escience and Post-Genome Biomedical Research
|
|
|
- Darren Harrington
- 10 years ago
- Views:
Transcription
1 escience and Post-Genome Biomedical Research Thomas L. Casavant, Adam P. DeLuca Departments of Biomedical Engineering, Electrical Engineering and Ophthalmology Coordinated Laboratory for Computational Genomics (CLCG) Center for Bioinformatics and Computational Biology (CBCB) 1
2 Outline 1. General Observations about Postgenomic escience 1. Specific Case Study where Traditional Publication and Archiving Practices are Lacking 1. Impact of Emerging Technology on Scale of the escience Problems 2
3 Post-Genomic escience The Post-Genome Era 3 Primary Types of Investigation 1. Generation of New High-Throughput Data (new Genome Projects ) 2. Generating New Data in the Context of Existing Results (Published or in Databases) 3. No New Data Exclusive re-use of Published Data 3
4 Case Study: Genomic Rearrangements or Deletions/Duplications (Dr. Krishna Rani Kalari, Mayo Clinic) 1. Goal: Identification of Human disease causing mutations 2. Observation: Assays exist to identify deletions and duplications time consuming laborious expensive 3. Approach: Develop In-silico procedures to identify and prioritize candidate deletion/duplication sites and accelerate the finding of disease mutation discovery 4
5 Approach Details 1. Construct case and control data sets for all known cases of disease causing unequal recombinations 2. Identify and obtain informative sequencebased features to create a training set 3. Evaluate machine learning methods on the training set 4. Design and develop a computational system to identify and prioritize candidate intragene deletions and duplications 5
6 Approach - System Level Obtain list of genes that have deletions/duplications Identify candidates From Published Literature Collect all the breakpoint sequences Case sequences Obtain annotation, melting Temperature and hapmap features for the DNA sequences Control sequences System/Analysis Predict deletion or duplication candidates 6
7 HGMD statistics 2362 genes have mutations 7 % (4,500) of the mutations in HGMD are caused by gross deletions and duplications. 7
8 HGMD mutation classification Mutation type Nucleotide substitutions (missene / nonsense) Total number of mutations Nucleotide substitutions (splicing) 46 Nucleotide substitutions (regulatory) 0 Small deletions 52 Small insertions 12 Small indels 1 Gross deletions 2 Gross insertions and duplications 0 Complex rearrangements (inversions) 1 Repeat variations 0 294
9 HGMD - Gross deletions Accession Number Description Phenotype Reference CG ex. 18 (described at genomic DNA level) CG bp nt (described at genomic DNA level) Stargardt disease Yatsenko (2003) Hum Mutat 21, 636 Stargardt disease Lewis (1999) Am J Hum Genet 64, 422
10 Local Deletion Database 10
11 Of the 4,500 Possible Training Cases, How Many Did We Get??? Searched for specific break point information for 1463 IDDs described in HGMD Identified 102 fully-characterized rearrangement breakpoints (cases) know exactly where the breakpoint occurs Identified 2338 matching set of breakpoints for each of the positives for which IDDs have not been observed (controls) 11
12 SPeeDD web-interface 12
13 Lessons From Deletion Case Study Important results and data are buried in traditional forms of scientific publication and dissemination mechanisms (no surprise here). Fidelity and throughput of legacy results inadequate Necessary data can be requested from investigators In some cases Reference to a changing world of what is assumed to be known Stay tuned the problem will only get worse 13
14 Impact of Emerging Technology on Scale of the escience Problems 14
15 ~3 genomes/week Genomes Online Database v
16 How did we get here? Advances in genome sequencing were driven by the Human Genome Project Scale-up started in 1999 Resources concentrated in large genome centers Increase in capacity Reduction in cost Economies of scale Improved technology Sequencing infrastructure available for non-human projects 16
17 Genome Center Perspective (George Weinstock, Wash-U/Baylor GSCs) Research is Data-driven Produce more data Hypothesis generating > hypothesis testing Community resource projects Rapid data release; prepublication Etiquette in use of prepublication data No intellectual property contraints Production is Technology-enabled Develop or acquire new technologies 17
18 130:1
19 Human disease study 500 cases controls 500 genes, 15 exons/targets per gene 2 reads/target 15 million reads to screen 1,000 subjects 454: 10M rds/d or Solexa: 160M rds/d Conclusion: this is a small experiment 19
20 Project Jim Whole human genome Proof of Principle What can be learned from a single genome? What biases exist in the data? What analysis issues arise? Not a consensus sequence but need to capture both alleles: 6 GB not 3 GB Data quality vs variation: how do you know a variant base is a mutation and not an error 20
21 Conclusions: Post-genomic escience 1. Generation of New High-Throughput Data (new Genome Projects ) 2. Generating New Data in the Context of Existing Results (Published or in Databases) 3. No New Data Exclusive re-use of Published Data 21
Focusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
