Innovations in Molecular Epidemiology
|
|
|
- Abner Jackson
- 8 years ago
- Views:
Transcription
1 Innovations in Molecular Epidemiology
2 Molecular Epidemiology Measure current rates of active transmission Determine whether recurrent tuberculosis is attributable to exogenous reinfection Determine whether all strains in a population exert similar epidemiological characteristics Understand transmission dynamics Identify outbreaks or extensive transmission from apparently sporadic, epidemiologically unrelated cases
3 Which approach to choose? stability of biomarker - the observed rate of polymorphism the genetic diversity of strains in the population The rate of change of the chosen biomarker must be able to distinguish epidemiologically unrelated strains and yet sufficiently slow and stable to reliably link related cases
4 Genetic Variation Generation Strategies in Bacteria Can be divided into just three categories: 1. Small local changes in nucleotide sequence of genome (e.g. single nucleotide polymorphisms or SNPs ) 2. Intragenomic reshuffling and deletion of segments of genomic sequence 3. Acquisition of DNA sequences from another organism
5 Different levels of resolution are obtained from different markers SNPs LSPs Spoligo VNTR/ MIRU IS6110 Low resolution high resolution
6 1. SNPs Mutational generation of a completely novel biological function unlikely: None described in M. tuberculosis Stepwise improvement of already available biological functions: a study of 26 structural genes from 842 strains of Mtb showed 95% of mutations linked to antibiotic resistance (rpob, gyra ) Silent (Synonymous) SNPs that do not affect the biological function: <subject to selective pressure Strain typing, speciation
7 Strain typing Broad evolutionary scenario for M. tuberculosis complex organisms characterised by KatG codon 463 (Leu) and GyrA codon 95 (Thr) into three Principal Genetic Groups (PGG1-3). Taken from Sreevatsan et al, 1997
8 Speciation SNPs used: RpoB ID short sequence assay gyrb SNP position 675 gyrb SNP position 756 gyrb SNP position 1410 gyrb SNP position 1450
9 2. Intragenomic Reshuffling of Segments of DNA Occurs via recombination of related sequences and can lead to: Novel combination of capacities by the fusion of different functional domains Reassortment of expression control signals with different reading frames serving in protein production Duplication of DNA segments serving as substrates for evolution Deletion of DNA segments to remove inessential sequences
10 Different levels of resolution are obtained from different markers SNPs LSPs Spoligo VNTR/ MIRU IS6110 Low resolution high resolution
11 Deletion analysis Taken from Brosch et al, 2002
12 Large Sequence Polymorphisms Gagneux a global phylogeny of M. tuberculosis complex, based on 89 concatenated gene sequences in 108 strains. Coloured branches indicate the main strain lineages (from Hershberg et al. PLoS Biology 2008). Frequency of subtypes based on 40,000 spoligotypes in spoldb4 Beijing 11.3% EAI 8.8% H 11.2% LAM 13.4% T 25% X 9%
13 Large Sequence Polymorphisms Global phylogeography of M. tuberculosis Taken from Gagneux S and Small PM, Lancet Infect Dis 7:
14 Different levels of resolution are obtained from different markers SNPs LSPs Spoligo VNTR/ MIRU IS6110 Low resolution high resolution
15 Spoligotyping
16 M. tuberculosis Spoligotyping PCR Amplification Primer Hybridization and Extension G C Detection Developed by SEQUENOM, slide courtesy of Dr Christiane Honisch Spacer Regions Direct Repeat Region Direct Repeat PCR Primer Extension Primer Spacer 38 (+) extension product detected Spacer 03 (-) extension product not detected unextended primer only
17 Different levels of resolution are obtained from different markers SNPs LSPs Spoligo VNTR/ MIRU IS6110 Low resolution high resolution
18 VNTR/MIRU Variable number tandem repeat (VNTR) variation is thought to caused by slipped-strand mispairing. The peculiar tertiary structure of repetitive DNA allows mis-matching of neighbouring repeats, and, depending on the strand orientation, repeats can be inserted or deleted during replication. Variation in repeat numbers and sequence degeneracy can be explained by DNA recombination between multiple loci consisting of homologous repeat motifs.
