNA grows longer and the RNA strand peels away from its template. RNA processing includes adding a cap and tail consisting of extra nucleotides at the ends of the RNA transcript, removing introns (noncoding regions of the RNA), and RNA splicing, joining exons (the parts of the gene that are expressed) together to form messenger RNA (). 9

10 The Processing of Eukaryotic RNA Messenger RNA () RNA splicing is believed to play a significant role in humans in allowing our approximately,000 genes to produce many thousands more polypeptides and by varying the exons that are included in the final. Translation requires, ATP, enzymes, ribosomes, and transfer RNA (trna). Figure 0.4 Transfer RNA (trna) RNA transcript with cap and tail Cap Transcription Addition of cap and tail s removed Tail Exons spliced together Coding sequence Transfer RNA (trna) acts as a molecular interpreter, carries amino acids, and matches amino acids with codons in using anticodons, a special triplet of bases that is complementary to a codon triplet on. Cytoplasm Translation: The Players Figure 0.5 Amino acid attachment site Translation is the conversion from the nucleic acid language to the protein language. Hydrogen bond RNA polynucleotide chain 0 trna polynucleotide (ribbon model) trna (simplified representation)

11 Ribosomes Ribosomes are organelles that coordinate the functions of and trna and are made of two subunits. Figure 0.6b Growing polypeptide Next amino acid to be added to polypeptide Each subunit is made up of proteins and a considerable amount of another kind of RNA, ribosomal RNA (rrna). trna Codons (b) The players of translation Ribosomes Translation: The Process A fully assembled ribosome holds trna and for use in translation. Translation is divided into three phases:. initiation,. elongation, and 3. termination. Figure 0.6a Initiation trna binding sites Initiation brings together P site A site, binding site Large subunit Small subunit Ribosome the first amino acid with its attached trna, and two subunits of the ribosome. The molecule has a cap and tail that help the bind to the ribosome. (a) A simplified diagram of a ribosome

12 Figure 0.7 Cap Start of genetic message End Tail Blast Animation: Translation Select Play Initiation Figure 0.8 Initiation occurs in two steps.. An molecule binds to a small ribosomal subunit, then a special initiator trna binds to the start codon, where translation is to begin on the. Initiator trna Met P site Large ribosomal subunit A site. A large ribosomal subunit binds to the small one, creating a functional ribosome. Start codon Small ribosomal subunit Elongation Elongation occurs in three steps. Step : Codon recognition. The anticodon of an incoming trna pairs with the codon at the A site of the ribosome. Animation: Translation Right click slide / select Play

13 Figure 0.9 Polypeptide Amino acid Elongation P site A site Step 3: Translocation. The P site trna leaves the ribosome. Codons Codon recognition The trna carrying the polypeptide moves from the A to the P site. ELONGATION Stop codon Peptide bond formation New peptide bond movement 3 Translocation Elongation Figure 0.9b Step : Peptide bond formation. The polypeptide leaves the trna in the P site and attaches to the amino acid on the trna in the A site. New peptide bond The ribosome catalyzes the bond formation between the two amino acids. movement Translocation ELONGATION Stop codon Figure 0.9a Termination Polypeptide Amino acid Elongation continues until a stop codon reaches the ribosome s A site, P site A site Codons Codon recognition Peptide bond formation ELONGATION the completed polypeptide is freed, and the ribosome splits back into its subunits. 3

14 Review: RNA Protein Figure Transcription In a cell, genetic information flows from to RNA in the nucleus and RNA to protein in the cytoplasm. Tail RNA processing Cap Amino acid trna ATP Enzyme 3 Amino acid attachment Figure 0.0- Figure Transcription Transcription RNA processing Tail Cap Amino acid trna Enzyme ATP 3 Amino acid attachment 4 A Initiation of translation Ribosomal subunits Figure 0.0- Figure Transcription Transcription Tail RNA processing Cap Tail RNA processing Cap Codon 5 Elongation Amino acid 4 trna Enzyme ATP 3 Amino acid attachment 4 A Initiation of translation Ribosomal subunits

15 Figure Transcription Tail RNA processing Cap Codon 5 Elongation Polypeptide Amino acid trna Enzyme ATP 3 Amino acid attachment A Ribosomal subunits 4 Initiation of 6 translation Termination Stop codon Review: RNA Protein As it is made, a polypeptide coils and folds and assumes a three-dimensional shape, its tertiary structure. Transcription and translation are how genes control the structures and activities of cells. 5