Next Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University [email protected] http://tandem.bu.edu/ The Human Genome Project took
Delivering the power of the world s most successful genomics platform
Delivering the power of the world s most successful genomics platform NextCODE Health is bringing the full power of the world s largest and most successful genomics platform to everyday clinical care NextCODE
Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
Single Nucleotide Polymorphisms (SNPs)
Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded
Genomes and SNPs in Malaria and Sickle Cell Anemia
Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing
Information leaflet. Centrum voor Medische Genetica. Version 1/20150504 Design by Ben Caljon, UZ Brussel. Universitair Ziekenhuis Brussel
Information on genome-wide genetic testing Array Comparative Genomic Hybridization (array CGH) Single Nucleotide Polymorphism array (SNP array) Massive Parallel Sequencing (MPS) Version 120150504 Design
IMPLEMENTING BIG DATA IN TODAY S HEALTH CARE PRAXIS: A CONUNDRUM TO PATIENTS, CAREGIVERS AND OTHER STAKEHOLDERS - WHAT IS THE VALUE AND WHO PAYS
IMPLEMENTING BIG DATA IN TODAY S HEALTH CARE PRAXIS: A CONUNDRUM TO PATIENTS, CAREGIVERS AND OTHER STAKEHOLDERS - WHAT IS THE VALUE AND WHO PAYS 29 OCTOBER 2015 DR. DIRK J. EVERS BACKGROUND TreatmentMAP
Leading Genomics. Diagnostic. Discove. Collab. harma. Shanghai Cambridge, MA Reykjavik
Leading Genomics Diagnostic harma Discove Collab Shanghai Cambridge, MA Reykjavik Global leadership for using the genome to create better medicine WuXi NextCODE provides a uniquely proven and integrated
DNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
The NF1-gene a hotspot for de novo Alu- and L1-insertion?
The NF1-gene a hotspot for de novo Alu- and L1-insertion? Katharina Wimmer Division Humangenetik, Medizinische Universität Innsbruck Molekulare Diagnostik 2013 Zürich, 1. März, 2013 2 Die im Vortrag vorgestellten
Dr Alexander Henzing
Horizon 2020 Health, Demographic Change & Wellbeing EU funding, research and collaboration opportunities for 2016/17 Innovate UK funding opportunities in omics, bridging health and life sciences Dr Alexander
Introduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 [email protected]
A Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
Genetic diagnostics the gateway to personalized medicine
Micronova 20.11.2012 Genetic diagnostics the gateway to personalized medicine Kristiina Assoc. professor, Director of Genetic Department HUSLAB, Helsinki University Central Hospital The Human Genome Packed
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE E15
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE DEFINITIONS FOR GENOMIC BIOMARKERS, PHARMACOGENOMICS,
Biological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
European Genome-phenome Archive database of human data consented for use in biomedical research at the European Bioinformatics Institute
European Genome-phenome Archive database of human data consented for use in biomedical research at the European Bioinformatics Institute Justin Paschall Team Leader Genetic Variation / EGA ! European Genome-phenome
Human Genome Organization: An Update. Genome Organization: An Update
Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
Sequencing and microarrays for genome analysis: complementary rather than competing?
Sequencing and microarrays for genome analysis: complementary rather than competing? Simon Hughes, Richard Capper, Sandra Lam and Nicole Sparkes Introduction The human genome is comprised of more than
Workshop on Establishing a Central Resource of Data from Genome Sequencing Projects
Report on the Workshop on Establishing a Central Resource of Data from Genome Sequencing Projects Background and Goals of the Workshop June 5 6, 2012 The use of genome sequencing in human research is growing
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
How To Understand The Science Of Genomics
Curs Bioinformática. Grau Genética GENÓMICA INTRODUCTION TO GENOME SCIENCE Antonio Barbadilla Group Genomics, Bioinformatics & Evolution Institut Biotecnologia I Biomedicina Departament de Genètica i Microbiologia
An example of bioinformatics application on plant breeding projects in Rijk Zwaan
An example of bioinformatics application on plant breeding projects in Rijk Zwaan Xiangyu Rao 17-08-2012 Introduction of RZ Rijk Zwaan is active worldwide as a vegetable breeding company that focuses on
European Medicines Agency
European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein
SOP 3 v2: web-based selection of oligonucleotide primer trios for genotyping of human and mouse polymorphisms
W548 W552 Nucleic Acids Research, 2005, Vol. 33, Web Server issue doi:10.1093/nar/gki483 SOP 3 v2: web-based selection of oligonucleotide primer trios for genotyping of human and mouse polymorphisms Steven
TRACKS GENETIC EPIDEMIOLOGY
Dr. Priya Duggal, Director In the post-genomic era where larger amounts of genetic data are now readily available, it has become increasingly important to design studies and use analytical techniques that
A leader in the development and application of information technology to prevent and treat disease.
