IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR)

Size: px
Start display at page:

Download "IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR)"

Transcription

1 IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) Background Infectious diseases caused by pathogenic organisms such as bacteria, viruses, protozoa, and fungi are a major threat to both wild fish populations and the aquaculture industry. Scientists who study fish diseases are detectives, often confronted with crime scenes and clues such as missing fish and huge die-offs. Their job is to piece together clues using a variety of techniques in order to determine the cause of the disease outbreak. New diagnostic techniques based on detecting the pathogen s DNA are being developed for the detection and identification of a variety of fish and shellfish pathogens. These new techniques are often more reliable, faster to perform, and cheaper than previously used techniques. Using molecular techniques, the presence of the pathogen can be detected before the host organisms show signs of infection. Major advances in biotechnology, including DNA sequencing and the polymerase chain reaction, or PCR, have greatly accelerated scientists ability to solve these fish mysteries, shedding light on the basic biology and life cycles of pathogenic organisms. Understanding the complete life cycle of a pathogen is an essential step in diagnosing and preventing the spread of the infection in both wild and cultured animals. Ceratomyxa shasta, a microscopic myxozoan parasite native to some watersheds in the Pacific Northwest, has been at the center of one of these fish mysteries for several decades. This tiny parasite is believed to be responsible for the death of millions of wild and stocked salmon and trout in the Pacific Northwest over the last hundred years and has helped shape salmon and trout management policies in the region. The parasite infects the intestinal tract of the fish, resulting in tissue necrosis, severe inflammation, and eventually death. While scientists had long suspected the parasite to be deadly to fish, they puzzled over why some fish stocks were more susceptible to the parasite than others and why it failed to spread from fish to fish. The parasite is not contagious like an infectious disease; instead, individual fish have to come in contact with the parasite. The parasite is found in some basins in the Pacific Northwest, including the Willamette, Klamath, and Deschutes rivers, but not in the Siletz River. As they were not able to complete the life cycle of C. shasta in the lab, researchers could not propose control strategies or predict how the parasite might spread. It took scientists more than 30 years to piece together the life cycle of C. shasta. The lack of mobility of the parasite made scientists suspect that a second host might be involved in the life cycle. After searching the mud, rocks, mussels, and other invertebrates, microbiologists at Oregon State University were finally able to identify the missing host as a tiny polychaete worm. The worms contained spores which looked visually like the spores seen in other myxosporean life cycles. The final proof came when Dr. Jerri Bartholomew, a microbiologist at OSU, was able to sequence a gene from both spore stages (from the worm and salmonid hosts) and show they were identical.

2 C D B A Figure 1. Ceratomyxa shasta life cycle: A. Infected fish B. Myxospore stage C. Polychaete worm host D. Actinospore stage With genetic information and an understanding of the parasite s life cycle (see Figure 1), Bartholomew and her colleagues have been able to develop a simple diagnostic procedure to detect the presence of the parasite in worm, water, or fish samples, using the polymerase chain reaction. What is PCR? The polymerase chain reaction is a technique that generates unlimited copies of a specified DNA sequence, which can be a portion of a gene from a pathogen, such as a gene from C. shasta. The PCR technique uses the same types of enzymes and biochemical components that a bacterial cell uses to replicate its own DNA: DNA polymerase, a template DNA, primer DNA, and deoxynucleotide precursors. The portion to be duplicated does not need to be cut out from the genome in order to be amplified. Scientists are able to define the boundaries of a small target sequence within the genome by designing two different DNA sequences called primers. Primers are short, single-stranded DNA molecules that are complementary to the boundary ends of the target sequence. Each of these single-stranded primers will bind only to its complementary sequence on one strand of the template DNA. Together, the two different primers will bind to opposite strands of the template DNA, orienting the DNA polymerase to copy or replicate the target sequence within the boundaries defined by the primers (see Figure 3). The power of PCR lies in the ability of the system to start with only one or a few copies of the template DNA, such as the DNA in a C. shasta spore present in the intestine at the early stages of infection or in a polychaete worm lurking in a mud sample from a river bottom, and copy a specified region of the DNA over and over again until there is enough DNA to detect and manipulate.

3 Since PCR was first invented by Kary Mullis in 1985, researchers have improved the method, so it is reliable, fast, and easy to perform. The DNA polymerase enzyme used in PCR reactions today was isolated from bacteria growing in hot thermal vents. This polymerase enzyme has evolved to be stable at high temperatures and can withstand the extreme temperatures needed to separate or unzip the double-stranded DNA template. Most DNA polymerases would be inactivated or denatured at this high temperature. By using Taq polymerase, a scientist can avoid having to add additional enzyme after each round of amplification. PCR basically follows these procedures (see the molecular biology techniques section to follow it step by step): Cell samples, in this case fish cells, are mixed in a reaction tube with buffers, primers, free nucleotides, and Taq. The tube is placed in a machine called a thermocycler, which works as its name suggests; it submits the samples to varying temperatures in a predetermined cycle, which may be repeated up to 30 times. The result is a huge number of new double-stranded DNA segments defined at each end by the primer complementary sequence. The amplified DNA can then be examined by agarose gel electrophoresis. To develop a diagnostic test for C. shasta, Bartholomew and her students designed primers that would bind only to a region of the C. shasta SSU rrna gene and not to the SSU rrna gene in rainbow trout, the polychaete worm or other myxozoan parasites (see Figures 2 and 3). The SSU rrna gene is present in all organisms, and sequence information is available for the gene from many related and unrelated organisms, making it easy for the scientists to design primers that would bind only to a region of C. shasta DNA and not to the sequences from other parasites or different fish genomic sequences, such as salmon or rainbow trout. Figure 2. Primers specific to the C. shasta SSU rrna gene

4 Credit: Gold Seal Canadian Fishing Company Figure 3: PCR process to isolate and amplify C. shasta spore DNA. C e Focus Question How do scientists use new molecular methods to test for diseases in fish? How are these methods used to develop management strategies? Learning Objective Students will understand how scientists use biotechnology to identify diseases in fish and develop management strategies. Materials Work sheets provided here Scissors Internet access to view PCR animations (optional) Teaching Time P One class period

