Polymorphism of retrotransposons in Bos taurus
|
|
|
- Baldric Greene
- 8 years ago
- Views:
Transcription
1 Polymorphism of retrotransposons in Bos taurus Bernt Guldbrandtsen Goutam Sahana Mogens Sandø Lund Center for Quantitative Genetics and Genomics Aarhus University Denmark
2 Transposons Type of jumping genes (McClintock, 1956) Mobile genetic elements genetic parasites Contain machinery for own mobilization
3 Transposons Type of jumping genes (McClintock, 1956) Mobile genetic elements genetic parasites Contain machinery for own mobilization
4 Transposons Type of jumping genes (McClintock, 1956) Mobile genetic elements genetic parasites Contain machinery for own mobilization
5 Prevalence Min. 45% of human genome (Mills et al., 2007) Alu1 and LINE1 make up about 25% of human genome (Smit, 1996) In cattle: Bos taurus Source:
6 Prevalence Min. 45% of human genome (Mills et al., 2007) Alu1 and LINE1 make up about 25% of human genome (Smit, 1996) In cattle: Bos taurus Source:
7 Prevalence Min. 45% of human genome (Mills et al., 2007) Alu1 and LINE1 make up about 25% of human genome (Smit, 1996) In cattle: Bos taurus Source:
8 Transposons Several classes Some (retrovirus-like) are flanked by long terminal repeats (LTR) Lifecycle depends on reverse transcriptase (RNA DNA) LTR GAG POL LTR Long terminal repeats
9 Transposons Several classes Some (retrovirus-like) are flanked by long terminal repeats (LTR) Lifecycle depends on reverse transcriptase (RNA DNA) LTR GAG POL LTR Long terminal repeats
10 Transposons Several classes Some (retrovirus-like) are flanked by long terminal repeats (LTR) Lifecycle depends on reverse transcriptase (RNA DNA) LTR GAG POL LTR Long terminal repeats
11 Transposition May contain machinery for own mobilization (autonomomous) Other copies are incomplete (non-autonomous) Accumulate mutations Most copies presumably defective Prevalence underestimated mutated beyond recognition New integration hard to detect with NGS data
12 Transposition May contain machinery for own mobilization (autonomomous) Other copies are incomplete (non-autonomous) Accumulate mutations Most copies presumably defective Prevalence underestimated mutated beyond recognition New integration hard to detect with NGS data
13 Transposition May contain machinery for own mobilization (autonomomous) Other copies are incomplete (non-autonomous) Accumulate mutations Most copies presumably defective Prevalence underestimated mutated beyond recognition New integration hard to detect with NGS data
14 Transposition May contain machinery for own mobilization (autonomomous) Other copies are incomplete (non-autonomous) Accumulate mutations Most copies presumably defective Prevalence underestimated mutated beyond recognition New integration hard to detect with NGS data
15 Transposition May contain machinery for own mobilization (autonomomous) Other copies are incomplete (non-autonomous) Accumulate mutations Most copies presumably defective Prevalence underestimated mutated beyond recognition New integration hard to detect with NGS data
16 Transposition May contain machinery for own mobilization (autonomomous) Other copies are incomplete (non-autonomous) Accumulate mutations Most copies presumably defective Prevalence underestimated mutated beyond recognition New integration hard to detect with NGS data
17 Mutagenesis Insertion of tranposons may damage imporant sequence 10% of all spontaneous mutations in mouse due to retrotransposition (Kazazian, 1998) Sequence identity may lead to non-homologous recombination between elements (Kadri et al., 2014).
18 Mutagenesis Insertion of tranposons may damage imporant sequence 10% of all spontaneous mutations in mouse due to retrotransposition (Kazazian, 1998) Sequence identity may lead to non-homologous recombination between elements (Kadri et al., 2014).
19 Mutagenesis Insertion of tranposons may damage imporant sequence 10% of all spontaneous mutations in mouse due to retrotransposition (Kazazian, 1998) Sequence identity may lead to non-homologous recombination between elements (Kadri et al., 2014).
