Staphylococcus aureus Protein A (spa) Typing
|
|
|
- Poppy Charles
- 7 years ago
- Views:
Transcription
1 Staphylococcus aureus Protein A (spa) Typing Senior scientist Henrik Hasman, National Food Institute-DTU Henrik Hasman hhas@food.dtu.dk
2 Typing method for S. aureus Gold standard - Phage typing and PFGE Phage and Band based Labourious: 2-6 days Analysis is subjective and can give non-typable results Communication of data is problematic DNA sequence-based methods Standardized protocol: 1-2 days Analysis is unambiguous Sequence data can easily be transferred Eg. MLST, coa, spa successfully used for S. aureus MLST is not suitable for routine surveillance of MRSA High cost and access to a high-throughput DNA sequencing facility The discriminative power of PFGE is generally higher than most DNAD NA-based methods
3 Protein A (spa) in S. aureus 2150bp Surface protein Virulence factor Binds to IgG via Fc-binding domain Reduce phagocytosis X-region-variable number of repeats Highly polymorphic» Deletion and duplication of repeats, and point mutations
4 What is a repeat? Multiple copies of the same nucleotide sequence Tandem vs. interspersed Tandem: HENRIKHeNRIKHEnRIKHeNRIK Interspersed
5 Region X spontaneous point mutations, loss and/or gain of repeats Variations in the number of repeats DNA polymerase slippage and various recombination events Variations in individual repeats are a result of mutagenesis 298 repeats known today (April ) 21-30nt (encode triplet codon) Repeats are assigned an numerical code (in Ridom/Bionummerics) spa type is deduced from the sequence and order of specific repeats
6
7 RCAMCAAAA SL Spa-typing of S. aureus r04 PCR and sequencing r20 r17 r20 r34 SR TAYATGTCGT 24 nt repeats (21 to 30 nt) GAGGAAGACAATAACAAGCCTGGT r04 AAAGAAGACAACAACAAACCTGGC r20 r04r20r17r20r34 = t2906
8 The SPA principle
9 How to translate sequence into SPA type? Manually (NOT recomended) Identify SL and SR Identify repeats Compare to list of all known repeat sequences Computer-based assignment At least two software solutions exists (Ridom and Bionumerics) Both are quiet expensive (3000+ Euros), but you might already have Bionumerics installed. Then the spa module is a free add-on. Or you might find a collaborating institute or hospital who has one of these programs installed. Otherwise contact your CRL (me) for help.
10
11
12
13
14
15
16
17 Bionumerics v4.61
18
19
20 Examples of related SPA types t034 r08r16r02r25r02r25r34 r24r25 t571 r08r16r02r25r02r25r34 r25 t011 r08r16r02r25 r34 r24r25 t108 r08r16r02r25 r24r25 t1255 r08r16 r34 r24r25 t1793 r08r16r02r25r02r25r34r24r24r25 t2876 r08r16r02r25r02r25r 24r25 Genetic events M L S t1333 r15r12r16r34 r02r25r17r24 >8 t899 r07r16 r23r02r34 >5 T
21 Examples of pittfalls in relating SPA types t528 r04 t524 r04r17 t529 r04r34 6,72,12,43,49,67,59 ST151 CC151 18,1,1,1,1,5,3 ST71 CC97 6,72,12,43,49,67,59 ST151 CC151
22 SPA typing vs MLST typing SPA typing has in general higher discriminative power than MLST and lower discriminative power than PFGE! - This means that many SPA types can belong to the same MLST type (also called Sequence Type ST). - Furthermore, closely related Sequence Types can be organized into so-called Clonal Complexes (CC s). t011 t034 t108 t571 t1255 t1793 t2876 ST398 ST804 ST1067 ST752 ST1232 ST621 CC398
23 SPA typing vs MLST typing In far the most cases, a SPA type will always belong to a certain Sequence Type. However, a few deviations from this rule exists! The SPA type t899 has been shown to belong to both ST9 and ST398. QUESTIONS??? AFTER THE BREAK The magical world of MLST typing.