19 Genesis of repeats in M. tuberculosis Requires pre-existing small repeats ( seeds) Short stem-loop structure aids slipped-strand mispairing G C C G G C C G C G G C
20 VNTR sequence alignment CDC1551MIRU ATGGCGCCGCTCCTCCTCATCGCTGCGCTCTGCATCGTCGCCGGCGGTAGTTA MIRU 10 repeat C MIRU 10 repeat C MIRU 10 repeat C MIRU 10 repeat CGG.GGTCAT--- CDC1551MIRU T...T...A...CG.C.C MIRU 23 repeat TCT...T...A...CG.C.C MIRU 23 repeat TCT...G...T...A...CG.C.C MIRU 23 repeat TCT...G...T...A...CG.C.C MIRU 23 repeat 5? TCT T...A...CGCA.GGTCAGCG CDC1551MIRU AA...--GAGGTCA---- MIRU 26 repeat A...--GAGGTCA---- MIRU26 repeat A...--GAGGTCA---- MIRU26 repeat A...--GAGGTCA---- MIRU 26 repeat 5? GAGGTCACAGA CDC1551MIRU T...T...CGGT.C MIRU16 repeat CGA...T...T...CGGT.C MIRU 16 repeat 3? CGA...T...T...CGGC.C.CGTGG- CDC1551ETRE CC.ACC ETRE repeat TCT...CC.ACC ETRE repeat TCT...CG.AGC.GCG--- CDC1551 MIRU A...T...G...T...CG...C MIRU 2 repeat TA...T...G...CG...C MIRU 2 repeat TA...TC..C.GCAAG..G.AGG...CC.CA.CT.ATGT..G..C.ACT--- CDC1551MIRU T...CGG.CCG MIRU 39 repeat T...T...CGG..C CDC1551QUB A.G..AGATT-.A...CGG..C QUB 5 repeat 2 aga C...C...TT...CGG..C.CTGGC- QUB5 repeat C...C...TT...CGG..C QUB5 repeat C...C...TT...CGG..C.ATCG-- CDC1551MIRU24 repe TGCTTCG...AG...C
21 Different levels of resolution are obtained from different markers SNPs LSPs Spoligo VNTR/ MIRU IS6110 Low resolution high resolution
22 Transposable Elements IS6110 Transposon enzyme generated Transposon cut out and inserted in new location ( hotspot ) Resulting in disrupted gene Transposon mediated DNA rearrangements are often regarded as a major evolutionary driving force, however repetitive DNA sequences also play a role. In M. tuberculosis the role of repetitive sequences may be greater.
23 IS6110 typing 0 bp 4.4Mbp 1355 base pairs containing an ORF encoding a transposase PvuII restriction followed by southern blotting and hybridisation with IS6110 probe 0-20 copies in M. tuberculosis. 8% UK isolates, 40% India isolates and most M. bovis isolates possess only a single copy of IS6110 The drawbacks of IS6110 RFLP are widely reported and include: The need for extended culturing time-consuming and can take weeks from start to completion lower throughput costly methodology
24 RFLP Exact sizing of fragments is also an issue, especially when considering interlaboratory comparison of data.
25 IS6110 FAFLP of M. tuberculosis IS6110 primer IS6110 Frequent cutter (TaqI) TaqI adaptor-specific primer Genomic DNA IS6110 blue labelled fragments
26 In silico (H37Rv) Expected fragments in this window: 75, 85, 87, 100, 127, 141, 163, 172, 190, 211
27 Example of strain comparison Sunderland Sunderland Preston Preston Highlighted area corresponds to the IS6110 element inserted in the DR region if spacer 24 is present then the FAFLP profile will contain the 318 bp fragment
28 Four colour IS based FAFLP DR based fragment
29
30 T lineage defined H, PGG2 X, PGG2 T, PGG3 T2Uganda, PGG2 LAM, PGG2 S, PGG2 Beijing PGG1, PGG2 outliers sharing no fragments
31 Evolutionary timeline Evolutionary timeline Mapped using multiple markers
32 Acknowledgements Sonia Borrell Nikki Thorne John Magee Jason Evans Saheer Gharbia Chloe Mortimer Christiane Honisch HPA TB Diagnostics And Molecular Epidemiology Group
Future Perspectives in Public Health Microbiology
Future Perspectives in Public Health Microbiology PHLS Public Health Laboratory Service Reference Surveillance Diagnostics 31/3/03 Food Water and Environmental The New Health Protection Agency Board Chief
Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
DNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
Molecular typing of VTEC: from PFGE to NGS-based phylogeny
Molecular typing of VTEC: from PFGE to NGS-based phylogeny Valeria Michelacci 10th Annual Workshop of the National Reference Laboratories for E. coli in the EU Rome, November 5 th 2015 Molecular typing
Localised Sex, Contingency and Mutator Genes. Bacterial Genetics as a Metaphor for Computing Systems
Localised Sex, Contingency and Mutator Genes Bacterial Genetics as a Metaphor for Computing Systems Outline Living Systems as metaphors Evolutionary mechanisms Mutation Sex and Localized sex Contingent
Gene Mapping Techniques
Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction
Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)
Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur
Forensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
Gene mutation and molecular medicine Chapter 15
Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to
Genetic Variation and Molecular Evolution
1 Genetic Variation and Molecular Evolution Werner Arber Biozentrum, University of Basel, Klingelbergstrasse 70, Basel, Switzerland 1 Introduction 3 2 Principles of Molecular Evolution 4 2.1 Evolutionary
Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA
Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns
Next Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took
19th Swiss TB Symposium Münchenwiler, 25.03.2010
19 th SWISS TUBERCULOSIS SYMPOSIUM Update on culture and identification Münchenwiler, 25.03.2010 Dr. Thomas Bodmer, M.D. Institute for Infectious Diseases Culture of mycobacteria Cultivation of MTB in
A Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
Chapter 6 DNA Replication
Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore
restriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
Mitochondrial DNA Analysis
Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)
Introduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov
Workshop on Methods for Isolation and Identification of Campylobacter spp. June 13-17, 2005
Workshop on Methods for Isolation and Identification of Campylobacter spp June 13-17, 2005 Goal: build capacity within the state public health laboratories to effectively identify Campylobacter species
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
Arabidopsis. A Practical Approach. Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham
Arabidopsis A Practical Approach Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham OXPORD UNIVERSITY PRESS List of Contributors Abbreviations xv xvu
4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?
Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.
Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
Design of conditional gene targeting vectors - a recombineering approach
Recombineering protocol #4 Design of conditional gene targeting vectors - a recombineering approach Søren Warming, Ph.D. The purpose of this protocol is to help you in the gene targeting vector design
Single Nucleotide Polymorphisms (SNPs)
Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded
Biological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
Genomes and SNPs in Malaria and Sickle Cell Anemia
Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
European Medicines Agency
European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein
Pairwise Sequence Alignment
Pairwise Sequence Alignment carolin.kosiol@vetmeduni.ac.at SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What
Focusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
DNA and Forensic Science
DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief
Biotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
Milestones of bacterial genetic research:
Milestones of bacterial genetic research: 1944 Avery's pneumococcal transformation experiment shows that DNA is the hereditary material 1946 Lederberg & Tatum describes bacterial conjugation using biochemical
Visualization of tuberculosis patient and Mycobacterium tuberculosis complex genotype data via host-pathogen maps
Visualization of tuberculosis patient and Mycobacterium tuberculosis complex genotype data via host-pathogen maps Kristin P. Bennett 1,2, Cagri Ozcaglar 1, Janani Ranganathan 3, Srivatsan Raghavan 3, Jacob
Genetics 301 Sample Final Examination Spring 2003
Genetics 301 Sample Final Examination Spring 2003 50 Multiple Choice Questions-(Choose the best answer) 1. A cross between two true breeding lines one with dark blue flowers and one with bright white flowers
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
June 09, 2009 Random Mutagenesis
Why Mutagenesis? Analysis of protein function June 09, 2009 Random Mutagenesis Analysis of protein structure Protein engineering Analysis of structure-function relationship Analysis of the catalytic center
Annex 6: Nucleotide Sequence Information System BEETLE. Biological and Ecological Evaluation towards Long-Term Effects
Annex 6: Nucleotide Sequence Information System BEETLE Biological and Ecological Evaluation towards Long-Term Effects Long-term effects of genetically modified (GM) crops on health, biodiversity and the
IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR)
IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) Background Infectious diseases caused by pathogenic organisms such as bacteria, viruses, protozoa,
DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA
DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence
Commonly Used STR Markers
Commonly Used STR Markers Repeats Satellites 100 to 1000 bases repeated Minisatellites VNTR variable number tandem repeat 10 to 100 bases repeated Microsatellites STR short tandem repeat 2 to 6 bases repeated
Human Genome and Human Genome Project. Louxin Zhang
Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular
Milk protein genetic variation in Butana cattle