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

Molecular Facts and Figures

Molecular Facts and Figures Nucleic Acids Molecular Facts and Figures DNA/RNA bases: DNA and RNA are composed of four bases each. In DNA the four are Adenine (A), Thymidine (T), Cytosine (C), and Guanine (G). In RNA the four are

More information

Section 1 Workbook (unit 2) ANSWERS

Section 1 Workbook (unit 2) ANSWERS Section 1 Workbook (unit 2) ANSWERS Complete the following table: nucleotide DNA RN Name: B5. Describe DNA replication 1) Label each base given in the diagram below and describe the 4 primary characteristics

More information

RNA and Protein Synthesis

RNA and Protein Synthesis RNA and Protein Synthesis Answer Key Vocabulary: amino acid, anticodon, codon, gene, messenger RNA, nucleotide, ribosome, RNA, RNA polymerase, transcription, transfer RNA, translation Prior Knowledge Questions

More information

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects Mutation Mutation provides raw material to evolution Different kinds of mutations have different effects Mutational Processes Point mutation single nucleotide changes coding changes (missense mutations)

More information

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of

More information

Hands on Simulation of Mutation

Hands on Simulation of Mutation Hands on Simulation of Mutation Charlotte K. Omoto P.O. Box 644236 Washington State University Pullman, WA 99164-4236 ABSTRACT This exercise is a hands-on simulation of mutations and their

More information

Gene Finding CMSC 423

Gene Finding CMSC 423 Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would you decipher

More information


PRACTICE TEST QUESTIONS PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.

More information

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme. Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

Ruth Sundeen. Lesson 9 Part 1. Help Your Students Learn. Greetings and felicitations from Mrs. Ruth!

Ruth Sundeen. Lesson 9 Part 1. Help Your Students Learn. Greetings and felicitations from Mrs. Ruth! Ruth Sundeen Lesson 9 Part 1 Help Your Students Learn Ages: Eighth grade to high school senior Topics: Protein Synthesis Enzymes Experiment to demonstrate fragility of enzymes Greetings and felicitations

More information


UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS UIT (12) MLECULE F LIFE: UCLEIC ACID ucleic acids are extremely large molecules that were first isolated from the nuclei of cells. Two kinds of nucleic acids are found in cells: RA (ribonucleic acid) is

More information

( TUTORIAL. (July 2006)

( TUTORIAL. (July 2006) ( TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

Hiding Data in DNA. 1 Introduction

Hiding Data in DNA. 1 Introduction Hiding Data in DNA Boris Shimanovsky *, Jessica Feng +, and Miodrag Potkonjak + * XAP Corporation + Dept. Computer Science, Univ. of California, Los Angeles Abstract. Just like disk or RAM, DNA and RNA

More information

From Gene to Protein Transcription and Translation i

From Gene to Protein Transcription and Translation i From Gene to Protein Transcription and Translation i How do the genes in our DNA influence our characteristics? For example, how can a gene determine whether a person is an albino with very pale skin and

More information

DNA and Protein Synthesis Grade 10

DNA and Protein Synthesis Grade 10 Ohio Standards Connection: Life Sciences Benchmark C Explain the genetic mechanisms and molecular basis of inheritance. Indicator 5 Illustrate the relationship of the structure and function of DNA to protein

More information

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Molecular Genetics. RNA, Transcription, & Protein Synthesis Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and

More information

13.2 Ribosomes & Protein Synthesis

13.2 Ribosomes & Protein Synthesis 13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).

More information

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3 DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can

More information

Pipe Cleaner Proteins. Essential question: How does the structure of proteins relate to their function in the cell?

Pipe Cleaner Proteins. Essential question: How does the structure of proteins relate to their function in the cell? Pipe Cleaner Proteins GPS: SB1 Students will analyze the nature of the relationships between structures and functions in living cells. Essential question: How does the structure of proteins relate to their

More information

DNA pol RNA pol ARS trna Ribosome DNA mrna Protein Transcription Translation Replication A B Acceptor stem D-loop T C loop Anticodon loop Variable loop Relative trna gene copy number 0.0 0.2 0.4

More information

1. Which of the following correctly organizes genetic material from the broadest category to the most specific category?

1. Which of the following correctly organizes genetic material from the broadest category to the most specific category? DNA and Genetics 1. Which of the following correctly organizes genetic material from the broadest category to the most specific category? A. genome chromosome gene DNA molecule B. genome chromosome DNA