5 W Procedure Part A. Developing a PCR-Based Diagnostic Test for C. Shasta You are a student in Dr. Bartholomew s lab and have been assigned the task of choosing a pair of PCR primers to be used in a diagnostic test for C. shasta. The primers you choose should bind only to C. shasta DNA but not to DNA from fish or polychaete worms present in the Northwest, such as salmon and trout, or to DNA from other parasites. In this activity, you are provided with the sequence of four primers as well as sequence information for the SSU rrna genes for C. Shasta, rainbow trout, the polychaete worm, and another closely related myxozoan pathogen that causes whirling disease. 1. Working individually or in groups of 2 to 4 (to be determined by the instructor), gather the handouts needed for the exercise. 2. Using the primer work sheet provided, cut out each primer sequence, making sure to leave the 5 and 3 designations. As you cut out the different primers, label a corner of each one in pencil to avoid mixing up the pieces of paper. By scanning along the DNA sequence of the SSU rrna gene provided on the DNA work sheets for each organism, determine which primers would bind to each organism s SSU rrna gene. Underline the binding site and label it with the primer name. Remember to take into consideration the 5 -to-3 direction of the primer and the DNA strand. The 5 -to-3 primer will hybridize (bind) to the 3 -to-5 DNA strand and the 3 -to-5 primer will hybridize to the 5 -to-3 DNA strand. 3. Answer questions 1 8 on the student work sheet. Part B: Management Strategies Using PCR: Fisheries biologists would like to restock rainbow trout in a high mountain lake in Oregon where C. shasta is known to be present. To determine which strain of rainbow trout to use, officials challenge four different fish strains with C. shasta (expose them to the disease) by placing them in live cages in the lake for three to five days. Following this incubation period, nonlethal gut swabs are collected from the challenged fish. DNA is prepared from the samples and subjected to PCR, using the diagnostic test you developed above. The PCR products are separated on an agarose gel and the results are shown in the figure below. Use the information in the figure to answer question 9 on the student work sheet. M = ladder of DNA fragments of known size used as a marker for the agarose gel 1 = Positive control C. shasta spore 2 = Shasta rainbow trout 3 = Deschutes River rainbow trout 4 = Coastal rainbow trout 5 = Commercial strain rainbow trout 6 = Negative control; no DNA

6 ? Questions Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) Student Work Sheet 1. What information would you need to design a diagnostic test based on PCR for a pathogen like C. shasta? 2. What are the advantages of a PCR-based diagnostic test over other methods, such as visual inspection for the presence of the parasite? 3. How can this diagnostic test be used as a management strategy in releasing fish stocks? 4. What kinds of regions of DNA do scientists look at? 5. What function do SSU rrna gene products play in organisms? 6. Which primers would you use in a diagnostic test for C. shasta? Why? 7. Scientists need to include positive and negative controls in each experiment to make sure that the experimental system is working properly. How could you make sure that the DNA samples are all prepared properly for the PCR reaction? Which primer pair would you pick to serve as a positive control to show that the PCR amplification would work on all of the samples? 8. Using the primers you have selected for C. shasta, what size PCR product would you expect on an agarose gel? 9. Based on the information in the agarose gel, which strain of rainbow trout should the biologists use to restock the lake? Explain why.

7 Student Work Sheet Continued Primer Sequences Under Consideration for the C. shasta Diagnostic Test: Primer Name Sequence Cs2 Cs5 5 ATTACAAGGGTCAATACTTTGC3 3 CTCGGTTCAACCAGAGAGG5 18SUNI(f) 5 TTAATTTGACTCAACACGGG3 18SUNI (r) 3 ATTGTCCAGACACTACGGG5 Sample 1: C. shasta SSU rrna gene sequence 5 TTTTGCTCTTTTTATTACAAGGGTCAATACTTTGCTTAATTGAATTGTATTGA3 3 AAAACGAGAAAAATAATGTTCCCAGTTATGAAACGAATTAACTTAACATAACT5 5 ATACTTGTATAGCGTGCCTTGAATAAAGCACAGTGCTCAAAGCAAGCGTAACG3 3 TATGAACATATCGCACGGAACTTATTTCGTGTCACGAGTTTCGTTCGCATTGC5 5 AAGTTGGAGAATCGAAGACGATCAGATACCGTCCTAGTTCCATACAGTAAACT3 3 TTCAACCTCTTAGCTTCTGCTAGTCTATGGCAGGATCAAGGTATGTCATTTGA3 5 ATGCCAGCTTGAGATTAGCTCGGTAAACGAGCCAAGTTGGTCTCTCCGTGAAA3 3 TACGGTCGAACTCTAATCGAGCCATTTGCTCGGTTCAACCAGAGAGGCACTTT5 5 ACAAGCTTTCGGGTTCCGGGGGGAGTACGGTCGCAAGTCTGAAACTTAAAGAA3 3 TGTTCGAAAGCCCAAGGCCCCCCTCATGCCAGCGTTCAGACTTTGAATTTCTT5 5 ATTGACGGAAGGGCACCACCAGGAGTGGAGCCTGCGGCTTAATTTGACTCAAC3 3 TAACTGCCTTCCCGTGGTGGTCCTCACCTCGGACGCCGAATTAAACTGAGTTG5 5 ACGGGGCAACTCACCAGGTCCGGACATTGAAAGGATTGACAGACTGATTCTTT3 3 TGCCCCGTTGAGTGGTCCAGGCCTGTAACTTTCCTAACTGTCTGACTAAGAAA5 5 CAGTAGCATTTGTCGTTCTACTGAGAATAGAGAGACAACTAGTTCAAGCTAGG3 3 GTCATCGTAAACAGCAAGATGACTCTTATCTCTCTGTTGATCAAGTTCGATCC5 5 GGAAGCGTGGCAATAACAGGTCTGTGATGCCCTTCGATGTTCTGGGCT3 3 CCTTCGCACCGTTATTGTCCAGACACTACGGGAAGCTACAAGACCCGA5