20 Scanning the Bos taurus genome GenomeTools ltrharvest (Ellinghaus et al, 2008) Detect LTR flanked transposons one class of transposons 4.6% of the cattle genome ( University of Maryland Assembly 3.1 (Zimin et al, 2009) 2 Hereford individuals: 2/3 a cow, 1/3 a bull Detects 87,310 putative LTR transposons in Bos taurus genome
21 Scanning the Bos taurus genome GenomeTools ltrharvest (Ellinghaus et al, 2008) Detect LTR flanked transposons one class of transposons 4.6% of the cattle genome ( University of Maryland Assembly 3.1 (Zimin et al, 2009) 2 Hereford individuals: 2/3 a cow, 1/3 a bull Detects 87,310 putative LTR transposons in Bos taurus genome
22 Scanning the Bos taurus genome GenomeTools ltrharvest (Ellinghaus et al, 2008) Detect LTR flanked transposons one class of transposons 4.6% of the cattle genome ( University of Maryland Assembly 3.1 (Zimin et al, 2009) 2 Hereford individuals: 2/3 a cow, 1/3 a bull Detects 87,310 putative LTR transposons in Bos taurus genome
23 Scanning the Bos taurus genome GenomeTools ltrharvest (Ellinghaus et al, 2008) Detect LTR flanked transposons one class of transposons 4.6% of the cattle genome ( University of Maryland Assembly 3.1 (Zimin et al, 2009) 2 Hereford individuals: 2/3 a cow, 1/3 a bull Detects 87,310 putative LTR transposons in Bos taurus genome
24 Scanning the Bos taurus genome GenomeTools ltrharvest (Ellinghaus et al, 2008) Detect LTR flanked transposons one class of transposons 4.6% of the cattle genome ( University of Maryland Assembly 3.1 (Zimin et al, 2009) 2 Hereford individuals: 2/3 a cow, 1/3 a bull Detects 87,310 putative LTR transposons in Bos taurus genome
25 Scanning Sequenced Animals Detect polymorphism in sequenced animals 172 animals with NGS data 46 Holstein, 27 Jersey, 83 Nordic Red and 16 Brown Swiss About 10X, about 300 bp inserts
26 Scanning Sequenced Animals Detect polymorphism in sequenced animals 172 animals with NGS data 46 Holstein, 27 Jersey, 83 Nordic Red and 16 Brown Swiss About 10X, about 300 bp inserts
27 Scanning Sequenced Animals Detect polymorphism in sequenced animals 172 animals with NGS data 46 Holstein, 27 Jersey, 83 Nordic Red and 16 Brown Swiss About 10X, about 300 bp inserts
28 Scanning Sequenced Animals Detect polymorphism in sequenced animals 172 animals with NGS data 46 Holstein, 27 Jersey, 83 Nordic Red and 16 Brown Swiss About 10X, about 300 bp inserts
29 Method Scan for pairs with reads mapping left and right of putative transposon to detect absence of putative LTR transposons detected in the assembly Missing Transposon
30 Classifying 1. More than 100 hits in animal discard hit 2. More than 30 hits in animal discard animal for hit 3. Less than 5 animals left in breed discard breed for hit hits animal carries putative transposon 5. More than 1 hit animal has at least one chromatid without transposon
31 Classifying 1. More than 100 hits in animal discard hit 2. More than 30 hits in animal discard animal for hit 3. Less than 5 animals left in breed discard breed for hit hits animal carries putative transposon 5. More than 1 hit animal has at least one chromatid without transposon
32 Classifying 1. More than 100 hits in animal discard hit 2. More than 30 hits in animal discard animal for hit 3. Less than 5 animals left in breed discard breed for hit hits animal carries putative transposon 5. More than 1 hit animal has at least one chromatid without transposon
33 Classifying 1. More than 100 hits in animal discard hit 2. More than 30 hits in animal discard animal for hit 3. Less than 5 animals left in breed discard breed for hit hits animal carries putative transposon 5. More than 1 hit animal has at least one chromatid without transposon
34 Classifying 1. More than 100 hits in animal discard hit 2. More than 30 hits in animal discard animal for hit 3. Less than 5 animals left in breed discard breed for hit hits animal carries putative transposon 5. More than 1 hit animal has at least one chromatid without transposon
35 Lots of Polymorphism Status BSW HOL JER RDC n Retained 76,320 73,101 75,499 71,650 Absent Polymorphic 4,550 7,862 4,958 9,476 NA
36 Lots of Polymorphism Status BSW HOL JER RDC n Retained 76,320 73,101 75,499 71,650 Absent Polymorphic 4,550 7,862 4,958 9,476 NA
37 Lots of Polymorphism Status BSW HOL JER RDC n Retained 76,320 73,101 75,499 71,650 Absent Polymorphic 4,550 7,862 4,958 9,476 NA
38 Lots of Polymorphism Status BSW HOL JER RDC n Retained 76,320 73,101 75,499 71,650 Absent Polymorphic 4,550 7,862 4,958 9,476 NA
39 Lots of Polymorphism Status BSW HOL JER RDC n Retained 76,320 73,101 75,499 71,650 Absent Polymorphic 4,550 7,862 4,958 9,476 NA
40 Distribution 80,314 present in all dairy breeds 70,046 present in all animals in all dairy animals 736 absent in at least one dairy breed 13 absent from all dairy breeds 11,080 polymorphic in at least one dairy breed 2,514 polymorphic in all dairy breeds
41 Distribution 80,314 present in all dairy breeds 70,046 present in all animals in all dairy animals 736 absent in at least one dairy breed 13 absent from all dairy breeds 11,080 polymorphic in at least one dairy breed 2,514 polymorphic in all dairy breeds
42 Distribution 80,314 present in all dairy breeds 70,046 present in all animals in all dairy animals 736 absent in at least one dairy breed 13 absent from all dairy breeds 11,080 polymorphic in at least one dairy breed 2,514 polymorphic in all dairy breeds
43 Distribution 80,314 present in all dairy breeds 70,046 present in all animals in all dairy animals 736 absent in at least one dairy breed 13 absent from all dairy breeds 11,080 polymorphic in at least one dairy breed 2,514 polymorphic in all dairy breeds
44 Distribution 80,314 present in all dairy breeds 70,046 present in all animals in all dairy animals 736 absent in at least one dairy breed 13 absent from all dairy breeds 11,080 polymorphic in at least one dairy breed 2,514 polymorphic in all dairy breeds
45 Distribution 80,314 present in all dairy breeds 70,046 present in all animals in all dairy animals 736 absent in at least one dairy breed 13 absent from all dairy breeds 11,080 polymorphic in at least one dairy breed 2,514 polymorphic in all dairy breeds
46 Interpretation Elements private to UMD3.1 animals must have arisen since separation of dairy and beef or were polymorphic in ancestral population High degree of within and between breed polymorphism, means many fairly recent new insertions
47 Interpretation Elements private to UMD3.1 animals must have arisen since separation of dairy and beef or were polymorphic in ancestral population High degree of within and between breed polymorphism, means many fairly recent new insertions
48 Conclusions Evidence of extensive mobilization of LTR transposons Source of genetic variation that is hard to follow with current NGS data processing pipelines We may be missing a major type of genetic variants in sequence analysis and gene mapping
49 Conclusions Evidence of extensive mobilization of LTR transposons Source of genetic variation that is hard to follow with current NGS data processing pipelines We may be missing a major type of genetic variants in sequence analysis and gene mapping
50 Conclusions Evidence of extensive mobilization of LTR transposons Source of genetic variation that is hard to follow with current NGS data processing pipelines We may be missing a major type of genetic variants in sequence analysis and gene mapping
The impact of genomic selection on North American dairy cattle breeding organizations
The impact of genomic selection on North American dairy cattle breeding organizations Jacques Chesnais, George Wiggans and Filippo Miglior The Semex Alliance, USDA and Canadian Dairy Network 2000 09 Genomic
Biological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
Milk protein genetic variation in Butana cattle
Milk protein genetic variation in Butana cattle Ammar Said Ahmed Züchtungsbiologie und molekulare Genetik, Humboldt Universität zu Berlin, Invalidenstraβe 42, 10115 Berlin, Deutschland 1 Outline Background
Non-genic evolution and selection in the human genome. or: Junk DNA. Gerton Lunter, Statistics, Bioinformatics group
Non-genic evolution and selection in the human genome or: Junk DNA Gerton Lunter, Statistics, Bioinformatics group Two puzzling observations About of our genome codes for protein. What is remaining for?