24 Multi Locus Sequence Typing (MLST) Senior scientist Henrik Hasman, National Food Institute-DTU Henrik Hasman
25 CC398 S. aureus isolates can in most cases be allocated into Clonal Complexes based on their Sequence type (at least human isolates ).
26 MLST.S(equence) T(ype).C(lonal) C(omplex)???? MLST is performed to obtain the Sequence Type (ST) The ST can often be associated with certain CC s If not, they are called Singletons S. aureus has major (human) CC s Each CC has a ST as founder and many ST s as members MLST is performed by sequencing 7 household genes These are selected based on their molecular clock MLST can not substitute PFGE as they have different molecular clocks.
27 Genes which are sequenced in the MLST arc (Carbamate kinase) aro (Shikimate dehydrogenase) glp (Glycerol kinase) gmk (Guanylate kinase) pta (Phosphate acetyltransferase) tpi (Triosephosphate isomerase) yqi (Acetyle coenzyme A acetyltransferase)
28 arcc The MLST principle Primer 1797 (100.0%) Primer 1798 (100.0%) Primer 1809 (100.0%) Primer 1810 (100.0%) yqil S. aureus MRSA252 BX bp Primer 1805 (100.0%) Primer 1806 (100.0%) pta Primer 1807 (95.7%) Primer 1808 (100.0%) tpi aroe Primer 1799 (100.0%) Primer 1800 (95.7%) Primer 1803 (95.0%) Primer 1804 (100.0%) Primer 1801 (100.0%) Primer 1802 (95.7%) glpf gmk
29 Primers and PCR conditions
30 The MLST principle MLST allele sizes: Gene arcc: aroe: glpf: gmk: pta: tpi: yqil: Size 456 bp 456 bp 465 bp 429 bp 474 bp 402 bp 516 bp
31 How many different alleles? Gene Number of Alleles arcc: 109 aroe: 151 glpf: 118 gmk: 84 pta: 112 tpi: 117 yqil: 108
32 The MLST principle A A T C A A T C G C A T T T T A A C T G A A A T G A A T A G T G A T A G A A C T G T A G G C A C A A T C G T T A C A C G T G T 3833 Fragment MRSA- 9B- 1797_ A A T C A A T C G C A T T T T A A C T G A A A T G A A T A G T G A T A G A A C T G T A G G C A C A A T C G T T A C A C G T G T
33 The MLST principle
34 The MLST principle Fragment with required length! Delete/trim
35 MLST Databases saureus.mlst.net/
36 MLST Databases
37 MLST Databases
38 MLST Databases
39 MLST Databases
40 MLST Databases
41 MLST profile: Gene Allelle arcc: 108 aroe: 13 glpf: 1 gmk: 1 pta: 12 tpi: 11 yqil: 13
42 Finding the Sequence Type (ST):
43 Finding the Sequence Type (ST):
44 Finding the Sequence Type (ST):
45 MLST the fast version. CLCbio DNA workbench + MLST module
46 3000 Euros Costs: Euros Results Drag n Drop sequences Costs: 1500Results
47 eburst.mlst.net/
48 Requires Java running on the computer
49 arcc aroe
50
51 CC398 CC8 CC5
52
53
54
55
56 Known members of Clonal Complex 398 ST398 (founder) ST804 ST1067 ST752 ST1232 ST621 ST753 ST291 ST813 ST1066 ST1277 ST1112