A leader in the development and application of information technology to prevent and treat disease. About MOLECULAR HEALTH Molecular Health was founded in 2004 with the vision of changing healthcare. Today
G E N OM I C S S E RV I C ES
GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E
Validation parameters: An introduction to measures of
Validation parameters: An introduction to measures of test accuracy Types of tests All tests are fundamentally quantitative Sometimes we use the quantitative result directly However, it is often necessary
Sharing Data from Large-scale Biological Research Projects: A System of Tripartite Responsibility
Sharing Data from Large-scale Biological Research Projects: A System of Tripartite Responsibility Report of a meeting organized by the Wellcome Trust and held on 14 15 January 2003 at Fort Lauderdale,
AP BIOLOGY 2010 SCORING GUIDELINES (Form B)
AP BIOLOGY 2010 SCORING GUIDELINES (Form B) Question 2 Certain human genetic conditions, such as sickle cell anemia, result from single base-pair mutations in DNA. (a) Explain how a single base-pair mutation
Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe
Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. To published results faster With proven scalability To the forefront of discovery To limitless applications
Single-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples
DATA Sheet Single-Cell DNA Sequencing with the C 1 Single-Cell Auto Prep System Reveal hidden populations and genetic diversity within complex samples Single-cell sensitivity Discover and detect SNPs,
Evolution (18%) 11 Items Sample Test Prep Questions
Evolution (18%) 11 Items Sample Test Prep Questions Grade 7 (Evolution) 3.a Students know both genetic variation and environmental factors are causes of evolution and diversity of organisms. (pg. 109 Science
Core Facility Genomics
Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray
Automated DNA sequencing 20/12/2009. Next Generation Sequencing
DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
Next Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
Staphylococcus aureus Protein A (spa) Typing
Staphylococcus aureus Protein A (spa) Typing Senior scientist Henrik Hasman, National Food Institute-DTU Henrik Hasman [email protected] +45 35 88 63 47 Typing method for S. aureus Gold standard - Phage
Lecture 3: Mutations
Lecture 3: Mutations Recall that the flow of information within a cell involves the transcription of DNA to mrna and the translation of mrna to protein. Recall also, that the flow of information between
Umm AL Qura University MUTATIONS. Dr Neda M Bogari
Umm AL Qura University MUTATIONS Dr Neda M Bogari CONTACTS www.bogari.net http://web.me.com/bogari/bogari.net/ From DNA to Mutations MUTATION Definition: Permanent change in nucleotide sequence. It can
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
Module 1. Sequence Formats and Retrieval. Charles Steward
The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.
Genomics and Health Data Standards: Lessons from the Past and Present for a Genome-enabled Future
Genomics and Health Data Standards: Lessons from the Past and Present for a Genome-enabled Future Daniel Masys, MD Professor and Chair Department of Biomedical Informatics Professor of Medicine Vanderbilt
BioBoot Camp Genetics
BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before
Genetics of Rheumatoid Arthritis Markey Lecture Series
Genetics of Rheumatoid Arthritis Markey Lecture Series Al Kim [email protected] 2012.09.06 Overview of Rheumatoid Arthritis Rheumatoid Arthritis (RA) Autoimmune disease primarily targeting the synovium
Vad är bioinformatik och varför behöver vi det i vården? a bioinformatician's perspectives
Vad är bioinformatik och varför behöver vi det i vården? a bioinformatician's perspectives [email protected] 2015-05-21 Functional Bioinformatics, Örebro University Vad är bioinformatik och varför
NGS and complex genetics
NGS and complex genetics Robert Kraaij Genetic Laboratory Department of Internal Medicine [email protected] Gene Hunting Rotterdam Study and GWAS Next Generation Sequencing Gene Hunting Mendelian gene
Introduction to NGS data analysis
Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High
Analysis of NGS Data
Analysis of NGS Data Introduction and Basics Folie: 1 Overview of Analysis Workflow Images Basecalling Sequences denovo - Sequencing Assembly Annotation Resequencing Alignments Comparison to reference
CRAC: An integrated approach to analyse RNA-seq reads Additional File 3 Results on simulated RNA-seq data.