Milk protein genetic variation in Butana cattle Ammar Said Ahmed Züchtungsbiologie und molekulare Genetik, Humboldt Universität zu Berlin, Invalidenstraβe 42, 10115 Berlin, Deutschland 1 Outline Background
SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications
Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each
The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:
Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How
Lessons from the Stanford HIV Drug Resistance Database
1 Lessons from the Stanford HIV Drug Resistance Database Bob Shafer, MD Department of Medicine and by Courtesy Pathology (Infectious Diseases) Stanford University Outline 2 Goals and rationale for HIVDB
Becker Muscular Dystrophy
Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency
Drug-resistant Tuberculosis: A Genetic Analysis Using Online Bioinformatics Tools
Inquiry & Investigation Drug-resistant Tuberculosis: A Genetic Analysis Using Online Bioinformatics Tools Jessica M. Taylor, Rebecca M. Davidson, Michael Strong Abstrac t Tuberculosis (TB) continues to
Recombinant DNA Technology
Recombinant DNA Technology Stephen B. Gruber, MD, PhD Division of Molecular Medicine and Genetics November 4, 2002 Learning Objectives Know the basics of gene structure, function and regulation. Be familiar
An example of bioinformatics application on plant breeding projects in Rijk Zwaan
An example of bioinformatics application on plant breeding projects in Rijk Zwaan Xiangyu Rao 17-08-2012 Introduction of RZ Rijk Zwaan is active worldwide as a vegetable breeding company that focuses on
Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University
Genotyping by sequencing and data analysis Ross Whetten North Carolina State University Stein (2010) Genome Biology 11:207 More New Technology on the Horizon Genotyping By Sequencing Timeline 2007 Complexity
Transmission of genetic variation: conjugation. Transmission of genetic variation: conjugation
Transmission of genetic variation: conjugation Transmission of genetic variation: conjugation Bacterial Conjugation is genetic recombination in which there is a transfer of DNA from a living donor bacterium
Expression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu
Expression and Purification of Recombinant Protein in bacteria and Yeast Presented By: Puspa pandey, Mohit sachdeva & Ming yu DNA Vectors Molecular carriers which carry fragments of DNA into host cell.
Chapter 13: Meiosis and Sexual Life Cycles
Name Period Chapter 13: Meiosis and Sexual Life Cycles Concept 13.1 Offspring acquire genes from parents by inheriting chromosomes 1. Let s begin with a review of several terms that you may already know.
The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics
The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long
Y Chromosome Markers
Y Chromosome Markers Lineage Markers Autosomal chromosomes recombine with each meiosis Y and Mitochondrial DNA does not This means that the Y and mtdna remains constant from generation to generation Except
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh
Recombinant DNA Unit Exam
Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the
MUTATION, DNA REPAIR AND CANCER
MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful
Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR
Roche Applied Science Technical Note No. LC 18/2004 Purpose of this Note Assay Formats for Use in Real-Time PCR The LightCycler Instrument uses several detection channels to monitor the amplification of
The following chapter is called "Preimplantation Genetic Diagnosis (PGD)".
Slide 1 Welcome to chapter 9. The following chapter is called "Preimplantation Genetic Diagnosis (PGD)". The author is Dr. Maria Lalioti. Slide 2 The learning objectives of this chapter are: To learn the
Principles of Evolution - Origin of Species
Theories of Organic Evolution X Multiple Centers of Creation (de Buffon) developed the concept of "centers of creation throughout the world organisms had arisen, which other species had evolved from X
How many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
(1-p) 2. p(1-p) From the table, frequency of DpyUnc = ¼ (p^2) = #DpyUnc = p^2 = 0.0004 ¼(1-p)^2 + ½(1-p)p + ¼(p^2) #Dpy + #DpyUnc
Advanced genetics Kornfeld problem set_key 1A (5 points) Brenner employed 2-factor and 3-factor crosses with the mutants isolated from his screen, and visually assayed for recombination events between
Analysis of DNA methylation: bisulfite libraries and SOLiD sequencing
Analysis of DNA methylation: bisulfite libraries and SOLiD sequencing An easy view of the bisulfite approach CH3 genome TAGTACGTTGAT TAGTACGTTGAT read TAGTACGTTGAT TAGTATGTTGAT Three main problems 1.
Recombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
Recombinant DNA Technology
Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium
Genetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
Sequencing and microarrays for genome analysis: complementary rather than competing?
Sequencing and microarrays for genome analysis: complementary rather than competing? Simon Hughes, Richard Capper, Sandra Lam and Nicole Sparkes Introduction The human genome is comprised of more than
Data Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
Final Project Report
CPSC545 by Introduction to Data Mining Prof. Martin Schultz & Prof. Mark Gerstein Student Name: Yu Kor Hugo Lam Student ID : 904907866 Due Date : May 7, 2007 Introduction Final Project Report Pseudogenes
Algorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
Transmission Dynamics and Molecular Characterization of Mycobacterium tuberculosis Isolates with Low Copy Numbers of IS6110
JOURNAL OF CLINICAL MICROBIOLOGY, Jan. 2001, p. 217 221 Vol. 39, No. 1 0095-1137/01/$04.00 0 DOI: 10.1128/JCM.39.1.217 221.2001 Copyright 2001, American Society for Microbiology. All Rights Reserved. Transmission
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE E15
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE DEFINITIONS FOR GENOMIC BIOMARKERS, PHARMACOGENOMICS,
MRC-Holland MLPA. Description version 12; 02-12-2012
SALSA MLPA probemix P083-C1 CDH1 Lot C1-0211. As compared to previous B1 version, new in version C1: two CDH1 probes and several reference probes have been replaced/added. In addition, the 88 and 96nt
Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.
Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists
The world of non-coding RNA. Espen Enerly
The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often
Molecular Diagnosis of Hepatitis B and Hepatitis D infections
Molecular Diagnosis of Hepatitis B and Hepatitis D infections Acute infection Detection of HBsAg in serum is a fundamental diagnostic marker of HBV infection HBsAg shows a strong correlation with HBV replication
How is genome sequencing done?
How is genome sequencing done? Using 454 Sequencing on the Genome Sequencer FLX System, DNA from a genome is converted into sequence data through four primary steps: Step One DNA sample preparation; Step
BCOR101 Midterm II Wednesday, October 26, 2005
BCOR101 Midterm II Wednesday, October 26, 2005 Name Key Please show all of your work. 1. A donor strain is trp+, pro+, met+ and a recipient strain is trp-, pro-, met-. The donor strain is infected with
Description: Molecular Biology Services and DNA Sequencing
Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:
Genomics Services @ GENterprise
Genomics Services @ GENterprise since 1998 Mainz University spin-off privately financed 6-10 employees since 2006 Genomics Services @ GENterprise Sequencing Service (Sanger/3730, 454) Genome Projects (Bacteria,
HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:
HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone
2006 7.012 Problem Set 3 KEY
2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
The Human Genome Project
The Human Genome Project Brief History of the Human Genome Project Physical Chromosome Maps Genetic (or Linkage) Maps DNA Markers Sequencing and Annotating Genomic DNA What Have We learned from the HGP?
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
GenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
Genetics Lecture Notes 7.03 2005. Lectures 1 2
Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several
An Overview of DNA Sequencing
An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure
Exercises for the UCSC Genome Browser Introduction
Exercises for the UCSC Genome Browser Introduction 1) Find out if the mouse Brca1 gene has non-synonymous SNPs, color them blue, and get external data about a codon-changing SNP. Skills: basic text search;
A and B are not absolutely linked. They could be far enough apart on the chromosome that they assort independently.
Name Section 7.014 Problem Set 5 Please print out this problem set and record your answers on the printed copy. Answers to this problem set are to be turned in to the box outside 68-120 by 5:00pm on Friday
Evolution of Retroviruses: Fossils in our DNA 1
Evolution of Retroviruses: Fossils in our DNA 1 JOHN M. COFFIN Professor of Molecular Biology and Microbiology Tufts University UNIQUE AMONG INFECTIOUS AGENTS, retroviruses provide the opportunity for
Structure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova
New generation sequencing: current limits and future perspectives Giorgio Valle CRIBI Università di Padova Around 2004 the Race for the 1000$ Genome started A few questions... When? How? Why? Standard
Module 10: Bioinformatics
Module 10: Bioinformatics 1.) Goal: To understand the general approaches for basic in silico (computer) analysis of DNA- and protein sequences. We are going to discuss sequence formatting required prior