Workshop on Methods for Isolation and Identification of Campylobacter spp. June 13-17, 2005

Transcription

1 Workshop on Methods for Isolation and Identification of Campylobacter spp June 13-17, 2005 Goal: build capacity within the state public health laboratories to effectively identify Campylobacter species and detect outbreaks by: Providing hands-on experience with laboratory procedures for the isolation and characterization of the Campylobacter species commonly isolated from clinical specimens

2 Pre / Post assessment results Participant Pre-Test Post-test % increase in score 1 57% 82% 25% 2 43% 57% 14% 3 51% 80% 29% 4 44% 69% 25% 5 38% 75% 37% 6 35% 65% 30% 7 37% 59% 22% 8 48% 78% 30% 9 47% 72% 25% 10 53% 87% 34% 11 47% 68% 21% 12 25% 52% 27% 13 44% 67% 23% 14 49% 84% 35% 15 40% 53% 13% 16 32% 81% 49%

3 PFGE and Beyond: PulseNet in the Next Decade Bala Swaminathan, PhD Centers for Disease Control and Prevention

4 Why Next Generation Subtyping Methods? PFGE (and other RFLP-based methods) are difficult to standardize Comparability of patterns within and between laboratories requires strict adherence to a standard protocol Normalization of patterns is complex PFGE is labor-intensive and requires high concentrations of a pure culture In some instances or for some pathogen groups, discrimination may not be adequate

5 Requirements for the next generation subtyping method for PulseNet Broad applicability Rapid results (<( 24 h) Inexpensive Better discrimination than PFGE Quantitative relatedness between strains Accurate snapshot of the genome diversity Backward compatibility with PFGE data Easy to perform on a routine basis Amenable to automation Results should be readily comparable within and between laboratories

6 Perna et al, Nature 409: , 2001

7 Methodologic Approaches Multi-locus locus sequence typing (MLST) Inadequate discrimination for most enteric pathogens for outbreak investigations Useful for Campylobacter jejuni Multi-locus locus Variable-Number Tandem Repeat Analysis (MLVA) Most promising for near-term subtyping High throughput SNP analysis Method of choice for the long term

8 Multilocus VNTR Analysis (MLVA) MLVA (Multi( Locus VNTR Analysis) Variable Number Tandem Repeats (VNTRs) Conserved repeat motif found in the genome Example: TAACCG Variable numbers of repeat units among isolates of the same species MLVA examines the number of repeats at multiple loci to determine genetic relationships Isolate A Isolate B Isolate C Isolate D TAACCG TAACCGTAACCG TAACCGTAACCGTAACCGTAACCG TAACCGTAACCGTAACCGTAACCGTAACCG

9 Variable Number Tandem Repeats VNTRs Insertion Deletion

10 Multiple Locus VNTR Analysis can be developed from low-pass sequence data

11 Development of E coli O157 MLVA protocol Contract awarded to the Massachusetts Department of Public Health / State Laboratory Institute in fall 2001 Collaboration with Dr Paul Keim (The Northern Arizona University)

12 E coli O157 strains used in the initial validation at CDC 152 isolates analyzed by both MLVA and PFGE using XbaI Geographically diverse sporadic isolates with unique XbaI PFGE patterns (UPP collection) Outbreak isolates from eight well characterized outbreaks Epidemiologically unrelated isolates clustered by PFGE A subset of 54 isolates were further characterized with BlnI

13 Nine VNTR loci included in the optimized MLVA protocol for E coli O157 VNTR Alternative name 1 Repeat size (bp) No of repeats No of alleles Inside ORF Minimum Maximum VNTR-3 Vhec3, TR Yes VNTR-9 Vhec4, TR No VNTR-10 Vhec1, TR Yes VNTR-17 TR Yes VNTR-19 TR Yes VNTR-25 TR No VNTR-34 Vhec2, TR Yes VNTR-36 Vhec No VNTR Yes 1 Vhec loci are form Lindstedt et al (2003); TR loci are from Noller et al (2003)

14 Discriminatory power of MLVA 152 isolates compared to PFGE 133 unique MLVA patterns 126 unique XbaI I PFGE patterns A subset of 54 isolates were characterized by PFGE using two enzymes 35 unique MLVA patterns 39 unique XbaI-Bln BlnI I PFGE patterns

15 VNTR_vals MLVA_composite Clustering of outbreak isolates and some selected sporadic isolates by MLVA 100 F5733 H6436 G5308 F6141 H F7382 F8751 F8768 F7383 F7384 C9523 C9581 C9815 G5244 A7793 F7349 F7350 F7351 F7353 F7354 F6749 F6750 A8184 EDL933 EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHX EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA EXHA GA / Stool GA / Stool ME / Environmental GA / Meat CT / Stool VA / Stool NJ / Stool CO / Stool CO / Ground beef NJ / Hamburger NJ / Fatal case WA / Sporadic CA / Outbreak AZ / Sporadic WA / Sporadic OR / Stool WI / Stool WI / Stool WI / Taco meat WI / Stool WI / Stool NY / Fatal case NY / Sibling MI / Stool MI / Hamburger GA water park outbreak CT apple cider outbreak CO outbreak NJ outbreak Western States outbreak WI restaurant outbreak NY County Fair MI outbreak