8 Sample 2: Rainbow trout SSU rrna gene sequence 5 CGACGAAAGCGAAACATTTGCCCAGAATGTTTTCATTAATCAAGAACGAAAG3 3 GCTGCTTTCGCTTTGTAAACGGGTCTTACAAAAGTAATTAGTTCTTGCTTTC5 5 TCGGAGGTTCGAAGACGATCAGATACCGTCGTAGTTCCGACCATAAACGATG3 3 AGCCTCCAAGCTTCTGCTAGTCTATGGCAGCATCAAGGCTGGTATTTGCTAC5 5 CCAACTAGCGATCCGGCGGCGTTATTCCCATGACCCGCCGGGCAGCGTCCGG3 3 GGTTGATCGCTAGGCCGCCGCAATAAGGGTACTGGGCGGCCCGTCGCAGGCC5 5 GAAACCAAAGTCTTTGGGTTCCGGGGGGAGTATGGTTGCAAAGCTGAAACTT3 3 CTTTGGTTTCAGAAACCCAAGGCCCCCCTCATACCAACGTTTCGACTTTGAA5 5 AAAGGAATTGACGGAAGGGCACCACCAGGATGGAGCCTGCGGCTTAATTTG3 3 TTTCCTTAACTGCCTTCCCGTGGTGGTCCTACCTCGGACGCCGAATTAAAC5 5 ACTCAACACGGGAAACCTCACCCGGCCCGGACACGGAAAGGATTGACAGAT3 3 TGAGTTGTGCCCTTTGGAGTGGGCCGGGCCTGTGCCTTTCCTAACTGTCTA5 5 GATAGCTCTTTCTCGATTCTGTGGGTGGTGGTCCATGGCCGTTCTTAGTTGGT3 3 CTATCGAGAAAGAGCTAAGACACCCACCACCAGGTACCGGCAAGAATCAACCA5 5 CTAGTTATGCGGCCCCGAGCGGTCGGCGTCCAACTTCTTAGAGGGACAAGTG3 3 GATCAATACGCCGGGGCTCGCCAGCCGCAGGTTGAAGAATCTCCCTGTTCAC5 5 GCGTTCAGCCACACGAGACTGAGCAATAACAGGTCTGTGATGCCCTTAGATG3 3 CGCAAGTCGGTGTGCTCTGACTCGTTATTGTCCAGACACTACGGGAATCTAC5

9 Sample 3: Myxobolus cerebralis (a pathogen related to C. shasta that causes whirling disease) SSU rrna gene sequence 5 GCGAAGGCATTTGCCCAGACCCCCTCGCTTAATCAAGAACGATAGTGGAGGTTCGAAGA3 3 GCCTTCCGTAAACGGGTCTGGGGGAGCGAATTAGTTCTTGCTATCACCTCCAAGCTTCT5 5 CGATCAGATACCGTCCTAGTCCCACTGTAACTATCCCCCGCAGCATAACTCTTTATACG3 3 GCTAGTCTATGGCAGGATCAGGGTGTCATTGATAGGGGGCGTCGTATTGAGAAATATGC5 5 CTTTATGTTGGTCCCCCTGGGAAACCTCAAGTTTTTCGGTTACGGGGAGAGTATGGTCA3 3 GAAATACAACCAGGGGGACCCTTTGGAGTTCAAAAAGCCAATGCCCCTCTCATACCAGT5 5 CAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACCACCAGGAGTGGTGCGGC3 3 GTTCCGACTTTGAATTTCCTTAACTGCCTTCCCGTGGTGGTCCTCACCACGCCG5 5 TTAATTTGACTCAACACGGGAAAACTTACCAGGTCCGGACATCAATAGGAT3 3 AATTAAACTGAGTTGTGCCCTTTTGAATGGTCCAGGCCTGTAGTTATCCTA5 5 AGACAAGACTGATAGATCTTTCTTGATATGATGGATAGTGGTGCATGGCCGTTCTTAGT3 3 TCTGTTCTGACTATCTAGAAAGAACTATACTACCTATCACCACGTACCGGCAAGAATCA5 5 CTGTTCAACTACCCAGTTGAGCAGTGTGTCATGGAGAGACTGTGAGGTATATATCCAAG3 3 GACAAGTTGATGGGTCAACTCGTCACACAGTACCTCTCTGACACTCCATATATAGGTTC5 5 TCTAATGAAGCAAGGCCATAACAGGTCTGTGATGCCCTAAGATGTCCTGGGCTGCACGC3 3 AGATTACTTCGTTCCGGTATTGTCCAGACACTACGGGATTCTACAGGACCCGACGTGCG5 5 GCGCTACAATGATGGTGACAGCCAGTTTCTAGGT3 3 CGCGATGTTACTACCACTGTCGGTCAAAGATCCA5

10 Sample 4: Polychaete worm SSU rrna gene sequence 5 CAACTATCGATCCGTCGGCGTTGACATCAAGACCCTGCGGGCAGCTTCCGGG3 3 GTTGATAGCTAGGCAGCCGCAACTGTAGTTCTGGGACGCCCGTCGAAGGCCC5 5 AAACCAAAGTTTTTGGGTTCCGGGGGAAGTATGGTTGCAAAGCTGAAACTTA3 3 TTTGGTTTCAAAAACCCAAGGCCCCCTTCATACCAACGTTTCGACTTTGAAT5 5 AAGGAATTGACGGAAGGGCACCACCAGGAGTGGAGCCTGCGGCTTAATTTGA3 3 TTCCTTAACTGCCTTCCCGTGGTGGTCCTCACCTCGGACGCCGAATTAAACT5 5 CTCAACACGGGAAAACTCACCCGGCCCGGACACCGTAAGGATTGACAGATTG3 3 GAGTTGTGCCCTTTTGAGTGGGCCGGGCCTGTGGCATTCCTAACTGTCTAAC5 5 AGAGCTCTTTCTTGATTCGGTGGGTGGTGGTGCATGGCCGTTCTTAGTTGGTG3 3 TCTCGAGAAAGAACTAAGCCACCCACCACCACGTACCGGCAAGAATCAACCAC5 5 GAGCGATTTGTCTGGTTAATTCCGATAACGAACGAGACTCTAGCCTGCTAAA3 3 CTCGCTAAACAGACCAATTAAGGCTATTGCTTGCTCTGAGATCGGACGATTT5 5 TAGTTCGTTCATATCTGTTGTGAACGTTAACTTCTTAGAGGGACAAGTGGCGT3 3 ATCAAGCAAGTATAGACAACACTTGCAATTGAAGAATCTCCCTGTTCACCGCA5 5 TTAGCCACGCGAGATTGAGCAATAACAGGTCTGTGATGCCCTTAGATGTTCG3 3 AATCGGTGCGCTCTAACTCGTTATTGTCCAGACACTACTTTAATCTACAAGC5

11 Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) Teacher Answer Key Questions 1. What information would you need to design a diagnostic test based on PCR for a pathogen like C. shasta? Information about the DNA sequence of the pathogen to design primers that would only bind to the pathogen s DNA and not bind to the host or other related pathogens 2. What are the advantages of a PCR-based diagnostic test over other methods, such as visual inspection for the presence of the parasite? Sensitivity and reliability. Can detect presence of pathogen before signs are visible or at the terminal stage. Inexpensive. 3. How can this diagnostic test be used as a management strategy in releasing fish stocks? Can use this test to identify which stocks are infected by a pathogen and which are resistant to the pathogen. Can test water samples from the release area for the presence of the pathogen. 4. What kinds of regions of DNA do scientists look at? Divergent regions of a gene that are conserved throughout organisms such as SSU rdna. Availability of homologous sequences from related and unrelated organisms is necessary. 5. What function do SSU rrna gene products play in organisms? The SSU rrna genes encode a small RNA molecule that is integrated with ribosomal proteins into the ribosome. This RNA molecule is required to position the mrna transcripts in the ribosome during translation of mrna into an amino acid chain. 6.Which primers would you use in a diagnostic test for C. shasta? Why? Primers Cs 2 and Cs 5 should be chosen as primers for the C. shasta diagnostic test because both bind only to the C. shasta sequences and not to the sequences from rainbow trout, the polychaete worm, or Myxobolus cerebralis. Cs 2 and Cs 5 bind to opposite strands of the DNA. The binding sites of the different primers have been highlighted in the sequences at the end of the answer key. 7. Scientists need to include positive and negative controls in each experiment to make sure that the experimental system is working properly. How could you make sure that the DNA samples are all prepared properly for the PCR reaction? Which primer pair would you pick to serve as a positive control that the PCR amplification would work on all of the samples?

12 Primers 18SUNI(f) and 18SUNI(r) could be chosen for the positive control PCR amplification. This pair would amplify a sequence from all of the samples and could be used to determine the quality of the template DNA. 8. Using the primers you have selected for C. shasta, what size PCR product would you expect on an agarose gel? A DNA fragment of 193 bp. 9. Based on the information in the agarose gel, which strain of rainbow trout should the biologists use to restock the lake? Explain why. The Deschutes River rainbow trout should be used to restock the lake, because these fish did not become infected by C. shasta, as shown by the absence of a PCR band in lane 3. Primer Binding Sites Sample 1: C. shasta SSU rrna gene sequence 5 TTTTGCTCTTTTTATTACAAGGGTCAATACTTTGCTTAATTGAATTGTATTGA3 3 AAAACGAGAAAAATAATGTTCCCAGTTATGAAACGAATTAACTTAACATAACT5 5 ATACTTGTATAGCGTGCCTTGAATAAAGCACAGTGCTCAAAGCAAGCGTAACG3 3 TATGAACATATCGCACGGAACTTATTTCGTGTCACGAGTTTCGTTCGCATTGC5 5 AAGTTGGAGAATCGAAGACGATCAGATACCGTCCTAGTTCCATACAGTAAACT3 3 TTCAACCTCTTAGCTTCTGCTAGTCTATGGCAGGATCAAGGTATGTCATTTGA3 5 ATGCCAGCTTGAGATTAGCTCGGTAAACGAGCCAAGTTGGTCTCTCCGTGAAA3 3 TACGGTCGAACTCTAATCGAGCCATTTGCTCGGTTCAACCAGAGAGGCACTTT5 5 ACAAGCTTTCGGGTTCCGGGGGGAGTACGGTCGCAAGTCTGAAACTTAAAGAA3 3 TGTTCGAAAGCCCAAGGCCCCCCTCATGCCAGCGTTCAGACTTTGAATTTCTT5 5 ATTGACGGAAGGGCACCACCAGGAGTGGAGCCTGCGGCTTAATTTGACTCAAC3 3 TAACTGCCTTCCCGTGGTGGTCCTCACCTCGGACGCCGAATTAAACTGAGTTG5 5 ACGGGGCAACTCACCAGGTCCGGACATTGAAAGGATTGACAGACTGATTCTTT3 3 TGCCCCGTTGAGTGGTCCAGGCCTGTAACTTTCCTAACTGTCTGACTAAGAAA5 5 CAGTAGCATTTGTCGTTCTACTGAGAATAGAGAGACAACTAGTTCAAGCTAGG3 3 GTCATCGTAAACAGCAAGATGACTCTTATCTCTCTGTTGATCAAGTTCGATCC5 5 GGAAGCGTGGCAATAACAGGTCTGTGATGCCCTTCGATGTTCTGGGCT3 3 CCTTCGCACCGTTATTGTCCAGACACTACGGGAAGCTACAAGACCCGA5 Sample 2: Rainbow trout SSU rrna gene sequence 5 CGACGAAAGCGAAACATTTGCCCAGAATGTTTTCATTAATCAAGAACGAAAG3 3 GCTGCTTTCGCTTTGTAAACGGGTCTTACAAAAGTAATTAGTTCTTGCTTTC5 5 TCGGAGGTTCGAAGACGATCAGATACCGTCGTAGTTCCGACCATAAACGATG3 3 AGCCTCCAAGCTTCTGCTAGTCTATGGCAGCATCAAGGCTGGTATTTGCTAC5 5 CCAACTAGCGATCCGGCGGCGTTATTCCCATGACCCGCCGGGCAGCGTCCGG3 3 GGTTGATCGCTAGGCCGCCGCAATAAGGGTACTGGGCGGCCCGTCGCAGGCC5 5 GAAACCAAAGTCTTTGGGTTCCGGGGGGAGTATGGTTGCAAAGCTGAAACTT3 3 CTTTGGTTTCAGAAACCCAAGGCCCCCCTCATACCAACGTTTCGACTTTGAA5 5 AAAGGAATTGACGGAAGGGCACCACCAGGATGGAGCCTGCGGCTTAATTTG3 3 TTTCCTTAACTGCCTTCCCGTGGTGGTCCTACCTCGGACGCCGAATTAAAC5 5 ACTCAACACGGGAAACCTCACCCGGCCCGGACACGGAAAGGATTGACAGAT3 3 TGAGTTGTGCCCTTTGGAGTGGGCCGGGCCTGTGCCTTTCCTAACTGTCTA5

13 5 GATAGCTCTTTCTCGATTCTGTGGGTGGTGGTCCATGGCCGTTCTTAGTTGGT3 3 CTATCGAGAAAGAGCTAAGACACCCACCACCAGGTACCGGCAAGAATCAACCA5 5 CTAGTTATGCGGCCCCGAGCGGTCGGCGTCCAACTTCTTAGAGGGACAAGTG3 3 GATCAATACGCCGGGGCTCGCCAGCCGCAGGTTGAAGAATCTCCCTGTTCAC5 5 GCGTTCAGCCACACGAGACTGAGCAATAACAGGTCTGTGATGCCCTTAGATG3 3 CGCAAGTCGGTGTGCTCTGACTCGTTATTGTCCAGACACTACGGGAATCTAC5 Sample 3: Myxobolus cerebralis (a pathogen related to C. shasta that causes whirling disease) SSU rrna gene sequence 5 GCGAAGGCATTTGCCCAGACCCCCTCGCTTAATCAAGAACGATAGTGGAGGTTCGAAGA3 3 GCCTTCCGTAAACGGGTCTGGGGGAGCGAATTAGTTCTTGCTATCACCTCCAAGCTTCT5 5 CGATCAGATACCGTCCTAGTCCCACTGTAACTATCCCCCGCAGCATAACTCTTTATACG3 3 GCTAGTCTATGGCAGGATCAGGGTGTCATTGATAGGGGGCGTCGTATTGAGAAATATGC5 5 CTTTATGTTGGTCCCCCTGGGAAACCTCAAGTTTTTCGGTTACGGGGAGAGTATGGTCA3 3 GAAATACAACCAGGGGGACCCTTTGGAGTTCAAAAAGCCAATGCCCCTCTCATACCAGT5 5 CAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACCACCAGGAGTGGTGCGGC3 3 GTTCCGACTTTGAATTTCCTTAACTGCCTTCCCGTGGTGGTCCTCACCACGCCG5 5 TTAATTTGACTCAACACGGGAAAACTTACCAGGTCCGGACATCAATAGGAT3 3 AATTAAACTGAGTTGTGCCCTTTTGAATGGTCCAGGCCTGTAGTTATCCTA5 5 AGACAAGACTGATAGATCTTTCTTGATATGATGGATAGTGGTGCATGGCCGTTCTTAGT3 3 TCTGTTCTGACTATCTAGAAAGAACTATACTACCTATCACCACGTACCGGCAAGAATCA5 5 CTGTTCAACTACCCAGTTGAGCAGTGTGTCATGGAGAGACTGTGAGGTATATATCCAAG3 3 GACAAGTTGATGGGTCAACTCGTCACACAGTACCTCTCTGACACTCCATATATAGGTTC5 5 TCTAATGAAGCAAGGCCATAACAGGTCTGTGATGCCCTAAGATGTCCTGGGCTGCACGC3 3 AGATTACTTCGTTCCGGTATTGTCCAGACACTACGGGATTCTACAGGACCCGACGTGCG5 5 GCGCTACAATGATGGTGACAGCCAGTTTCTAGGT3 3 CGCGATGTTACTACCACTGTCGGTCAAAGATCCA5 Sample 4: Polychaete worm SSU rrna gene sequence 5 CAACTATCGATCCGTCGGCGTTGACATCAAGACCCTGCGGGCAGCTTCCGGG3 3 GTTGATAGCTAGGCAGCCGCAACTGTAGTTCTGGGACGCCCGTCGAAGGCCC5 5 AAACCAAAGTTTTTGGGTTCCGGGGGAAGTATGGTTGCAAAGCTGAAACTTA3 3 TTTGGTTTCAAAAACCCAAGGCCCCCTTCATACCAACGTTTCGACTTTGAAT5 5 AAGGAATTGACGGAAGGGCACCACCAGGAGTGGAGCCTGCGGCTTAATTTGA3 3 TTCCTTAACTGCCTTCCCGTGGTGGTCCTCACCTCGGACGCCGAATTAAACT5 5 CTCAACACGGGAAAACTCACCCGGCCCGGACACCGTAAGGATTGACAGATTG3 3 GAGTTGTGCCCTTTTGAGTGGGCCGGGCCTGTGGCATTCCTAACTGTCTAAC5 5 AGAGCTCTTTCTTGATTCGGTGGGTGGTGGTGCATGGCCGTTCTTAGTTGGTG3 3 TCTCGAGAAAGAACTAAGCCACCCACCACCACGTACCGGCAAGAATCAACCAC5 5 GAGCGATTTGTCTGGTTAATTCCGATAACGAACGAGACTCTAGCCTGCTAAA3 3 CTCGCTAAACAGACCAATTAAGGCTATTGCTTGCTCTGAGATCGGACGATTT5 5 TAGTTCGTTCATATCTGTTGTGAACGTTAACTTCTTAGAGGGACAAGTGGCGT3 3 ATCAAGCAAGTATAGACAACACTTGCAATTGAAGAATCTCCCTGTTCACCGCA5 5 TTAGCCACGCGAGATTGAGCAATAACAGGTCTGTGATGCCCTTAGATGTTCG3 3 AATCGGTGCGCTCTAACTCGTTATTGTCCAGACACTACTTTAATCTACAAGC5

14 o References and Further Reading Bartholomew, J. L., M. J. Whipple, D. G. Stevens, and J. L. Fryer The life cycle of Ceratomyxa shasta, a myxosporean parasite of salmonids, requires a freshwater polychaete as an alternate host. American Journal of Parasitology. 83: Dolan Learning Center, Animation of the Polymerase Chain Reaction. resources/shockwave/pcranwhole.html. Accessed July Accessed August Kreuzer, H. and A. Massey, eds. Polymerase Chain Reaction: Paper PCR in Recombinant DNA and Biotechnology, 2nd Edition. ASM Press, Washington, D.C pp Palenzuela, O., G. Trobridge, and J. Bartholomew PCR Diagnostics of Ceratomyxa Shasta. Diseases of Aquatic Organisms 36: Savonen, C A fish mystery. Oregon s Agricultural Progress 43:18 23.

BIOTECHNOLOGY. What can we do with DNA?

BIOTECHNOLOGY. What can we do with DNA? BIOTECHNOLOGY What can we do with DNA? Biotechnology Manipulation of biological organisms or their components for research and industrial purpose Usually manipulate DNA itself How to study individual gene?