: An integrated approach to analyse RNA-seq reads Additional File 3 Results on simulated RNA-seq data. Nicolas Philippe and Mikael Salson and Thérèse Commes and Eric Rivals February 13, 2013 1 Results
ITT Advanced Medical Technologies - A Programmer's Overview
ITT Advanced Medical Technologies (Ileri Tip Teknolojileri) ITT Advanced Medical Technologies (Ileri Tip Teknolojileri) is a biotechnology company (SME) established in Turkey. Its activity area is research,
Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) [email protected]
Bioinformatique et Séquençage Haut Débit, Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) [email protected] 1 RNA Transcription to RNA and subsequent
Arabidopsis. A Practical Approach. Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham
Arabidopsis A Practical Approach Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham OXPORD UNIVERSITY PRESS List of Contributors Abbreviations xv xvu
TRANSLATIONAL BIOINFORMATICS 101
TRANSLATIONAL BIOINFORMATICS 101 JESSICA D. TENENBAUM Department of Bioinformatics and Biostatistics, Duke University Durham, NC 27715 USA [email protected] SUBHA MADHAVAN Innovation Center for
Roberto Ciccone, Orsetta Zuffardi Università di Pavia
Roberto Ciccone, Orsetta Zuffardi Università di Pavia XIII Corso di Formazione Malformazioni Congenite dalla Diagnosi Prenatale alla Terapia Postnatale unipv.eu Carrara, 24 ottobre 2014 Legend:Bluebars
Lecture Outline. Introduction to Databases. Introduction. Data Formats Sample databases How to text search databases. Shifra Ben-Dor Irit Orr
Introduction to Databases Shifra Ben-Dor Irit Orr Lecture Outline Introduction Data and Database types Database components Data Formats Sample databases How to text search databases What units of information
Targeted. sequencing solutions. Accurate, scalable, fast TARGETED
Targeted TARGETED Sequencing sequencing solutions Accurate, scalable, fast Sequencing for every lab, every budget, every application Ion Torrent semiconductor sequencing Ion Torrent technology has pioneered
Genetic Algorithm. Based on Darwinian Paradigm. Intrinsically a robust search and optimization mechanism. Conceptual Algorithm
24 Genetic Algorithm Based on Darwinian Paradigm Reproduction Competition Survive Selection Intrinsically a robust search and optimization mechanism Slide -47 - Conceptual Algorithm Slide -48 - 25 Genetic
Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling
Lectures 1 and 8 15 February 7, 2013 This is a review of the material from lectures 1 and 8 14. Note that the material from lecture 15 is not relevant for the final exam. Today we will go over the material
MUTATION, DNA REPAIR AND CANCER
MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful
Teaching Bioinformatics to Undergraduates
Teaching Bioinformatics to Undergraduates http://www.med.nyu.edu/rcr/asm Stuart M. Brown Research Computing, NYU School of Medicine I. What is Bioinformatics? II. Challenges of teaching bioinformatics
SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications
Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each
DNA-Analytik III. Genetische Variabilität
DNA-Analytik III Genetische Variabilität Genetische Variabilität Lexikon Scherer et al. Nat Genet Suppl 39:s7 (2007) Genetische Variabilität Sequenzvariation Mutationen (Mikro~) Basensubstitution Insertion
Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office
2013 Laboratory Accreditation Program Audioconferences and Webinars Implementing Next Generation Sequencing (NGS) as a Clinical Tool in the Laboratory Nazneen Aziz, PhD Director, Molecular Medicine Transformation
TECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298
DIAGNOSTICS BUSINESS ANALYSIS SERIES: TECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298 By ADAMS BUSINESS ASSOCIATES MAY 2014. May 2014 ABA 298 1 Technologies, Products & Services
Bioinformatics: course introduction
Bioinformatics: course introduction Filip Železný Czech Technical University in Prague Faculty of Electrical Engineering Department of Cybernetics Intelligent Data Analysis lab http://ida.felk.cvut.cz
Human Genome and Human Genome Project. Louxin Zhang
Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular
NIH s Genomic Data Sharing Policy
NIH s Genomic Data Sharing Policy 2 Benefits of Data Sharing Enables data generated from one study to be used to explore a wide range of additional research questions Increases statistical power and scientific
Data Integration. Lectures 16 & 17. ECS289A, WQ03, Filkov
Data Integration Lectures 16 & 17 Lectures Outline Goals for Data Integration Homogeneous data integration time series data (Filkov et al. 2002) Heterogeneous data integration microarray + sequence microarray
GenBank: A Database of Genetic Sequence Data
GenBank: A Database of Genetic Sequence Data Computer Science 105 Boston University David G. Sullivan, Ph.D. An Explosion of Scientific Data Scientists are generating ever increasing amounts of data. Relevant
BI122 Introduction to Human Genetics, Fall 2014
BI122 Introduction to Human Genetics, Fall 2014 Course Overview We will explore 1) the genetic and molecular basis of heredity and inherited traits, 2) how genetics & genomics reveals an understanding
Challenges associated with analysis and storage of NGS data
Challenges associated with analysis and storage of NGS data Gabriella Rustici Research and training coordinator Functional Genomics Group [email protected] Next-generation sequencing Next-generation sequencing
Enhancing Functionality of EHRs for Genomic Research, Including E- Phenotying, Integrating Genomic Data, Transportable CDS, Privacy Threats
Enhancing Functionality of EHRs for Genomic Research, Including E- Phenotying, Integrating Genomic Data, Transportable CDS, Privacy Threats Genomic Medicine 8 meeting Alexa McCray Christopher G Chute Rex
Gene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook)
Name Date Per Look at the diagrams, then answer the questions. Gene Mutations affect a single gene by changing its base sequence, resulting in an incorrect, or nonfunctional, protein being made. (a) A
Cancer Genomics: What Does It Mean for You?
Cancer Genomics: What Does It Mean for You? The Connection Between Cancer and DNA One person dies from cancer each minute in the United States. That s 1,500 deaths each day. As the population ages, this
Towards Integrating the Detection of Genetic Variants into an In-Memory Database
Towards Integrating the Detection of Genetic Variants into an 2nd International Workshop on Big Data in Bioinformatics and Healthcare Oct 27, 2014 Motivation Genome Data Analysis Process DNA Sample Base
Innovations in Molecular Epidemiology
Innovations in Molecular Epidemiology Molecular Epidemiology Measure current rates of active transmission Determine whether recurrent tuberculosis is attributable to exogenous reinfection Determine whether
Gene mutation and molecular medicine Chapter 15
Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to
Integration of genomic data into electronic health records
Integration of genomic data into electronic health records Daniel Masys, MD Affiliate Professor Biomedical & Health Informatics University of Washington, Seattle Major portion of today s lecture is based
Site-Directed Nucleases and Cisgenesis Maria Fedorova, Ph.D.
Site-Directed Nucleases and Cisgenesis Maria Fedorova, Ph.D. Regulatory Strategy Lead Enabling Technologies DuPont-Pioneer, USA 1 New Plant Breeding Techniques 2007 New Techniques Working Group established
Regulatory Issues in Genetic Testing and Targeted Drug Development
Regulatory Issues in Genetic Testing and Targeted Drug Development Janet Woodcock, M.D. Deputy Commissioner for Operations Food and Drug Administration October 12, 2006 Genetic and Genomic Tests are Types
Cloud-Based Big Data Analytics in Bioinformatics
Cloud-Based Big Data Analytics in Bioinformatics Presented By Cephas Mawere Harare Institute of Technology, Zimbabwe 1 Introduction 2 Big Data Analytics Big Data are a collection of data sets so large
Localised Sex, Contingency and Mutator Genes. Bacterial Genetics as a Metaphor for Computing Systems
Localised Sex, Contingency and Mutator Genes Bacterial Genetics as a Metaphor for Computing Systems Outline Living Systems as metaphors Evolutionary mechanisms Mutation Sex and Localized sex Contingent
Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations
Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations AlCoB 2014 First International Conference on Algorithms for Computational Biology Thiago da Silva Arruda Institute
Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
Genomic CDS: an example of a complex ontology for pharmacogenetics and clinical decision support
Genomic CDS: an example of a complex ontology for pharmacogenetics and clinical decision support Matthias Samwald 1 1 Medical University of Vienna, Vienna, Austria [email protected] Abstract.