More information

Gene Finding. Slides by Carl Kingsford

Gene Finding. Slides by Carl Kingsford Gene Finding Slides by Carl Kingsford Genome of the Cow a sequence of 2.86 billion letters enough letters to fill a million pages of a typical book. TATGGAGCCAGGTGCCTGGGGCAACAAGACTGTGGTCACTGAATTCATCCTTCTTGGTCTAACAGAGAACATAG

More information DNA Bracelets DNA Bracelets DNA Bracelets by Louise Brown Jasko John Anthony Campbell Jack Dennis Cassidy Michael Nickelsburg Stephen Prentis Rohm Objectives: 1) Using plastic beads, construct

More information

Insulin mrna to Protein Kit

Insulin mrna to Protein Kit Insulin mrna to Protein Kit A 3DMD Paper BioInformatics and Mini-Toober Folding Activity Teacher Key and Teacher Notes www. Insulin mrna to Protein Kit Contents Becoming Familiar with the Data... 3 Identifying

More information

II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes

II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes HEREDITY = passing on of characteristics from parents to offspring How?...DNA! I. DNA, Chromosomes, Chromatin, and Genes DNA = blueprint of life (has the instructions for making an organism) Chromatin=

More information

RNA and Protein Synthesis

RNA and Protein Synthesis Name lass Date RN and Protein Synthesis Information and Heredity Q: How does information fl ow from DN to RN to direct the synthesis of proteins? 13.1 What is RN? WHT I KNOW SMPLE NSWER: RN is a nucleic

More information

Protein Synthesis Simulation

Protein Synthesis Simulation Protein Synthesis Simulation Name(s) Date Period Benchmark: SC.912.L.16.5 as AA: Explain the basic processes of transcription and translation, and how they result in the expression of genes. (Assessed

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:

More information

Lab #5: DNA, RNA & Protein Synthesis. Heredity & Human Affairs (Biology 1605) Spring 2012

Lab #5: DNA, RNA & Protein Synthesis. Heredity & Human Affairs (Biology 1605) Spring 2012 Lab #5: DNA, RNA & Protein Synthesis Heredity & Human Affairs (Biology 1605) Spring 2012 DNA Stands for : Deoxyribonucleic Acid Double-stranded helix Made up of nucleotides Each nucleotide= 1. 5-carbon

More information

Biological One-way Functions

Biological One-way Functions Biological One-way Functions Qinghai Gao, Xiaowen Zhang 2, Michael Anshel 3 Dept. Security System, Farmingdale State College / SUNY,

More information

3120-1 - Page 1. Name:

3120-1 - Page 1. Name: Name: 1) Which series is arranged in correct order according to decreasing size of structures? A) DNA, nucleus, chromosome, nucleotide, nitrogenous base B) chromosome, nucleus, nitrogenous base, nucleotide,

More information

Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus

Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus Cao, H.W. and Zhang, H.* College of Biological Science and Technology, HeiLongJiang BaYi Agricultural University, DaQing 163319, China. *

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

Genetics Module B, Anchor 3

Genetics Module B, Anchor 3 Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for

More information

Protein Synthesis How Genes Become Constituent Molecules

Protein Synthesis How Genes Become Constituent Molecules Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein

More information

Unit 9: DNA, RNA, and Proteins. Pig and elephant DNA just don t splice, but why?

Unit 9: DNA, RNA, and Proteins. Pig and elephant DNA just don t splice, but why? Unit 9: DNA, RNA, and Proteins Pig and elephant DNA just don t splice, but why? BONUS - History of DNA Structure of DNA 3.3.1 - Outline DNA nucleotide structure in terms of sugar (deoxyribose), base and

More information

Academic Nucleic Acids and Protein Synthesis Test

Academic Nucleic Acids and Protein Synthesis Test Academic Nucleic Acids and Protein Synthesis Test Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. Each organism has a unique combination

More information

Ms. Campbell Protein Synthesis Practice Questions Regents L.E.