16 Conclusions from the on-going validation of the E coli O157 MLVA protocol Overall, MLVA slightly less discriminating than PFGE with two enzymes MLVA can further discriminate some of the most common PFGE patterns Epidemiological congruence of the MLVA data appears to be equal to or better than PFGE Development of interpretation guidelines may pose a challenge

17 2005: Future plans July: : Complete the CDC internal validation of the E coli O157 MLVA protocol August-September September: : Begin collaborative validation of the E coli O157 MLVA protocol by transferring the protocol to PulseNet participating laboratories

18 PFGE vs MLVA in Outbreak Isolates (Data from Minnesota Dept of Health) Outbreak OB1 (n=6) OB2 (n=32) OB3 (n=6) OB4 (n=8) OB5 (n=6) OB6 (n=10) PFGE TM 14 (4) TM 215 (1) TM 352 (1) TM 127 TM 5b TM 2d TM 1a TM 43 Outbreak Type MLVA MST 48 MST 62 (1) MST 81 (1) MST 60 (1) MST 61 (29) MST 10 (2) MST 8 (2) MST 105 (2) MST 70 MST 27 (5) MST 30 (1) MST 54 (1) MST 85 (9) Frequency of Outbreak type in Sporadic Isolates PFGE 3 (27%) 0 (0%) 0 (0%) 2 (18%) 1 (09%) 3 (27%) 1 (09%) 0 (0%) MLVA 0 (0%) 0 (0%) 2 (18%) 0 (0%) 0 (0%) 0 (0%) 0 (0%) 0 (0%) 4 (36%) 0 (0%) 0 (0%)

19 Discrimination of Phage Typing and MLVA Within Common SE PFGE Types Most Common No MLVA Types No Phage Types No PFGE Types PFGE Types SE11B6 12 7* NA SE1B NA Phage Types 4 14 NA NA 3 13a 17 NA 11 MLVA Types MSE11 NA 4 5 MSE9 NA 5 4 *Includes RDNC Data from Minnesota Department of Health

20 SNP-based Typing of E coli O157

21 AAGGTTA ATGGTTA

22 SNPs as genotyping markers Unambiguous data Easy to exchange/compare in database Good potential for automation Amenable to high-throughput platforms Useful for long-term epidemiology/population genetics Alternative for typing highly clonal species, serotypes

23 In silico genome comparison Anchor Sakai query EDL933 Most genes are 100% identical ~100 loci bearing SNPs (phageborne, sequencing errors, or paralogous ) Need a better strategy to identify novel SNPs

24 NimbleGen CGR microarray Mutation Mapping Resequencing Singh-Gasson et al 1999 Nat Biotechnol 17: Nuwaysir et al 2002 Genome Res 12:

25 Selection of genes for CGR Conserved among different E coli O157 isolates Single-copy in the genome Re-sequencing capacity per slide ~12Mb (~1,200 genes) 376 O157-specific genes in 95 size-conserved S-loops (including many virulence factors) ~69 housekeeping genes with putative SNPs 754 additional backbone genes randomly-selected throughout the entire genome Large virulence plasmid (po157) Ohnishi et al 2002 PNAS 99:

26 O157 strains for resequencing Strain Origin Year Characteristics PFGE pattern Sakai Japan 1996 stx1+, stx F5733 Georgia 1998 stx1+, stx G5289 Washington 1994 stx2+, Phage type Virginia 2001 stx2+, PFGE type N0436 Colorado 2002 stx N0303 New York 2001 stx1+, stx N0587 North Carolina 2001 stx F6141 Georgia 1998 stx1+, stx F8768 Colorado 2002 stx G5101 Washington 1993 stx1+, stx2+, Mug+, Urea /89 Germany 1989 stx2+, Sorbitol+, O157:H- 2528

27 SNP (376: G-A) G in gene ECs3157 (12Kb, putative sulfatase)

28 Deletions in gene ECs4864 (41Kb, RhsH core protein)

29 Gene absence in ECs2974 (950-bp, Shiga toxin I subunit A)

30 Summary 1,199 complete chromosomal genes (1,167,510-bp) + po157 (92,721-bp) 823 backbone genes (22% of 3,729) 376 S-loop genes (23% of 1,632) 836 SNPs in 511 genes (42% of 1,199) 309 in 9 typical O157:H7 isolates On average, 34 SNPs/1,199 genes between two isolates Estimated ~152 SNPs/5,361 genes between two isolates Non-synonymous : Synonymous = 499 : 337 SNP location: (Backbone vs S-loop) = 552 (350 loci) : 284 (161 loci) Polymorphism (%): (Backbone vs S-loop) = 0125% : 0143%

31 836 SNPs in 511 Conserved Chromosomal Genes

32 Conclusions PFGE will continue to be an essential subtyping method for PulseNet in the near future MLVA may provide additional discrimination for E coli O157:[H7] and some Salmonella serotypes Will start transferring MLVA protocol for E coli O157 :[H7]to state and local public health laboratories in 2005 SNP is the subtyping method of the future; SNP may be used in combination with MLVA Much work remains to be done on new subtyping methods for PulseNet; we hope to continue active participation with public health laboratories

33 Bioterrorism Preparedness and Response Funds for PulseNet Activities ELC and BT are separate funding streams with different (some overlap) goals and objectives ELC funds have not increased maintenance of successful projects; some new projects BT funds for PulseNet Enhance preparedness accelerated or more informative subtyping Increase surge capacity Foodborne pathogen priorities: E coli O157:[H7], Listeria