More information

The Techniques of Molecular Biology: Forensic DNA Fingerprinting

The Techniques of Molecular Biology: Forensic DNA Fingerprinting Revised Fall 2011 The Techniques of Molecular Biology: Forensic DNA Fingerprinting The techniques of molecular biology are used to manipulate the structure and function of molecules such as DNA and proteins

More information

Chapter 20: Biotechnology: DNA Technology & Genomics

Chapter 20: Biotechnology: DNA Technology & Genomics Biotechnology Chapter 20: Biotechnology: DNA Technology & Genomics The BIG Questions How can we use our knowledge of DNA to: o Diagnose disease or defect? o Cure disease or defect? o Change/improve organisms?

More information

PCR Polymerase Chain Reaction

PCR Polymerase Chain Reaction Biological Sciences Initiative HHMI PCR Polymerase Chain Reaction PCR is an extremely powerful technique used to amplify any specific piece of DNA of interest. The DNA of interest is selectively amplified

More information

Sequencing a Genome: Inside the Washington University Genome Sequencing Center. Activity Supplement Paper PCR (DNA Amplification)

Sequencing a Genome: Inside the Washington University Genome Sequencing Center. Activity Supplement Paper PCR (DNA Amplification) Sequencing a Genome: Inside the Washington University Genome Sequencing Center Activity Supplement (DNA Amplification) Project Outline The multimedia project Sequencing a Genome: Inside the Washington

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites.

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites. 1. A recombinant DNA molecules is one that is a. produced through the process of crossing over that occurs in meiosis b. constructed from DNA from different sources c. constructed from novel combinations

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

Biotechnology Test Test

Biotechnology Test Test Log In Sign Up Biotechnology Test Test 15 Matching Questions Regenerate Test 1. Plasmid 2. PCR Process 3. humulin 4. pluripotent 5. polymerase chain reaction (PCR) a b Is much smaller than the human genome,

More information

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

Transcription Study Guide

Transcription Study Guide Transcription Study Guide This study guide is a written version of the material you have seen presented in the transcription unit. The cell s DNA contains the instructions for carrying out the work of

More information

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot Recombinant technology Gene analysis Sequencing PCR RNA Northern-blot RT PCR Protein Western-blot Sequencing Southern-blot in situ hybridization in situ hybridization Function analysis Histochemical analysis

More information

Microbiology Laboratory: MOLECULAR IDENTIFICATION OF UNKNOWN BACTERIA

Microbiology Laboratory: MOLECULAR IDENTIFICATION OF UNKNOWN BACTERIA Microbiology Laboratory: MOLECULAR IDENTIFICATION OF UNKNOWN BACTERIA Classical Microbiology courses are typically structured to introduce the identification of bacterial species using a series of biochemical

More information

Name Class Date. KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. frameshift mutation

Name Class Date. KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. frameshift mutation Unit 7 Study Guide Section 8.7: Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. VOCABULARY mutation point mutation frameshift mutation mutagen MAIN IDEA: Some mutations

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information

The Biotechnology Education Company

The Biotechnology Education Company EDVTEK P.. Box 1232 West Bethesda, MD 20827-1232 The Biotechnology 106 EDV-Kit # Principles of DNA Sequencing Experiment bjective: The objective of this experiment is to develop an understanding of DNA

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

Bio 3A Lab: DNA Isolation and the Polymerase Chain Reaction

Bio 3A Lab: DNA Isolation and the Polymerase Chain Reaction Bio 3A Lab: DNA Isolation and the Polymerase Chain Reaction Objectives Understand the process of DNA isolation Perform DNA isolation using cheek cells Use thermal cycler and Taq polymerase to perform DNA

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

Lab 5: DNA Fingerprinting

Lab 5: DNA Fingerprinting Lab 5: DNA Fingerprinting You are about to perform a procedure known as DNA fingerprinting. The data obtained may allow you to determine if the samples of DNA that you will be provided with are from the

More information

Biotechnology: DNA Technology & Genomics

Biotechnology: DNA Technology & Genomics Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Chapter 9 Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Q&A Interferons are species specific, so that interferons to be used in humans must be produced in human cells. Can you think

More information

Gene Mapping Techniques

Gene Mapping Techniques Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

Mitochondrial DNA Analysis

Mitochondrial DNA Analysis Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)

More information

Chapter 6 DNA Replication

Chapter 6 DNA Replication Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore

More information

4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?

4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true? Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.

More information

Crime Scenes and Genes

Crime Scenes and Genes Glossary Agarose Biotechnology Cell Chromosome DNA (deoxyribonucleic acid) Electrophoresis Gene Micro-pipette Mutation Nucleotide Nucleus PCR (Polymerase chain reaction) Primer STR (short tandem repeats)

More information

Biotechnology and Recombinant DNA

Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Recombinant DNA procedures - an overview Biotechnology: The use of microorganisms, cells, or cell components to make a product. Foods, antibiotics, vitamins, enzymes Recombinant

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

STANDARD 2 Students will demonstrate appropriate safety procedures and equipment use in the laboratory.

STANDARD 2 Students will demonstrate appropriate safety procedures and equipment use in the laboratory. BIOTECHNOLOGY Levels: 11-12 Units of Credit: 1.0 CIP Code: 51.1201 Prerequisite: Biology or Chemistry Skill Certificates: #708 COURSE DESCRIPTION is an exploratory course designed to create an awareness

More information

Recipient Cell. DNA Foreign DNA. Recombinant DNA

Recipient Cell. DNA Foreign DNA. Recombinant DNA Module 4B Biotechnology In this module, we will examine some of the techniques scientists have developed to study and manipulate the DNA of living organisms. Objective # 7 Explain what genetic recombination

More information

Recombinant DNA and Biotechnology

Recombinant DNA and Biotechnology Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study

More information

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Molecular Genetics. RNA, Transcription, & Protein Synthesis Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

Beginner s Guide to Real-Time PCR

Beginner s Guide to Real-Time PCR Beginner s Guide to Real-Time PCR 02 Real-time PCR basic principles PCR or the Polymerase Chain Reaction has become the cornerstone of modern molecular biology the world over. Real-time PCR is an advanced

More information

Replication Study Guide

Replication Study Guide Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have

More information

Fish Health Management Policy. September 12, 2003 Oregon Department of Fish and Wildlife