57 Thank you for your attention Questions and remarks?
A Fast, Accurate, and Automated Workflow for Multi Locus Sequence Typing of Bacterial Isolates
Application Note MLST A Fast, Accurate, and Automated Workflow for Multi Locus Sequence Typing of Bacterial Isolates Using Applied Biosystems 3130 and 3730 Series Capillary Electrophoresis Systems and
ANNUAL REPORT ON STAPHYLOCOCCUS AUREUS BACTERAEMIA CASES IN DENMARK 2008 (part I)
ANNUAL REPORT ON STAPHYLOCOCCUS AUREUS BACTERAEMIA CASES IN DENMARK 2008 (part I) STAPHYLOCOCCUS LABORATORY, STATENS SERUM INSTITUT 1 Staphylococcus aureus bacteraemia annual report, part I The format
Molecular typing of VTEC: from PFGE to NGS-based phylogeny
Molecular typing of VTEC: from PFGE to NGS-based phylogeny Valeria Michelacci 10th Annual Workshop of the National Reference Laboratories for E. coli in the EU Rome, November 5 th 2015 Molecular typing
Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
ANNUAL REPORT ON STAPHYLOCOCCUS AUREUS BACTERAEMIA CASES IN DENMARK 2009 (part I)
ANNUAL REPORT ON STAPHYLOCOCCUS AUREUS BACTERAEMIA CASES IN DENMARK 2009 (part I) STAPHYLOCOCCUS LABORATORY, STATENS SERUM INSTITUT 1 Staphylococcus aureus Bacteraemia Annual Report, Part I The annual
Gene mutation and molecular medicine Chapter 15
Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to
Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
escience and Post-Genome Biomedical Research
escience and Post-Genome Biomedical Research Thomas L. Casavant, Adam P. DeLuca Departments of Biomedical Engineering, Electrical Engineering and Ophthalmology Coordinated Laboratory for Computational
June 09, 2009 Random Mutagenesis
Why Mutagenesis? Analysis of protein function June 09, 2009 Random Mutagenesis Analysis of protein structure Protein engineering Analysis of structure-function relationship Analysis of the catalytic center
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
Data Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
Commonly Used STR Markers
Commonly Used STR Markers Repeats Satellites 100 to 1000 bases repeated Minisatellites VNTR variable number tandem repeat 10 to 100 bases repeated Microsatellites STR short tandem repeat 2 to 6 bases repeated
How many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
Workshop on Methods for Isolation and Identification of Campylobacter spp. June 13-17, 2005
Workshop on Methods for Isolation and Identification of Campylobacter spp June 13-17, 2005 Goal: build capacity within the state public health laboratories to effectively identify Campylobacter species
AP BIOLOGY 2010 SCORING GUIDELINES (Form B)
AP BIOLOGY 2010 SCORING GUIDELINES (Form B) Question 2 Certain human genetic conditions, such as sickle cell anemia, result from single base-pair mutations in DNA. (a) Explain how a single base-pair mutation
From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
MUTATION, DNA REPAIR AND CANCER
MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
Gene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook)
Name Date Per Look at the diagrams, then answer the questions. Gene Mutations affect a single gene by changing its base sequence, resulting in an incorrect, or nonfunctional, protein being made. (a) A
Innovations in Molecular Epidemiology
Innovations in Molecular Epidemiology Molecular Epidemiology Measure current rates of active transmission Determine whether recurrent tuberculosis is attributable to exogenous reinfection Determine whether
Genetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
Genetic diagnostics the gateway to personalized medicine
Micronova 20.11.2012 Genetic diagnostics the gateway to personalized medicine Kristiina Assoc. professor, Director of Genetic Department HUSLAB, Helsinki University Central Hospital The Human Genome Packed
Recombinant DNA Unit Exam
Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the
EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità
EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità Inventory of the expertise on molecular typing of Verocytotoxin-producing
a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled
Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino
2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
Biological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA
Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns
Bob Jesberg. Boston, MA April 3, 2014
DNA, Replication and Transcription Bob Jesberg NSTA Conference Boston, MA April 3, 2014 1 Workshop Agenda Looking at DNA and Forensics The DNA, Replication i and Transcription i Set DNA Ladder The Double
Molecular Genetics. RNA, Transcription, & Protein Synthesis
Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and
Next Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took
Module 10: Bioinformatics
Module 10: Bioinformatics 1.) Goal: To understand the general approaches for basic in silico (computer) analysis of DNA- and protein sequences. We are going to discuss sequence formatting required prior
Molecular Cloning, Product Brochure
, Product Brochure Interest in any of the products, request or order them at Bio-Connect. Bio-Connect B.V. T NL +31 (0)26 326 44 50 T BE +32 (0)2 503 03 48 Begonialaan 3a F NL +31 (0)26 326 44 51 F BE
Forensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
Vector NTI Advance 11 Quick Start Guide
Vector NTI Advance 11 Quick Start Guide Catalog no. 12605050, 12605099, 12605103 Version 11.0 December 15, 2008 12605022 Published by: Invitrogen Corporation 5791 Van Allen Way Carlsbad, CA 92008 U.S.A.