Ms. Campbell Protein Synthesis Practice Questions Regents L.E. Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide

More information

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed

More information

Shu-Ping Lin, Ph.D. E-mail:

Shu-Ping Lin, Ph.D. E-mail: Amino Acids & Proteins Shu-Ping Lin, Ph.D. Institute te of Biomedical Engineering ing E-mail: Website: edu tw/pweb/users/splin/ Date: 10.13.2010

More information

RNA & Protein Synthesis

RNA & Protein Synthesis RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis

More information

Transcription Study Guide

Transcription Study Guide Transcription Study Guide This study guide is a written version of the material you have seen presented in the transcription unit. The cell s DNA contains the instructions for carrying out the work of

More information

DNA. Discovery of the DNA double helix

DNA. Discovery of the DNA double helix DNA Replication DNA Discovery of the DNA double helix A. 1950 s B. Rosalind Franklin - X-ray photo of DNA. C. Watson and Crick - described the DNA molecule from Franklin s X-ray. What is DNA? Question:

More information

Multiple Choice Write the letter that best answers the question or completes the statement on the line provided.

Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. Name lass Date hapter 12 DN and RN hapter Test Multiple hoice Write the letter that best answers the question or completes the statement on the line provided. Pearson Education, Inc. ll rights reserved.

More information

2006 7.012 Problem Set 3 KEY

2006 7.012 Problem Set 3 KEY 2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each

More information

Proteins. Amino Acids. Chapter 3. Molecular Diagnostics Fundamentals, Methods and Clinical Applications Second Edition 2/5/2013

Proteins. Amino Acids. Chapter 3. Molecular Diagnostics Fundamentals, Methods and Clinical Applications Second Edition 2/5/2013 Proteins Chapter 3 Amino Acids Nonpolar Alanine, Ala, A Isoleucine, Ile, I Leucine, Leu, L Methionine, Met, M Phenylalanine, Phe, F Tryptophan,Trp, W Valine, Val, V Negatively Charged (Acidic) Aspartic

More information

Translation. Translation: Assembly of polypeptides on a ribosome

Translation. Translation: Assembly of polypeptides on a ribosome Translation Translation: Assembly of polypeptides on a ribosome Living cells devote more energy to the synthesis of proteins than to any other aspect of metabolism. About a third of the dry mass of a cell

More information

Prep Time: 1 hour. Class Time: 45 minutes

Prep Time: 1 hour. Class Time: 45 minutes ACTIVITY OVERVIEW Abstract: Students use edible models of the DNA molecule to transcribe an mrna sequence, then translate it into a protein. Module: The Basics and Beyond Prior Knowledge Needed: A basic

More information

Lecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure

Lecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure Lecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure Nucleic acids play an important role in the storage and expression of genetic information. They are divided into

More information

Basic Concepts of DNA, Proteins, Genes and Genomes

Basic Concepts of DNA, Proteins, Genes and Genomes Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate

More information

Answer: 2. Uracil. Answer: 2. hydrogen bonds. Adenine, Cytosine and Guanine are found in both RNA and DNA.

Answer: 2. Uracil. Answer: 2. hydrogen bonds. Adenine, Cytosine and Guanine are found in both RNA and DNA. Answer: 2. Uracil Adenine, Cytosine and Guanine are found in both RNA and DNA. Thymine is found only in DNA; Uracil takes its (Thymine) place in RNA molecules. Answer: 2. hydrogen bonds The complementary

More information

From DNA to Protein

From DNA to Protein Nucleus Control center of the cell contains the genetic library encoded in the sequences of nucleotides in molecules of DNA code for the amino acid sequences of all proteins determines which specific proteins

More information

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown 1 DNA Coloring - Transcription & Translation Transcription RNA, Ribonucleic Acid is very similar to DNA. RNA normally exists as a single strand (and not the double stranded double helix of DNA). It contains

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:.

More information

IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon. V. Polypeptides and Proteins

IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon. V. Polypeptides and Proteins IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon A. Acid/Base properties 1. carboxyl group is proton donor! weak acid 2. amino group is proton acceptor! weak base 3. At physiological ph: H

More information

Synonymous Codon Usage in Lactococcus lactis: Mutational Bias Versus Translational Selection

Synonymous Codon Usage in Lactococcus lactis: Mutational Bias Versus Translational Selection Journal of Biomolecular Structure & Dynamics, ISSN 0739-1102 Volume 21, Issue Number 4, (2004) Adenine Press (2004) Abstract Synonymous Codon Usage in Lactococcus lactis: Mutational Bias Versus Translational

More information

Ribosomal Protein Synthesis

Ribosomal Protein Synthesis 1 1 Ribosomal Protein Synthesis Prof. Dr. Wolfgang Wintermeyer 1, Prof. Dr. Marina V. Rodnina 2 1 Institut f r Molekularbiologie, Universit t Witten/Herdecke, Stockumer Stra e 10, 58448 Witten, Germany;

More information

12.1 The Role of DNA in Heredity

12.1 The Role of DNA in Heredity 12.1 The Role of DNA in Heredity Only in the last 50 years have scientists understood the role of DNA in heredity. That understanding began with the discovery of DNA s structure. In 1952, Rosalind Franklin

More information

Advanced Medicinal & Pharmaceutical Chemistry CHEM 5412 Dept. of Chemistry, TAMUK

Advanced Medicinal & Pharmaceutical Chemistry CHEM 5412 Dept. of Chemistry, TAMUK Advanced Medicinal & Pharmaceutical Chemistry CHEM 5412 Dept. of Chemistry, TAMUK Dai Lu, Ph.D. Tel: 361-221-0745 Office: RCOP, Room 307 Drug Discovery and Development Drug Molecules Medicinal

More information

Nucleotides and Nucleic Acids

Nucleotides and Nucleic Acids Nucleotides and Nucleic Acids Brief History 1 1869 - Miescher Isolated nuclein from soiled bandages 1902 - Garrod Studied rare genetic disorder: Alkaptonuria; concluded that specific gene is associated

More information

Concluding lesson. Student manual. What kind of protein are you? (Basic)

Concluding lesson. Student manual. What kind of protein are you? (Basic) Concluding lesson Student manual What kind of protein are you? (Basic) Part 1 The hereditary material of an organism is stored in a coded way on the DNA. This code consists of four different nucleotides:

More information

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination

More information

Proteins and Nucleic Acids

Proteins and Nucleic Acids Proteins and Nucleic Acids Chapter 5 Macromolecules: Proteins Proteins Most structurally & functionally diverse group of biomolecules. : o Involved in almost everything o Enzymes o Structure (keratin,

More information

The Steps. 1. Transcription. 2. Transferal. 3. Translation

The Steps. 1. Transcription. 2. Transferal. 3. Translation Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order

More information

Chapter 11: Molecular Structure of DNA and RNA

Chapter 11: Molecular Structure of DNA and RNA Chapter 11: Molecular Structure of DNA and RNA Student Learning Objectives Upon completion of this chapter you should be able to: 1. Understand the major experiments that led to the discovery of DNA as

More information

To be able to describe polypeptide synthesis including transcription and splicing

To be able to describe polypeptide synthesis including transcription and splicing Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain

More information

Chapter 17: From Gene to Protein

Chapter 17: From Gene to Protein AP Biology Reading Guide Fred and Theresa Holtzclaw Julia Keller 12d Chapter 17: From Gene to Protein 1. What is gene expression? Gene expression is the process by which DNA directs the synthesis of proteins

More information

Chapter 17: From Gene to Protein

Chapter 17: From Gene to Protein Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master

More information

CCR Biology - Chapter 8 Practice Test - Summer 2012

CCR Biology - Chapter 8 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 8 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What did Hershey and Chase know

More information

Lab # 12: DNA and RNA

Lab # 12: DNA and RNA 115 116 Concepts to be explored: Structure of DNA Nucleotides Amino Acids Proteins Genetic Code Mutation RNA Transcription to RNA Translation to a Protein Figure 12. 1: DNA double helix Introduction Long

More information

Sean Carroll.

Sean Carroll. Sean Carroll 1 Suggestions for doing well Come to class! Read the assignment before lecture Stay current with problems Seek help if needed

More information

Mutations and Genetic Variability. 1. What is occurring in the diagram below?

Mutations and Genetic Variability. 1. What is occurring in the diagram below? Mutations and Genetic Variability 1. What is occurring in the diagram below? A. Sister chromatids are separating. B. Alleles are independently assorting. C. Genes are replicating. D. Segments of DNA are

More information

DNA Structure and Replication

DNA Structure and Replication Why? DNA Structure and Replication How is genetic information stored and copied? Deoxyribonucleic acid or DNA is the molecule of heredity. It contains the genetic blueprint for life. For organisms to grow

More information

Lecture Overview. Hydrogen Bonds. Special Properties of Water Molecules. Universal Solvent. ph Scale Illustrated. special properties of water

Lecture Overview. Hydrogen Bonds. Special Properties of Water Molecules. Universal Solvent. ph Scale Illustrated. special properties of water Lecture Overview special properties of water > water as a solvent > ph molecules of the cell > properties of carbon > carbohydrates > lipids > proteins > nucleic acids Hydrogen Bonds polarity of water

More information


TRANSCRIPTION TRANSLATION - GENETIC CODE AND OUTLINE OF PROTEIN SYNTHESIS TRANSCRIPTION TRANSLATION - GENETIC CODE AND OUTLINE OF PROTEIN SYNTHESIS Central Dogma of Protein Synthesis Proteins constitute the major part by dry weight of an actively growing cell. They are widely

More information

Part A: Amino Acids and Peptides (Is the peptide IAG the same as the peptide GAI?)

Part A: Amino Acids and Peptides (Is the peptide IAG the same as the peptide GAI?) ChemActivity 46 Amino Acids, Polypeptides and Proteins 1 ChemActivity 46 Part A: Amino Acids and Peptides (Is the peptide IAG the same as the peptide GAI?) Model 1: The 20 Amino Acids at Biological p See

More information

Prep Time: 15 minutes. Class Time: 30 minutes

Prep Time: 15 minutes. Class Time: 30 minutes ACTIVITY OVERVIEW Abstract: Students navigate the Basics and Beyond module to complete a web quest to learn about how proteins are made using the instructions contained in genes. Module: Basics and Beyond

More information

The Puzzle of Life A Lesson Plan for Life S cien ce Teach ers From: The G reat Lakes S cien ce C ent er, C lev elan d, OH

The Puzzle of Life A Lesson Plan for Life S cien ce Teach ers From: The G reat Lakes S cien ce C ent er, C lev elan d, OH Introduction: The Puzzle of Life A Lesson Plan for Life S cien ce Teach ers From: The G reat Lakes S cien ce C ent er, C lev elan d, OH In the Puzzle of Life activity, students will demonstrate how the

More information



More information

A disaccharide is formed when a dehydration reaction joins two monosaccharides. This covalent bond is called a glycosidic linkage.

A disaccharide is formed when a dehydration reaction joins two monosaccharides. This covalent bond is called a glycosidic linkage. CH 5 Structure & Function of Large Molecules: Macromolecules Molecules of Life All living things are made up of four classes of large biological molecules: carbohydrates, lipids, proteins, and nucleic

More information

Replication Study Guide

Replication Study Guide Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have

More information

12.1 Identifying the Substance of Genes

12.1 Identifying the Substance of Genes 12.1 Identifying the Substance of Genes Lesson Objectives Summarize the process of bacterial transformation. Describe the role of bacteriophages in identifying genetic material. Identify the role of DNA

More information

Name: Date: Period: DNA Unit: DNA Webquest

Name: Date: Period: DNA Unit: DNA Webquest Name: Date: Period: DNA Unit: DNA Webquest Part 1 History, DNA Structure, DNA Replication DNA History Read the text and answer the following questions.

More information

BCH401G Lecture 39 Andres

BCH401G Lecture 39 Andres BCH401G Lecture 39 Andres Lecture Summary: Ribosome: Understand its role in translation and differences between translation in prokaryotes and eukaryotes. Translation: Understand the chemistry of this

More information

The Molecules of Cells

The Molecules of Cells The Molecules of Cells I. Introduction A. Most of the world s population cannot digest milk-based foods. 1. These people are lactose intolerant because they lack the enzyme lactase. 2. This illustrates

More information

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized: Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How

More information

Bio 102 Practice Problems Genetic Code and Mutation

Bio 102 Practice Problems Genetic Code and Mutation Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Choose the one best answer: Beadle and Tatum mutagenized Neurospora to find

More information

2.1 Nucleic acids the molecules of life

2.1 Nucleic acids the molecules of life 1 2.1 Nucleic acids the molecules of life Nucleic acids information molecules of the cells form new cells stored in chromosomes in nucleus of the cell in the form of a code in DNA / parts of the code are

More information

Honors Biology Practice Questions #1. Name. 6. Seastars have a diploid number of 24 chromosomes. The haploid number would be

Honors Biology Practice Questions #1. Name. 6. Seastars have a diploid number of 24 chromosomes. The haploid number would be Honors Biology Practice Questions #1 1. Donkeys have 68 chromosomes in each body cell. If a donkey cell undergoes meiosis, how many chromosomes should be in each gamete? A. 18 B. 34 C. 68 D. 132 2. A sperm

More information

DNA Structure and Replication. Chapter Nine

DNA Structure and Replication. Chapter Nine DNA Structure and Replication Chapter Nine 2005 We know: DNAis the hereditary material DNAhas a double helix structure Made of four bases; A,T,C,G Sugar-Phosphate backbone DNAreplication is semi-conservative

More information