Genomes and SNPs in Malaria and Sickle Cell Anemia
Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing
An example of bioinformatics application on plant breeding projects in Rijk Zwaan
An example of bioinformatics application on plant breeding projects in Rijk Zwaan Xiangyu Rao 17-08-2012 Introduction of RZ Rijk Zwaan is active worldwide as a vegetable breeding company that focuses on
Biotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
Genomic Selection in. Applied Training Workshop, Sterling. Hans Daetwyler, The Roslin Institute and R(D)SVS
Genomic Selection in Dairy Cattle AQUAGENOME Applied Training Workshop, Sterling Hans Daetwyler, The Roslin Institute and R(D)SVS Dairy introduction Overview Traditional breeding Genomic selection Advantages
Chapter 6 DNA Replication
Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore
Recombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
Presentation by: Ahmad Alsahaf. Research collaborator at the Hydroinformatics lab - Politecnico di Milano MSc in Automation and Control Engineering
Johann Bernoulli Institute for Mathematics and Computer Science, University of Groningen 9-October 2015 Presentation by: Ahmad Alsahaf Research collaborator at the Hydroinformatics lab - Politecnico di
Genetics Test Biology I
Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.
Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples
Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples Sudhir K. Sinha, Ph.D.*, Anne H. Montgomery, M.S., Gina Pineda, M.S., and Hiromi Brown, Ph.D.
Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:
Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How
Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
A Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
Next Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took
Dairy Cattle. Bos taurus (Bovidae) Fast Facts:
Dairy Cattle Bos taurus (Bovidae) Fast Facts: Number of growers: 496 Amount of Cattle produced in Washington State: 238,000 head in 2008 Economic impact in Washington State: $784 million Annual value of
Focusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
Trasposable elements: P elements
Trasposable elements: P elements In 1938 Marcus Rhodes provided the first genetic description of an unstable mutation, an allele of a gene required for the production of pigment in maize. This instability
NAV routine genetic evaluation of Dairy Cattle
NAV routine genetic evaluation of Dairy Cattle data and genetic models NAV December 2013 Second edition 1 Genetic evaluation within NAV Introduction... 6 NTM - Nordic Total Merit... 7 Traits included in
1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
Answer Key Problem Set 5
7.03 Fall 2003 1 of 6 1. a) Genetic properties of gln2- and gln 3-: Answer Key Problem Set 5 Both are uninducible, as they give decreased glutamine synthetase (GS) activity. Both are recessive, as mating
Basics of Marker Assisted Selection
asics of Marker ssisted Selection Chapter 15 asics of Marker ssisted Selection Julius van der Werf, Department of nimal Science rian Kinghorn, Twynam Chair of nimal reeding Technologies University of New
The NF1-gene a hotspot for de novo Alu- and L1-insertion?
The NF1-gene a hotspot for de novo Alu- and L1-insertion? Katharina Wimmer Division Humangenetik, Medizinische Universität Innsbruck Molekulare Diagnostik 2013 Zürich, 1. März, 2013 2 Die im Vortrag vorgestellten
Data Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE
AP Biology Date SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE LEARNING OBJECTIVES Students will gain an appreciation of the physical effects of sickle cell anemia, its prevalence in the population,
Researcher 2: Post-Submission Advanced Topics Training Energizer
Researcher 2: Post-Submission Advanced Topics IRBNet provides the research community with an unmatched set of secure, web-based collaboration tools to support the design, management, review and oversight
restriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
Terms: The following terms are presented in this lesson (shown in bold italics and on PowerPoint Slides 2 and 3):
Unit B: Understanding Animal Reproduction Lesson 4: Understanding Genetics Student Learning Objectives: Instruction in this lesson should result in students achieving the following objectives: 1. Explain
Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects
Mutation Mutation provides raw material to evolution Different kinds of mutations have different effects Mutational Processes Point mutation single nucleotide changes coding changes (missense mutations)
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
Investing in genetic technologies to meet future market requirements and assist in delivering profitable sheep and cattle farming
Investing in genetic technologies to meet future market requirements and assist in delivering profitable sheep and cattle farming B+LNZ GENETICS The Government through its Ministry of Business, Innovation
Structure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment
Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249
Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA
Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns
Human Genome Organization: An Update. Genome Organization: An Update
Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion
Matthew McClure October 18, 2013
Matthew McClure October 18, 2013 Microsatellite Imputation Infer MS from SNP Haplotype Genotyped ONCE Initial Study 347 cattle -ISAG bovine MS parentage panel -Illumina HDSNP -Phased using BEAGLE Brown
GenBank: A Database of Genetic Sequence Data
GenBank: A Database of Genetic Sequence Data Computer Science 105 Boston University David G. Sullivan, Ph.D. An Explosion of Scientific Data Scientists are generating ever increasing amounts of data. Relevant
Localised Sex, Contingency and Mutator Genes. Bacterial Genetics as a Metaphor for Computing Systems
Localised Sex, Contingency and Mutator Genes Bacterial Genetics as a Metaphor for Computing Systems Outline Living Systems as metaphors Evolutionary mechanisms Mutation Sex and Localized sex Contingent
Delivering the power of the world s most successful genomics platform
Delivering the power of the world s most successful genomics platform NextCODE Health is bringing the full power of the world s largest and most successful genomics platform to everyday clinical care NextCODE
Molecular and Cell Biology Laboratory (BIOL-UA 223) Instructor: Ignatius Tan Phone: 212-998-8295 Office: 764 Brown Email: ignatius.tan@nyu.
Molecular and Cell Biology Laboratory (BIOL-UA 223) Instructor: Ignatius Tan Phone: 212-998-8295 Office: 764 Brown Email: ignatius.tan@nyu.edu Course Hours: Section 1: Mon: 12:30-3:15 Section 2: Wed: 12:30-3:15
GENOMIC SELECTION: THE FUTURE OF MARKER ASSISTED SELECTION AND ANIMAL BREEDING
GENOMIC SELECTION: THE FUTURE OF MARKER ASSISTED SELECTION AND ANIMAL BREEDING Theo Meuwissen Institute for Animal Science and Aquaculture, Box 5025, 1432 Ås, Norway, theo.meuwissen@ihf.nlh.no Summary
The Human Genome Project. From genome to health From human genome to other genomes and to gene function Structural Genomics initiative
The Human Genome Project From genome to health From human genome to other genomes and to gene function Structural Genomics initiative June 2000 What is the Human Genome Project? U.S. govt. project coordinated
Evolution of Retroviruses: Fossils in our DNA 1
Evolution of Retroviruses: Fossils in our DNA 1 JOHN M. COFFIN Professor of Molecular Biology and Microbiology Tufts University UNIQUE AMONG INFECTIOUS AGENTS, retroviruses provide the opportunity for
Final Project Report
CPSC545 by Introduction to Data Mining Prof. Martin Schultz & Prof. Mark Gerstein Student Name: Yu Kor Hugo Lam Student ID : 904907866 Due Date : May 7, 2007 Introduction Final Project Report Pseudogenes
SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications
Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each
Arabidopsis. A Practical Approach. Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham
Arabidopsis A Practical Approach Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham OXPORD UNIVERSITY PRESS List of Contributors Abbreviations xv xvu
Genetic improvement: a major component of increased dairy farm profitability
Genetic improvement: a major component of increased dairy farm profitability Filippo Miglior 1,2, Jacques Chesnais 3 & Brian Van Doormaal 2 1 2 Canadian Dairy Network 3 Semex Alliance Agri-Food Canada
Immunology Ambassador Guide (updated 2014)
Immunology Ambassador Guide (updated 2014) Immunity and Disease We will talk today about the immune system and how it protects us from disease. Also, we ll learn some unique ways that our immune system
pcas-guide System Validation in Genome Editing
pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible
Introduction to NGS data analysis
Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High
Chromosomes, Mapping, and the Meiosis Inheritance Connection
Chromosomes, Mapping, and the Meiosis Inheritance Connection Carl Correns 1900 Chapter 13 First suggests central role for chromosomes Rediscovery of Mendel s work Walter Sutton 1902 Chromosomal theory
Control of Gene Expression
Control of Gene Expression (Learning Objectives) Explain the role of gene expression is differentiation of function of cells which leads to the emergence of different tissues, organs, and organ systems
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
Gene mutation and molecular medicine Chapter 15
Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to
DNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
RNA Viruses. A Practical Approac h. Alan J. Cann
RNA Viruses A Practical Approac h Alan J. Cann List of protocols page xiii Abbreviations xvii Investigation of RNA virus genome structure 1 A j. Easton, A.C. Marriott and C.R. Pringl e 1 Introduction-the
Genetics Lecture Notes 7.03 2005. Lectures 1 2
Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several
Next Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
Genomic selection in dairy cattle: Integration of DNA testing into breeding programs
Genomic selection in dairy cattle: Integration of DNA testing into breeding programs Jonathan M. Schefers* and Kent A. Weigel* *Department of Dairy Science, University of Wisconsin, Madison 53706; and
Introduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov
Scope for the Use of Pregnancy Confirmation Data in Genetic Evaluation for Reproductive Performance
Scope for the Use of Pregnancy Confirmation Data in Genetic Evaluation for Reproductive Performance J. Jamrozik and G.J. Kistemaker Canadian Dairy Network The data on cow's pregnancy diagnostics has been
Worksheet - COMPARATIVE MAPPING 1
Worksheet - COMPARATIVE MAPPING 1 The arrangement of genes and other DNA markers is compared between species in Comparative genome mapping. As early as 1915, the geneticist J.B.S Haldane reported that
School of Nursing. Presented by Yvette Conley, PhD
Presented by Yvette Conley, PhD What we will cover during this webcast: Briefly discuss the approaches introduced in the paper: Genome Sequencing Genome Wide Association Studies Epigenomics Gene Expression
BioBoot Camp Genetics
BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before
Artificial Insemination (AI) in Cattle
Artificial Insemination (AI) in Cattle Most dairy cows are bred by AI Less common in beef cattle Commonly, bulls are used for all breeding under pasture conditions Less commonly, bulls are used as clean-up
Use of DNA-based Biotechnologies in the Beef Cattle Industry Alison Van Eenennaam, Ph.D.
Use of DNA-based Biotechnologies in the Beef Cattle Industry Alison Van Eenennaam, Ph.D. Cooperative Extension Specialist Animal Biotechnology and Genomics UC Davis alvaneenennaam@ucdavis.edu http://animalscience.ucdavis.edu/animalbiotech/
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
Cell and Molecular Biology 550 GENETIC PRINCIPLES Spring Semester 2014 Monday, Wednesday, Friday 10-11:30 am, 253 BRBII/III
Cell and Molecular Biology 550 GENETIC PRINCIPLES Spring Semester 2014 Monday, Wednesday, Friday 10-11:30 am, 253 BRBII/III This is a combined lecture and discussion course that surveys major concepts
Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
A and B are not absolutely linked. They could be far enough apart on the chromosome that they assort independently.
Name Section 7.014 Problem Set 5 Please print out this problem set and record your answers on the printed copy. Answers to this problem set are to be turned in to the box outside 68-120 by 5:00pm on Friday
Exercises for the UCSC Genome Browser Introduction
Exercises for the UCSC Genome Browser Introduction 1) Find out if the mouse Brca1 gene has non-synonymous SNPs, color them blue, and get external data about a codon-changing SNP. Skills: basic text search;
Lessons from the Stanford HIV Drug Resistance Database
1 Lessons from the Stanford HIV Drug Resistance Database Bob Shafer, MD Department of Medicine and by Courtesy Pathology (Infectious Diseases) Stanford University Outline 2 Goals and rationale for HIVDB
The world of non-coding RNA. Espen Enerly
The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often
In Vitro Fertilization as a tool for the Genetics Improvement. History and Future Prospects.
In Vitro Fertilization as a tool for the Genetics Improvement. History and Future Prospects. Ovum pick up followed by embryo production procedure (OPU-IVP) is strongly driven by the need of the breeding
Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center
Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing
GROSS MARGINS : HILL SHEEP 2004/2005
GROSS MARGINS GROSS MARGINS : HILL SHEEP 2004/2005 All flocks Top third Number of flocks in sample 242 81 Average size of flock (ewes and ewe lambs) 849 684 Lambs reared per ewe 1.10 1.25 ENTERPRISE OUTPUT
mirnaselect pep-mir Cloning and Expression Vector
Product Data Sheet mirnaselect pep-mir Cloning and Expression Vector CATALOG NUMBER: MIR-EXP-C STORAGE: -80ºC QUANTITY: 2 vectors; each contains 100 µl of bacterial glycerol stock Components 1. mirnaselect
Single Nucleotide Polymorphisms (SNPs)
Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded
DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
LECTURE 6 Gene Mutation (Chapter 16.1-16.2)
LECTURE 6 Gene Mutation (Chapter 16.1-16.2) 1 Mutation: A permanent change in the genetic material that can be passed from parent to offspring. Mutant (genotype): An organism whose DNA differs from the
Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled
Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino
4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?
Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.
Tips when buying a Cowdog
Tips when buying a Cowdog M ost anybody that has ever been looking for a cowdog knows that finding the right dog to fit your needs is often difficult. Buying a cowdog is a little like buying a new piece
Reproductive technologies. Lecture 15 Introduction to Breeding and Genetics GENE 251/351 School of Environment and Rural Science (Genetics)
Reproductive technologies Lecture 15 Introduction to Breeding and Genetics GENE 251/351 School of Environment and Rural Science (Genetics) Animal Breeding in a nutshell Breeding objectives Trait measurement
Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics
Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics Christopher Benner, PhD Director, Integrative Genomics and Bioinformatics Core (IGC) idash Webinar,
Proceedings, Applied Reproductive Strategies in Beef Cattle September 11 and 12, 2007, Billings, Montana NEW TECHNOLOGIES FOR REPRODUCTION IN CATTLE
Proceedings, Applied Reproductive Strategies in Beef Cattle September 11 and 12, 2007, Billings, Montana NEW TECHNOLOGIES FOR REPRODUCTION IN CATTLE George E. Seidel, Jr. Animal Reproduction and Biotechnology
Evaluations for service-sire conception rate for heifer and cow inseminations with conventional and sexed semen
J. Dairy Sci. 94 :6135 6142 doi: 10.3168/jds.2010-3875 American Dairy Science Association, 2011. Evaluations for service-sire conception rate for heifer and cow inseminations with conventional and sexed
escience and Post-Genome Biomedical Research
escience and Post-Genome Biomedical Research Thomas L. Casavant, Adam P. DeLuca Departments of Biomedical Engineering, Electrical Engineering and Ophthalmology Coordinated Laboratory for Computational
Activity 7.21 Transcription factors
Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation
RATES OF CONCEPTION BY ARTIFICIAL INSEMINATION OF. 1 Miss. Rohini Paramsothy Faculty of Agriculture University of Jaffna
RATES OF CONCEPTION BY ARTIFICIAL INSEMINATION OF DAIRY COWS IN JAFFNA DISTRICT 1 Miss. Rohini Paramsothy Faculty of Agriculture University of Jaffna INTRODUCTION Conception rates of dairy cows are influenced
Transmission of genetic variation: conjugation. Transmission of genetic variation: conjugation
Transmission of genetic variation: conjugation Transmission of genetic variation: conjugation Bacterial Conjugation is genetic recombination in which there is a transfer of DNA from a living donor bacterium
Cystic Fibrosis Webquest Sarah Follenweider, The English High School 2009 Summer Research Internship Program
Cystic Fibrosis Webquest Sarah Follenweider, The English High School 2009 Summer Research Internship Program Introduction: Cystic fibrosis (CF) is an inherited chronic disease that affects the lungs and
Error Tolerant Searching of Uninterpreted MS/MS Data
Error Tolerant Searching of Uninterpreted MS/MS Data 1 In any search of a large LC-MS/MS dataset 2 There are always a number of spectra which get poor scores, or even no match at all. 3 Sometimes, this
Genetomic Promototypes
Genetomic Promototypes Mirkó Palla and Dana Pe er Department of Mechanical Engineering Clarkson University Potsdam, New York and Department of Genetics Harvard Medical School 77 Avenue Louis Pasteur Boston,