Protein Synthesis How Genes Become Constituent Molecules
Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein
Umm AL Qura University MUTATIONS. Dr Neda M Bogari
Umm AL Qura University MUTATIONS Dr Neda M Bogari CONTACTS www.bogari.net http://web.me.com/bogari/bogari.net/ From DNA to Mutations MUTATION Definition: Permanent change in nucleotide sequence. It can
DNA and Forensic Science
DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief
Structure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
DNA Replication in Prokaryotes
OpenStax-CNX module: m44488 1 DNA Replication in Prokaryotes OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,
Typing in the NGS era: The way forward!
Typing in the NGS era: The way forward! Valeria Michelacci NGS course, June 2015 Typing from sequence data NGS-derived conventional Multi Locus Sequence Typing (University of Warwick, 7 housekeeping genes)
Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
Institutional Partnership Program
GENEWIZ Outsourcing Services Institutional Partnership Program Solid Science. Superior Service. DNA Sequencing Partners to Fuel Your Success Institutions whose success depends on significant life science
Genetics Lecture Notes 7.03 2005. Lectures 1 2
Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several
Lecture 3: Mutations
Lecture 3: Mutations Recall that the flow of information within a cell involves the transcription of DNA to mrna and the translation of mrna to protein. Recall also, that the flow of information between
Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)
Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur
Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.
Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists
PrimeSTAR HS DNA Polymerase
Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction
1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
Y Chromosome Markers
Y Chromosome Markers Lineage Markers Autosomal chromosomes recombine with each meiosis Y and Mitochondrial DNA does not This means that the Y and mtdna remains constant from generation to generation Except
Bacterial Next Generation Sequencing - nur mehr Daten oder auch mehr Wissen? Dag Harmsen Univ. Münster, Germany dharmsen@uni-muenster.
Bacterial Next Generation Sequencing - nur mehr Daten oder auch mehr Wissen? Dag Harmsen Univ. Münster, Germany dharmsen@uni-muenster.de Commercial Disclosure Dag Harmsen is co-founder and partial owner
Single Nucleotide Polymorphisms (SNPs)
Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded
Gene Mapping Techniques
Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction
Mitochondrial DNA Analysis
Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)
Recombinant DNA Technology
Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium
Human Leukocyte Antigens - HLA
Human Leukocyte Antigens - HLA Human Leukocyte Antigens (HLA) are cell surface proteins involved in immune function. HLA molecules present antigenic peptides to generate immune defense reactions. HLA-class
DNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
Sequencing emm-specific PCR Products for Routine and Accurate Typing of Group A Streptococci
JOURNAL OF CLINICAL MICROBIOLOGY, Apr. 1996, p. 953 958 Vol. 34, No. 4 0095-1137/96/$04.00 0 Copyright 1996, American Society for Microbiology Sequencing emm-specific PCR Products for Routine and Accurate
MRC-Holland MLPA. Description version 12; 02-12-2012
SALSA MLPA probemix P083-C1 CDH1 Lot C1-0211. As compared to previous B1 version, new in version C1: two CDH1 probes and several reference probes have been replaced/added. In addition, the 88 and 96nt
Translation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
Introduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov
Crime Scenes and Genes
Glossary Agarose Biotechnology Cell Chromosome DNA (deoxyribonucleic acid) Electrophoresis Gene Micro-pipette Mutation Nucleotide Nucleus PCR (Polymerase chain reaction) Primer STR (short tandem repeats)
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
PRACTICE TEST QUESTIONS
PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.