Fish Health Management Policy. September 12, 2003 Oregon Department of Fish and Wildlife Fish Health Management Policy September 12, 2003 Oregon Department of Fish and Wildlife Fish Health Management Policy 635-007-0960 Purpose The purpose of the Fish Health Management Policy is to describe

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information

DNA & Protein Synthesis Exam

DNA & Protein Synthesis Exam DNA & Protein Synthesis Exam DO NOT WRITE ON EXAM EXAM # VER. B Multiple choice Directions: Answer the following questions based on the following diagram. (1pt. each) 5. The above nucleotide is purine

More information

Experiment 2: DNA fingerprinting for microbial source tracking

Experiment 2: DNA fingerprinting for microbial source tracking Experiment 2: DNA fingerprinting for microbial source tracking Goal: To fingerprint strains of E. coli, and determine the source, as best as possible, for each of the strains. Introduction The Clean Water

More information

DNA and Forensic Science

DNA and Forensic Science DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief

More information

Name: Date: Period: DNA Unit: DNA Webquest

Name: Date: Period: DNA Unit: DNA Webquest Name: Date: Period: DNA Unit: DNA Webquest Part 1 History, DNA Structure, DNA Replication DNA History http://www.dnaftb.org/dnaftb/1/concept/index.html Read the text and answer the following questions.

More information

Genetics Module B, Anchor 3

Genetics Module B, Anchor 3 Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for

More information

restriction enzymes 350 Home R. Ward: Spring 2001

restriction enzymes 350 Home R. Ward: Spring 2001 restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually

More information

14.3 Studying the Human Genome

14.3 Studying the Human Genome 14.3 Studying the Human Genome Lesson Objectives Summarize the methods of DNA analysis. State the goals of the Human Genome Project and explain what we have learned so far. Lesson Summary Manipulating

More information

Lecture 38: DNA Fingerprinting

Lecture 38: DNA Fingerprinting Lecture 38: DNA Fingerprinting (DNA technology) The most awesome and powerful tool acquired by man since the splitting of atoms - The Time Magazine (USA) Conventional fingerprint of an individual comes

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter

More information

Next Generation Polymerase Chain Reaction

Next Generation Polymerase Chain Reaction Next Generation Polymerase Chain Reaction Developed by Nobel laureate Kary Mullis in the 1980s, Polymerase Chain Reaction (PCR) is a molecular technology that allows fast and in vitro. It has since become

More information

Activity 7.21 Transcription factors

Activity 7.21 Transcription factors Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation

More information

1/12 Dideoxy DNA Sequencing

1/12 Dideoxy DNA Sequencing 1/12 Dideoxy DNA Sequencing Dideoxy DNA sequencing utilizes two steps: PCR (polymerase chain reaction) amplification of DNA using dideoxy nucleoside triphosphates (Figures 1 and 2)and denaturing polyacrylamide

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

GFP Transformation Genetic Manipulations

GFP Transformation Genetic Manipulations MODULE 2 Objective 2.1 Lesson E GFP Transformation Genetic Manipulations Course Advanced Biotechnology Unit DNA Technology Essential Question How is foreign DNA genes taken up by organisms and expressed?

More information

The Steps. 1. Transcription. 2. Transferal. 3. Translation

The Steps. 1. Transcription. 2. Transferal. 3. Translation Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order

More information

VLLM0421c Medical Microbiology I, practical sessions. Protocol to topic J10

VLLM0421c Medical Microbiology I, practical sessions. Protocol to topic J10 Topic J10+11: Molecular-biological methods + Clinical virology I (hepatitis A, B & C, HIV) To study: PCR, ELISA, your own notes from serology reactions Task J10/1: DNA isolation of the etiological agent

More information

DNA: A Person s Ultimate Fingerprint

DNA: A Person s Ultimate Fingerprint A partnership between the UAB Center for Community Outreach Development and McWane Center DNA: A Person s Ultimate Fingerprint This project is supported by a Science Education Partnership Award (SEPA)

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns

More information

ab185916 Hi-Fi cdna Synthesis Kit

ab185916 Hi-Fi cdna Synthesis Kit ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1

More information

Cloning of genes from genomic DNA: Part 3-Restriction Enzyme Digestion and Agarose Gel Electrophoresis

Cloning of genes from genomic DNA: Part 3-Restriction Enzyme Digestion and Agarose Gel Electrophoresis Cloning of genes from genomic DNA: Part 3-Restriction Enzyme Digestion and Agarose Gel Electrophoresis Continuing from our isolation of genomic DNA and PCR amplification of either the evenskipped gene

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period Chapter 20: Biotechnology The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult

More information

Objectives: Vocabulary:

Objectives: Vocabulary: Introduction to Agarose Gel Electrophoresis: A Precursor to Cornell Institute for Biology Teacher s lab Author: Jennifer Weiser and Laura Austen Date Created: 2010 Subject: Molecular Biology and Genetics

More information

IMBB 2013. Genomic DNA purifica8on

IMBB 2013. Genomic DNA purifica8on IMBB 2013 Genomic DNA purifica8on Why purify DNA? The purpose of DNA purifica8on from the cell/8ssue is to ensure it performs well in subsequent downstream applica8ons, e.g. Polymerase Chain Reac8on (PCR),

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.

1. Molecular computation uses molecules to represent information and molecular processes to implement information processing. Chapter IV Molecular Computation These lecture notes are exclusively for the use of students in Prof. MacLennan s Unconventional Computation course. c 2013, B. J. MacLennan, EECS, University of Tennessee,

More information

Essentials of Real Time PCR. About Sequence Detection Chemistries

Essentials of Real Time PCR. About Sequence Detection Chemistries Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected

More information

Recombinant Paper Plasmids Cut-and-Paste Biotechnology

Recombinant Paper Plasmids Cut-and-Paste Biotechnology Recombinant Paper Plasmids Cut-and-Paste Biotechnology OBJECTIVE / RIONALE Bioengineers make news using recombinant DNA techniques in hopes of curing genetic diseases, better understanding cancer, and

More information

RNA & Protein Synthesis

RNA & Protein Synthesis RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis

More information

Identification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes

Identification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes Identification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes 1. Aim and field of application The present method concerns the identification

More information

13.4 Gene Regulation and Expression

13.4 Gene Regulation and Expression 13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.

More information

Introduction. Chapter 11 DNA replication, repair and recombination. Overview. DNA replication is essential for life. Short on DNA structure

Introduction. Chapter 11 DNA replication, repair and recombination. Overview. DNA replication is essential for life. Short on DNA structure Chapter 11 DNA replication, repair and recombination Overview Brief introduction DNA replication DNA repair DNA recombination DNA replication is essential for life Introduction Cells divide and make copies

More information

Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.

Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question. Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists

More information

1. Which of the following correctly organizes genetic material from the broadest category to the most specific category?

1. Which of the following correctly organizes genetic material from the broadest category to the most specific category? DNA and Genetics 1. Which of the following correctly organizes genetic material from the broadest category to the most specific category? A. genome chromosome gene DNA molecule B. genome chromosome DNA

More information

Amazing DNA facts. Hands-on DNA: A Question of Taste Amazing facts and quiz questions

Amazing DNA facts. Hands-on DNA: A Question of Taste Amazing facts and quiz questions Amazing DNA facts These facts can form the basis of a quiz (for example, how many base pairs are there in the human genome?). Students should be familiar with most of this material, so the quiz could be

More information

To be able to describe polypeptide synthesis including transcription and splicing

To be able to describe polypeptide synthesis including transcription and splicing Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain

More information

DNA Scissors: Introduction to Restriction Enzymes

DNA Scissors: Introduction to Restriction Enzymes DNA Scissors: Introduction to Restriction Enzymes Objectives At the end of this activity, students should be able to 1. Describe a typical restriction site as a 4- or 6-base- pair palindrome; 2. Describe

More information

CompleteⅡ 1st strand cdna Synthesis Kit

CompleteⅡ 1st strand cdna Synthesis Kit Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:

More information

Bob Jesberg. Boston, MA April 3, 2014

Bob Jesberg. Boston, MA April 3, 2014 DNA, Replication and Transcription Bob Jesberg NSTA Conference Boston, MA April 3, 2014 1 Workshop Agenda Looking at DNA and Forensics The DNA, Replication i and Transcription i Set DNA Ladder The Double

More information

Cloning GFP into Mammalian cells

Cloning GFP into Mammalian cells Protocol for Cloning GFP into Mammalian cells Studiepraktik 2013 Molecular Biology and Molecular Medicine Aarhus University Produced by the instructors: Tobias Holm Bønnelykke, Rikke Mouridsen, Steffan

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

Genetic Engineering and Biotechnology

Genetic Engineering and Biotechnology 1 So, what is biotechnology?? The use of living organisms to carry out defined chemical processes for industrial or commercial application. The office of Technology Assessment of the U.S. Congress defines

More information

DNA Replication in Prokaryotes

DNA Replication in Prokaryotes OpenStax-CNX module: m44488 1 DNA Replication in Prokaryotes OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

Microbiology / Active Lecture Questions Chapter 9 Biotechnology & Recombinant DNA 1 Chapter 9 Biotechnology & Recombinant DNA

Microbiology / Active Lecture Questions Chapter 9 Biotechnology & Recombinant DNA 1 Chapter 9 Biotechnology & Recombinant DNA 1 2 Restriction enzymes were first discovered with the observation that a. DNA is restricted to the nucleus. b. phage DNA is destroyed in a host cell. c. foreign DNA is kept out of a cell. d. foreign DNA

More information

Lecture 36: Basics of DNA Cloning-II

Lecture 36: Basics of DNA Cloning-II Lecture 36: Basics of DNA Cloning-II Note: Before starting this lecture students should have completed Lecture 35 Sequential steps involved in DNA cloning using plasmid DNA as vector: Molecular cloning

More information

II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes

II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes HEREDITY = passing on of characteristics from parents to offspring How?...DNA! I. DNA, Chromosomes, Chromatin, and Genes DNA = blueprint of life (has the instructions for making an organism) Chromatin=

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

Immunology Ambassador Guide (updated 2014)

Immunology Ambassador Guide (updated 2014) Immunology Ambassador Guide (updated 2014) Immunity and Disease We will talk today about the immune system and how it protects us from disease. Also, we ll learn some unique ways that our immune system

More information

Kaustubha Qanungo Ph.D Biological Sciences Trident Technical College 7000 Rivers Avenue Charleston SC 29464

Kaustubha Qanungo Ph.D Biological Sciences Trident Technical College 7000 Rivers Avenue Charleston SC 29464 Call for action: Paradigm shift in teaching microbiology in a community colleges Kaustubha Qanungo Ph.D Biological Sciences Trident Technical College 7000 Rivers Avenue Charleston SC 29464 Project Course:

More information

13.2 Ribosomes & Protein Synthesis

13.2 Ribosomes & Protein Synthesis 13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).

More information

Total Test Questions: 71 Levels: Grades 10-12 Units of Credit: 1.0 STANDARD 1 STUDENTS WILL INVESTIGATE THE PAST, PRESENT, AND FUTURE APPLICATIONS OF

Total Test Questions: 71 Levels: Grades 10-12 Units of Credit: 1.0 STANDARD 1 STUDENTS WILL INVESTIGATE THE PAST, PRESENT, AND FUTURE APPLICATIONS OF DESCRIPTION Biotechnology is designed to create an awareness of career possibilities in the field of biotechnology. Students are introduced to diagnostic and therapeutic laboratory procedures that support

More information

Activity 4 Long-Term Effects of Drug Addiction

Activity 4 Long-Term Effects of Drug Addiction Activity 4 Long-Term Effects of Drug Addiction Core Concept: Addictive drugs may lead to long-term changes in brain function. Class time required: Approximately 60-80 minutes Teacher Provides: Copy of

More information

PRACTICE TEST QUESTIONS

PRACTICE TEST QUESTIONS PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

Reliable PCR Components for Molecular Diagnostic Assays

Reliable PCR Components for Molecular Diagnostic Assays Reliable PCR Components for Molecular Diagnostic Assays Terri McDonnell, MBA, PMP Senior Program Manager, Molecular Diagnostics March 2014 In this webinar we will: Discuss requirements for amplification

More information

Chapter 17: From Gene to Protein

Chapter 17: From Gene to Protein Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master

More information

Disease Risks Posed by Hatchery Salmon

Disease Risks Posed by Hatchery Salmon Disease Risks Posed by Hatchery Salmon James Winton US Geological Survey Western Fisheries Research Center Seattle, Washington Disease in Populations of Wild Fish Disease is a component of natural mortality

More information