Description: Molecular Biology Services and DNA Sequencing
Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:
Bio 102 Practice Problems Genetic Code and Mutation
Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine
Becker Muscular Dystrophy
Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency
Focusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
Linear Sequence Analysis. 3-D Structure Analysis
Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical properties Molecular weight (MW), isoelectric point (pi), amino acid content, hydropathy (hydrophilic
Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary
Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page
restriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
2006 7.012 Problem Set 3 KEY
2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each
Localised Sex, Contingency and Mutator Genes. Bacterial Genetics as a Metaphor for Computing Systems
Localised Sex, Contingency and Mutator Genes Bacterial Genetics as a Metaphor for Computing Systems Outline Living Systems as metaphors Evolutionary mechanisms Mutation Sex and Localized sex Contingent
Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation
PN 100-9879 A1 TECHNICAL NOTE Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation Introduction Cancer is a dynamic evolutionary process of which intratumor genetic and phenotypic
Genetics Test Biology I
Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.
Chapter 6 DNA Replication
Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore
Biology Final Exam Study Guide: Semester 2
Biology Final Exam Study Guide: Semester 2 Questions 1. Scientific method: What does each of these entail? Investigation and Experimentation Problem Hypothesis Methods Results/Data Discussion/Conclusion
Transcription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
On Covert Data Communication Channels Employing DNA Steganography with Application in Massive Data Storage
ARAB ACADEMY FOR SCIENCE, TECHNOLOGY AND MARITIME TRANSPORT COLLEGE OF ENGINEERING AND TECHNOLOGY COMPUTER ENGINEERING DEPARTMENT On Covert Data Communication Channels Employing DNA Steganography with
MRC-Holland MLPA. Related SALSA MLPA probemix P091 CFTR: contains probes for the CFTR gene, related to chronic pancreatitis.
SALSA MLPA probemix P242-B3 Pancreatitis Lot B3-0215. As compared to version B2 (lot B2-1212), one flanking probe has been removed and four reference probes have been replaced. Hereditary Pancreatitis
IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR)
IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) Background Infectious diseases caused by pathogenic organisms such as bacteria, viruses, protozoa,
Replication Study Guide
Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have
Antibody Function & Structure
Antibody Function & Structure Specifically bind to antigens in both the recognition phase (cellular receptors) and during the effector phase (synthesis and secretion) of humoral immunity Serology: the
The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:
Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
Bioinformatics Grid - Enabled Tools For Biologists.
Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis
Whole genome sequencing of foodborne pathogens: experiences from the Reference Laboratory. Kathie Grant Gastrointestinal Bacteria Reference Unit
Whole genome sequencing of foodborne pathogens: experiences from the Reference Laboratory Kathie Grant Gastrointestinal Bacteria Reference Unit 16 th June 2014 Planning for Implementation of WGS 2011-2014
Genetomic Promototypes
Genetomic Promototypes Mirkó Palla and Dana Pe er Department of Mechanical Engineering Clarkson University Potsdam, New York and Department of Genetics Harvard Medical School 77 Avenue Louis Pasteur Boston,
Annex 6: Nucleotide Sequence Information System BEETLE. Biological and Ecological Evaluation towards Long-Term Effects
Annex 6: Nucleotide Sequence Information System BEETLE Biological and Ecological Evaluation towards Long-Term Effects Long-term effects of genetically modified (GM) crops on health, biodiversity and the
BCOR101 Midterm II Wednesday, October 26, 2005
BCOR101 Midterm II Wednesday, October 26, 2005 Name Key Please show all of your work. 1. A donor strain is trp+, pro+, met+ and a recipient strain is trp-, pro-, met-. The donor strain is infected with
European Medicines Agency
European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein
Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.
Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.
HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:
HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone
Troubleshooting Sequencing Data
Troubleshooting Sequencing Data Troubleshooting Sequencing Data No recognizable sequence (see page 7-10) Insufficient Quantitate the DNA. Increase the amount of DNA in the sequencing reactions. See page
MRSA surveillance 2012: Bovines
MRSA surveillance 2012: Bovines Prof. dr. Patrick Butaye Drs. Stéphanie Nemeghaire 1 1. Introduction In the framework of the FASFC surveillance and the EMIDA-ERA NET project, a surveillance of MRSA in
Network Activities PTs on VTEC detection and typing and training initiatives
9 th Annual workshop of the EU Reference Laboratories for E. coli, Rome 20-21 October 2014 Network Activities PTs on VTEC detection and typing and training initiatives Proficiency tests (PT) on E.coli
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences