pcas-guide System Validation in Genome Editing
|
|
|
- Sharleen Chandler
- 10 years ago
- Views:
Transcription
1 pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible and simple system resulting in high specificity and low cell toxicity. The system uses a nuclease, Cas9 in complex with guide RNA (grna) to cleave DNA in a sequence-specific manner upstream of the protospacer-adjacent-motif (PAM - the sequence NGG) in any genomic location. RNA-Guided Human Genome Engineering via Cas9 Prashant Mali et al, George M. Church pcas9-guide vector expressing human codon-optimized Cas9 and grna The main purpose of this paper is to provide details how to tag a gene in the cellular genome using OriGene s pcas-guide system. I. The wild-type HSP60 C-terminal sequence and the desired C-terminal HA-tagged HSP60 sequence after genome editing A. The wild-type HSP60 C-terminal sequence. Sequences in green are two targeting sequences for grna cloning; one before the stop codon (labeled with *) and one after the stop codon. Regarding how to design grna will be displayed below. TTA TTG GAT GCT GCT GGT GTG GCC TCT CTG TTA ACT ACA GCA GAA GTT GTA GTC ACA GAA ATT CCT 1787 L L D A A G V A S L L T T A E V V V T E I P 550 AAA GAA GAG AAG GAC CCT GGA ATG GGT GCA ATG GGT GGA ATG GGA GGT GGT ATG GGA GGT GGC ATG 1853 K E E K D P G M G A M G G M G G G M G G G M 572 TTC TAA CTCCTAGACTAGTGCTTTACCTTTATTAATGAACTGTGACAGGAAGCCCAAGGCAGTGTTCCTCACCAATAACTTCAGA 1938 F * 573 GAAGTCAGTTGGAGAAAATGAAGAAAAAGGCTGGCTGAAAATCACTATAACCATCAGTTACTGGTTTCAGTTGACAAAATATATAAT 2025 GGTTTACTGCTGTCATTGTCCATGCCTACAGATAATTTATTTTGTATTTTTGAATAAAAAACATTTGTACATTCCTGATACTGGGTA 2112 CAAGAGCCATGTACCAGTGTACTGCTTTCAACTTAAATCACTGAGGCATTTTTACTACTATTCTGTTAAAATCAGGATTTTAGTGCT 2199 B. The desired C-terminal HA tagged HSP60 sequence after editing (sequence in red is the HA tag) TTA TTG GAT GCT GCT GGT GTG GCC TCT CTG TTA ACT ACA GCA GAA GTT GTA GTC ACA GAA ATT CCT 1787 L L D A A G V A S L L T T A E V V V T E I P 550 AAA GAA GAG AAG GAC CCT GGA ATG GGT GCA ATG GGT GGA ATG GGA GGT GGT ATG GGA GGT GGC ATG 1853 K E E K D P G M G A M G G M G G G M G G G M 572 TTC TAC CCA TAC GAT GTT CCA GAT TAC GCT TAA CTCCTAGACTAGTGCTTTACCTTTATTAATGAACTGTGACAGG 1929 F Y P Y D V P D Y A * 582 AAGCCCAAGGCAGTGTTCCTCACCAATAACTTCAGAGAAGTCAGTTGGAGAAAATGAAGAAAAAGGCTGGCTGAAAATCACTATAAC 2016 CATCAGTTACTGGTTTCAGTTGACAAAATATATAATGGTTTACTGCTGTCATTGTCCATGCCTACAGATAATTTATTTTGTATTTTT 2103
2 GAATAAAAAACATTTGTACATTCCTGATACTGGGTACAAGAGCCATGTACCAGTGTACTGCTTTCAACTTAAATCACTGAGGCATTT 2190 TTACTACTATTCTGTTAAAATCAGGATTTTAGTGCTTGCCACCACCAGATGAGAAGTTAAGCAGCCTTTCTGTGGAGAGTGAGAATA 2277 ATTGTGTACAAAGTAGAGAAGTATCCAATTATGTGACAACCTTTGTGTAATAAAAATTTGTTTAAAGTTAAAAAAAAAAAAAAAAAA 2364 AA 2366 II. Designing pcas-guide targeting sequences, grna Since the insertion site is at the end of the C-terminus of HSP60, the double-stranded break site should be near the insertion site which is the stop codon TAA in the wild-type sequence. Cas9-Guide system also recognizes the reverse complement sequence. For the targeting sequence in the reverse complement sequence, the cleavage site should be at the 5 end of the corresponding forward targeting sequence. To design two grna sequences, a designing tool at the Blue Heron website was used A sequence of around 60 bp flanking the TAA was copied and pasted to the sequence box of the designing tool. After clicking the Search button, the search results were shown below: Location Target Sequence Pam GC content 2-21(F) 5 ATGGGAGGTGGTATGGGAGG 3 TGG 61% 59-40(RC) 5 TAAAGGTAAAGCACTAGTCT 3 AGG 39% F, forward sequence; RC, reverse complement The two sequences were selected, and the corresponding oligo pairs (shown in green text in the WT HSP60 C-terminus sequence above) were ordered and cloned to the pcas-guide vector to produce grna when transfected into cells. The constructs are named pcas-hsp60t1 and pcas-hsp60t2 respectively. III. Designing the HSP60 editing donor DNA Oligo DNA was used as the editing donor for homologous recombination to insert the HA tag at the C- terminus of HSP60 in the genome. The HA tag sequence is flanked by about 50 bp HSP60 sequence before and after the stop codon respectively (homologous arms for recombination). Forward Oligo (sequence in red is the HA tag sequence): 5 GAATGGGTGCAATGGGTGGAATGGGAGGTGGTATGGGAGGTGGCATGTTCtacccatacgatgttccagattacgct TAACTCCTAGACTAGTGCTTTACCTTTATTAATGAACTGTGACAGGAAGC 3 Reverse complement Oligo (sequence in red is the HA tag sequence): 5 GCTTCCTGTCACAGTTCATTAATAAAGGTAAAGCACTAGTCTAGGAGTTAagcgtaatctggaacatcgtatgggta GAACATGCCACCTCCCATACCACCTCCCATTCCACCCATTGCACCCATTC 3
3 The two oligos were annealed to form double-stranded DNA following the protocol below: In a PCR tube, add the following: 4 µl Forward oligo (100 µm stock) 4 µl Reverse oligo (100 µm stock) 4 µl 10X annealing buffer 40 µl dh 2 O Mix the solution and follow the steps to anneal the oligos: 94 o C for 4 min 75 o C for 5 min 65 o C for 15 min 25 o C for 20 min After annealing, transfer the solution to a 1.5 ml tube and add 360 µl of dh 2 O. Measure the DNA concentration using a Nano drop. The DNA is ready for use. IV. Genome editing through transfection 1. Day 1, Seed cells Approximately hours before transfection, seed HEK293T cells in a 6-well plate in 2.5 ml complete growth media per well. Ideally cells should be 50% confluent prior to transfection. 2. Day 2, Transfection a. In a 1.5 ml tube, add 0.75 µg of pcas-guide DNA and 0.75 µg of the HSP60 HA donor DNA. Add 60 µl of Opti-MEM to dilute the DNA by mixing completely. b. Add 4.5 µl of transfection reagent (Turbofectin 8.0) to the diluted DNA mixture. Pipette gently to mix completely and incubate at RT for 20 min c. Transfer the Turbofectin 8.0/DNA mixture to a well in the 6-well plate prepared on day 1 drop-wise. Gently rock the plate back-and-forth and from side-to-side to achieve even distribution of the complexes. 3. Day 3 24hr post transfection, change the cell culture media with fresh media; grow cells at a CO2 incubator for an additional two days. 4. Day 5 Split the cells to three identical 6-well plates. Grow the cells for three more days. 5. Day 8 The cells can now be analyzed for genome editing. V. Analysis detecting the HA tag inserted in the cellular genome Analysis I, Protein extraction and Western Blotting to measure HA-tagged HSP60 protein 1. Remove the media from each well, wash the cells with 2 ml PBS. 2. Add 100 µl RIPA buffer and collect the cell lysates into a 1.5 ml tube. 3. Clear the cell debris by spinning down at 4000rpm for 4 min. 4. Take the supernatant, add 100 µl of 2X protein loading buffer. 5. Run the lysates on a 4-12% gradient SDS PAGE Gel. 6. Perform protein transfer onto a PVDF membrane using a standard protocol.
4 7. Western blotting was performed using anti-hsp60 and anti-ha antibodies respectively Anti HSP60 Anti HA Fig. 1. Western blotting of pcas-guide constructs and HSP60 donor DNA transfected HEK293 cells. Lane 1 and lane 5: pcas-scramble plus HSP60 HA donor were transfected Lane 2 and lane 6: pcas-hsp60t1 plus HSP60 HA donor were transfected Lane 3 and lane 7: pcas-scramble plus HSP60 HA donor were transfected Lane 4 and lane 8: pcas-hsp60t2 plus HSP60 HA donor were transfected Analysis II, Genomic DNA extraction and PCR to verify the HA tag sequence in the cellular genome 1. Cells were harvested and genomic DNA was extracted using a genomic isolation kit. 2. Measure the DNA concentration. 3. Perform PCR using a pair of primers* detecting the HA sequence integration 4. Run PCR products on a 1% Agarose Gel *Note: to detect the targeted editing through PCR, a pair of PCR primers was designed. The forward primer is in the HA coding region and the reverse primer is in the HSP60 which is downstream of the donor sequence to avoid background contamination from the HSP60 donor oligo DNA. A positive PCR product with a correct size and subsequent sequencing of the PCR fragment will confirm the desired integration in the cellular genome.
5 Fig. 2. PCR the genomic DNA from pcas-guide constructs and HSP60 donor DNA transfected HEK293 cells. Lane 1: DNA molecular Marker Lane 2: pcas-scramble plus HSP60 HA donor Lane3: pcas-hspt1 plus HSP60 HA donor Lane4: pcas-scramble plus HSP60 HA donor Lane5: pcas-hspt2 plus HSP60 HA donor In summary, adding a tag to the endogenous gene is simple and affordable using pcas-guide system. We used oligos as donor sequence in this tagging study. For other genome engineering, such as gene replacement with luciferase or GFP for promoter study and gene knock-in, rescue donor vectors can also be used. The rescue donor vectors can be ordered Editing.aspx.
DNA Sample preparation and Submission Guidelines
DNA Sample preparation and Submission Guidelines Requirements: Please submit samples in 1.5ml microcentrifuge tubes. Fill all the required information in the Eurofins DNA sequencing order form and send
GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core
DNA Sequencing Services Pre-Mixed o Provide template and primer, mixed into the same tube* Pre-Defined o Provide template and primer in separate tubes* Custom o Full-service for samples with unknown concentration
Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation
BDGP Resources Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation For recovery of sequences flanking PZ, PlacW and PEP elements E. Jay Rehm Berkeley Drosophila Genome Project I.
10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C)
TECHNICAL DATA SHEET BIOLUMINESCENCE RESONANCE ENERGY TRANSFER RENILLA LUCIFERASE FUSION PROTEIN EXPRESSION VECTOR Product: prluc-c Vectors Catalog number: Description: Amount: The prluc-c vectors contain
RT-PCR: Two-Step Protocol
RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed
(http://genomes.urv.es/caical) TUTORIAL. (July 2006)
(http://genomes.urv.es/caical) TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA
Gene Synthesis 191. Mutagenesis 194. Gene Cloning 196. AccuGeneBlock Service 198. Gene Synthesis FAQs 201. User Protocol 204
Gene Synthesis 191 Mutagenesis 194 Gene Cloning 196 AccuGeneBlock Service 198 Gene Synthesis FAQs 201 User Protocol 204 Gene Synthesis Overview Gene synthesis is the most cost-effective way to enhance
pcmv6-neo Vector Application Guide Contents
pcmv6-neo Vector Application Guide Contents Package Contents and Storage Conditions... 2 Product Description... 2 Introduction... 2 Production and Quality Assurance... 2 Methods... 3 Other required reagents...
(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors.
Legends of supplemental figures and tables Figure 1: Overview of study design and results. (A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. After raw data gene expression
UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet
1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:.
TransIT -2020 Transfection Reagent
Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/5400 INTRODUCTION TransIT -2020 Transfection Reagent is a high-performance, animal-origin free, broad spectrum reagent
Molecular analyses of EGFR: mutation and amplification detection
Molecular analyses of EGFR: mutation and amplification detection Petra Nederlof, Moleculaire Pathologie NKI Amsterdam Henrique Ruijter, Ivon Tielen, Lucie Boerrigter, Aafke Ariaens Outline presentation
Taqman TCID50 for AAV Vector Infectious Titer Determination
Page 1 of 8 Purpose: To determine the concentration of infectious particles in an AAV vector sample. This process involves serial dilution of the vector in a TCID50 format and endpoint determination through
SERVICES CATALOGUE WITH SUBMISSION GUIDELINES
SERVICES CATALOGUE WITH SUBMISSION GUIDELINES 3921 Montgomery Road Cincinnati, Ohio 45212 513-841-2428 www.agctsequencing.com CONTENTS Welcome Dye Terminator Sequencing DNA Sequencing Services - Full Service
TITRATION OF raav (VG) USING QUANTITATIVE REAL TIME PCR
Page 1 of 5 Materials DNase digestion buffer [13 mm Tris-Cl, ph7,5 / 5 mm MgCl2 / 0,12 mm CaCl2] RSS plasmid ptr-uf11 SV40pA Forward primer (10µM) AGC AAT AGC ATC ACA AAT TTC ACA A SV40pA Reverse Primer
Mir-X mirna First-Strand Synthesis Kit User Manual
User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.
First Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
Chromatin Immunoprecipitation
Chromatin Immunoprecipitation A) Prepare a yeast culture (see the Galactose Induction Protocol for details). 1) Start a small culture (e.g. 2 ml) in YEPD or selective media from a single colony. 2) Spin
In vitro analysis of pri-mirna processing. by Drosha-DGCR8 complex. (Narry Kim s lab)
In vitro analysis of pri-mirna processing by Drosha-DGCR8 complex (Narry Kim s lab) 1-1. Preparation of radiolabeled pri-mirna transcript The RNA substrate for a cropping reaction can be prepared by in
Instructions. Torpedo sirna. Material. Important Guidelines. Specifications. Quality Control
is a is a state of the art transfection reagent, specifically designed for the transfer of sirna and mirna into a variety of eukaryotic cell types. is a state of the art transfection reagent, specifically
Pure-IP Western Blot Detection Kit
Product Manual Pure-IP Western Blot Detection Kit Catalog Number PRB-5002 20 blots FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction The technique of immunoprecipitation (IP) is used
Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides
Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides Polyacrylamide gel electrophoresis (PAGE) and subsequent analyses are common tools in biochemistry and molecular biology. This Application
Supplementary Information. Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human
Supplementary Information Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human vascular endothelial growth factor 165 revealed by biosensor based assays Yoichi Takakusagi
Mutations and Genetic Variability. 1. What is occurring in the diagram below?
Mutations and Genetic Variability 1. What is occurring in the diagram below? A. Sister chromatids are separating. B. Alleles are independently assorting. C. Genes are replicating. D. Segments of DNA are
Anti-ATF6 α antibody, mouse monoclonal (1-7)
Anti-ATF6 α antibody, mouse monoclonal (1-7) 73-500 50 ug ATF6 (activating transcription factor 6) is an endoplasmic reticulum (ER) membrane-bound transcription factor activated in response to ER stress.
Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation. Beginning Perl, Chap 4 6. Example 1
Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation Beginning Perl, Chap 4 6 Example 1 #!/usr/bin/perl -w use strict; # version 1: my @nt = ('A', 'C', 'G', 'T'); for
Cloning GFP into Mammalian cells
Protocol for Cloning GFP into Mammalian cells Studiepraktik 2013 Molecular Biology and Molecular Medicine Aarhus University Produced by the instructors: Tobias Holm Bønnelykke, Rikke Mouridsen, Steffan
Design high specificity CRISPR-Cas9 grnas: principles and tools. Heidi Huang, PhD
Design high specificity CRISPR-Cas9 grnas: principles and tools Heidi Huang, PhD Webinar Agenda 1 2 3 4 Introduction of CRISPR-Cas9 grna Design Resources and Services Q&A 2 What is CRISPR? CRISPR Clustered
Recombinant DNA Unit Exam
Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the
FOR REFERENCE PURPOSES
BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit
NimbleGen SeqCap EZ Library SR User s Guide Version 3.0
NimbleGen SeqCap EZ Library SR User s Guide Version 3.0 For life science research only. Not for use in diagnostic procedures. Copyright 2011 Roche NimbleGen, Inc. All Rights Reserved. Editions Version
Hands on Simulation of Mutation
Hands on Simulation of Mutation Charlotte K. Omoto P.O. Box 644236 Washington State University Pullman, WA 99164-4236 [email protected] ABSTRACT This exercise is a hands-on simulation of mutations and their
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
RevertAid Premium First Strand cdna Synthesis Kit
RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent
Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project
Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project Protocol for recovery of sequences flanking insertions in the Drosophila Gene Disruption
ab185916 Hi-Fi cdna Synthesis Kit
ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1
Classic Immunoprecipitation
292PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name Classic Immunoprecipitation Utilizes Protein A/G Agarose for Antibody Binding (Cat.
50 g 650 L. *Average yields will vary depending upon a number of factors including type of phage, growth conditions used and developmental stage.
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: [email protected] Phage DNA Isolation Kit Product # 46800, 46850 Product Insert
Application Guide... 2
Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied
Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541
PRODUCT INFORMATION Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541 Lot _ Store at -20 C Expiry Date _ www.thermoscientific.com/onebio CERTIFICATE OF ANALYSIS The Phusion Site-Directed Mutagenesis
User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube
User Manual CelluLyser Lysis and cdna Synthesis Kit Version 1.4 Oct 2012 From cells to cdna in one tube CelluLyser Lysis and cdna Synthesis Kit Table of contents Introduction 4 Contents 5 Storage 5 Additionally
Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products
Genolution Pharmaceuticals, Inc. Revolution through genes, And Solution through genes. Life Science and Molecular Diagnostic Products www.genolution1.com TEL; 02-3010-8670, 8672 Geno-Serum Hepatitis B
ExpressArt Bacterial H-TR cdna synthesis kit. With extreme selectivity against rrnas
ExpressArt Bacterial H-TR cdna synthesis kit With extreme selectivity against rrnas suitable for 2 to 4 µg total RNA Catalogue No. 8004-A30 (30 rxns) Reagents Materials are provided for 30 cdna synthesis
NimbleGen DNA Methylation Microarrays and Services
NimbleGen DNA Methylation Microarrays and Services Sample Preparation Instructions Outline This protocol describes the process for preparing samples for NimbleGen DNA Methylation microarrays using the
Table S1. Related to Figure 4
Table S1. Related to Figure 4 Final Diagnosis Age PMD Control Control 61 15 Control 67 6 Control 68 10 Control 49 15 AR-PD PD 62 15 PD 65 4 PD 52 18 PD 68 10 AR-PD cingulate cortex used for immunoblot
Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3
Table of Contents I. Description... 2 II. Kit Components... 2 III. Storage... 2 IV. 1st Strand cdna Synthesis Reaction... 3 V. RT-PCR, Real-time RT-PCR... 4 VI. Application... 5 VII. Preparation of RNA
GRS Plasmid Purification Kit Transfection Grade GK73.0002 (2 MaxiPreps)
1 GRS Plasmid Purification Kit Transfection Grade GK73.0002 (2 MaxiPreps) (FOR RESEARCH ONLY) Sample : Expected Yield : Endotoxin: Format : Operation Time : Elution Volume : 50-400 ml of cultured bacterial
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Susan Carson Heather B. Miller D.Scott Witherow ELSEVIER AMSTERDAM BOSTON HEIDELBERG LONDON NEW YORK OXFORD PARIS SAN DIEGO SAN
HighPure Maxi Plasmid Kit
HighPure Maxi Plasmid Kit For purification of high pure plasmid DNA with high yields www.tiangen.com PP120109 HighPure Maxi Plasmid Kit Kit Contents Storage Cat.no. DP116 Contents RNaseA (100 mg/ml) Buffer
ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S.
A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA... A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA from Shed Reptile Skin ABSTRACT
Next Generation Sequencing
Next Generation Sequencing 38. Informationsgespräch der Blutspendezentralefür Wien, Niederösterreich und Burgenland Österreichisches Rotes Kreuz 22. November 2014, Parkhotel Schönbrunn Die Zukunft hat
Protocol for Western Blotting
Protocol for Western Blotting Materials Materials used on Day 3 Protease inhibitor stock: 1 μg/μl pepstatin A in DMSO 200 μm leupeptin in OG Buffer 200 mm PMSF: Freshly made. Ex) 34.8 mg PMSF in 1 ml isopropanol
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One TM mirna First-Strand cdna Synthesis Kit AMRT-0020 (20 RT reactions), AMRT-0060 (60 RT reactions) Used in combination
RNA Extraction and Quantification, Reverse Transcription, and Real-time PCR (q-pcr)
RNA Extraction and Quantification, Reverse Transcription, and Real-time Preparation of Samples Cells: o Remove media and wash cells 2X with cold PBS. (2 ml for 6 well plate or 3 ml for 6cm plate) Keep
Protein extraction from Tissues and Cultured Cells using Bioruptor Standard & Plus
Protein extraction from Tissues and Cultured Cells using Bioruptor Standard & Plus Introduction Protein extraction from tissues and cultured cells is the first step for many biochemical and analytical
Genomic DNA Extraction Kit INSTRUCTION MANUAL
Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview
Chromatin Immunoprecipitation (ChIP)
Chromatin Immunoprecipitation (ChIP) Day 1 A) DNA shearing 1. Samples Dissect tissue (One Mouse OBs) of interest and transfer to an eppendorf containing 0.5 ml of dissecting media (on ice) or PBS but without
Gene Finding CMSC 423
Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would you decipher
Terra PCR Direct Polymerase Mix User Manual
Clontech Laboratories, Inc. Terra PCR Direct Polymerase Mix User Manual Cat. Nos. 639269, 639270, 639271 PT5126-1 (031416) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain
GenScript BloodReady TM Multiplex PCR System
GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI
Integrated Protein Services
Integrated Protein Services Custom protein expression & purification Version DC04-0012 Expression strategy The first step in the recombinant protein generation process is to design an appropriate expression
Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr
User Manual Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,
Optimized Protocol sirna Test Kit for Cell Lines and Adherent Primary Cells
page 1 of 8 sirna Test Kit for Cell Lines and Adherent Primary Cells Kit principle Co-transfection of pmaxgfp, encoding the green fluorescent protein (GFP) from Pontellina p. with an sirna directed against
Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix
CLONING & MAPPING DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix LIBRARY PREP FOR NET GEN SEQUENCING PROTEIN
2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line
i 1 INTRODUCTION 1.1 Human Hepatitis B virus (HBV) 1 1.1.1 Pathogenesis of Hepatitis B 1 1.1.2 Genome organization of HBV 3 1.1.3 Structure of HBV virion 5 1.1.4 HBV life cycle 5 1.1.5 Experimental models
qstar mirna qpcr Detection System
qstar mirna qpcr Detection System Table of Contents Table of Contents...1 Package Contents and Storage Conditions...2 For mirna cdna synthesis kit...2 For qstar mirna primer pairs...2 For qstar mirna qpcr
STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS
STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS THESIS SUBMITTED FOR THE DEGREB OF DOCTOR OF PHILOSOPHY (SCIENCE) OF THE UNIVERSITY OF CALCUTTA 1996 NRISINHA DE, M.Sc DEPARTMENT OF BIOCHEMISTRY
The p53 MUTATION HANDBOOK
The p MUTATION HANDBOOK Version 1. /7 Thierry Soussi Christophe Béroud, Dalil Hamroun Jean Michel Rubio Nevado http://p/free.fr The p Mutation HandBook By T Soussi, J.M. Rubio-Nevado, D. Hamroun and C.
RT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl
Components RT31-020 20 rxns RT31-050 50 rxns RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl 2x RT Master Mix (2) 200 µl 2 x 250 µl 5 x 200 µl RNase H (E. coli) 20 µl 2 x 25 µl
PRODUCT INFORMATION...
VIROMER RED In vitro plasmid DNA and mrna Standard Transfection PRODUCT INFORMATION... 2 GENERAL... 2 RED OR YELLOW?... 3 PROTOCOL GUIDELINES... 4 GENERAL REMARKS... 4 CELL CULTURE AND PLATING... 4 FORWARD/REVERSE
ptune Inducible Vector
ptune Inducible Vector Application Guide Table of Contents Package contents and Storage Conditions:...2 Related products:...2 Introduction...2 Figure 1. Schematic Diagrams of ptune Inducible vector...3
FastLine cell cdna Kit
1. FastLine cell cdna Kit For high-speed preparation of first-strand cdna directly from cultured cells without RNA purification www.tiangen.com RT100701 FastLine cell cdna Kit Cat. no. KR105 Kit Contents
EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità
Identification and characterization of Verocytotoxin-producing Escherichia coli (VTEC) by Real Time PCR amplification of the main virulence genes and the genes associated with the serogroups mainly associated
Technical Manual No. 0173 Update Date 10112010
TissueDirect TM Multiplex PCR System Technical Manual No. 0173 Update Date 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed
All commonly-used expression vectors used in the Jia Lab contain the following multiple cloning site: BamHI EcoRI SmaI SalI XhoI_ NotI
2. Primer Design 2.1 Multiple Cloning Sites All commonly-used expression vectors used in the Jia Lab contain the following multiple cloning site: BamHI EcoRI SmaI SalI XhoI NotI XXX XXX GGA TCC CCG AAT
SDS-PAGE. (June 23, 2005)
SDS-PAGE (June 23, 2005) GATHER REAGENTS & MATERIALS 30% acrylamide/0.8% bisacrylamide (30:1) 4X Tris. Cl/SDS, ph 8.8 4X Tris. Cl/SDS, ph 6.8 Ammonium persulfate, 10% (Make fresh each time.) SDS electrophoresis
Introduction to cloning
1 of 14 Introduction to cloning Aim The aim of this protocol is to serve as a general guideline to mainstream molecular cloning of Gene of Interest ( GOI ). Overview GOI Sequence Transformation into Bacteria
Genome Editing TOOLS TO SUPPORT CRISPR/CAS9 APPLICATIONS
Genome Editing TOOLS TO SUPPORT CRISPR/CAS9 APPLICATIONS Genome Editing: Tools to Support CRISPR/Cas9 Applications Genome editing is enabled by the development of tools to make precise, targeted changes
Supplementary Figure 1.
Supplementary Figure 1. (A) MicroRNA 212 enhances IS from pancreatic β-cells. INS-1 832/3 β-cells were transfected with precursors for mirnas 212, 375, or negative control oligonucleotides. 48 hrs after
Design of conditional gene targeting vectors - a recombineering approach
Recombineering protocol #4 Design of conditional gene targeting vectors - a recombineering approach Søren Warming, Ph.D. The purpose of this protocol is to help you in the gene targeting vector design
INTERFERin in vitro sirna/mirna transfection reagent PROTOCOL. 1 Standard sirna transfection of adherent cells... 2
INTERFERin in vitro sirna/mirna transfection reagent PROTOCOL DESCRIPTION INTERFERin is a powerful sirna/mirna transfection reagent that ensures efficient gene silencing and reproducible transfection in
EZ Load Molecular Rulers. Catalog Numbers 170-8351 20 bp 170-8352 100 bp 170-8353 100 bp PCR 170-8354 500 bp 170-8355 1 kb 170-8356 Precision Mass
EZ Load Molecular Rulers Catalog Numbers 170-8351 20 bp 170-8352 100 bp 170-8353 100 bp PCR 170-8354 500 bp 170-8355 1 kb 170-8356 Precision Mass EZ Load Molecular Rulers Quantity DNA sufficient for 100
Bacterial Transformation with Green Fluorescent Protein. Table of Contents Fall 2012
Bacterial Transformation with Green Fluorescent Protein pglo Version Table of Contents Bacterial Transformation Introduction..1 Laboratory Exercise...3 Important Laboratory Practices 3 Protocol...... 4
GeneCopoeia Genome Editing Tools for Safe Harbor Integration in. Mice and Humans. Ed Davis, Liuqing Qian, Ruiqing li, Junsheng Zhou, and Jinkuo Zhang
G e n e C o p o eia TM Expressway to Discovery APPLICATION NOTE Introduction GeneCopoeia Genome Editing Tools for Safe Harbor Integration in Mice and Humans Ed Davis, Liuqing Qian, Ruiqing li, Junsheng
Reverse Transcription System
TECHNICAL BULLETIN Reverse Transcription System Instruc ons for use of Product A3500 Revised 1/14 TB099 Reverse Transcription System All technical literature is available on the Internet at: www.promega.com/protocols/
Event-specific Method for the Quantification of Maize MIR162 Using Real-time PCR. Protocol
Event-specific Method for the Quantification of Maize MIR162 Using Real-time PCR Protocol 31 January 2011 Joint Research Centre Institute for Health and Consumer Protection Molecular Biology and Genomics
DNA Isolation Kit for Cells and Tissues
DNA Isolation Kit for Cells and Tissues for 10 isolations of 00 mg each for tissue or 5 x 10 7 cultured cells Cat. No. 11 81 770 001 Principle Starting material Application Time required Results Benefits
Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011
Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)
BacReady TM Multiplex PCR System
BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental
TransformAid Bacterial Transformation Kit
Home Contacts Order Catalog Support Search Alphabetical Index Numerical Index Restriction Endonucleases Modifying Enzymes PCR Kits Markers Nucleic Acids Nucleotides & Oligonucleotides Media Transfection
PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI,
Supplemental Text/Tables PCR Amplification and Sequencing PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Foster City, CA). Each PCR reaction contained 20 ng genomic
mirnaselect pep-mir Cloning and Expression Vector
Product Data Sheet mirnaselect pep-mir Cloning and Expression Vector CATALOG NUMBER: MIR-EXP-C STORAGE: -80ºC QUANTITY: 2 vectors; each contains 100 µl of bacterial glycerol stock Components 1. mirnaselect
Product name Company Cat # PowerPac Basic Power supply Bio Rad 165-6019 Mini Protean electrophoresis system Mini trans blot cell Bio Rad 170-3930
SDS-PAGE and western blot for low molecular weight proteins (2-20kDa) Merav Marom Shamur, Smart Assays Aim: Analysis of low molecular weight proteins by SDS-PAGE and western blot under reducing conditions.
OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation
OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation -Optimal strategies to a successful mirna research project Optimal strategies to a successful mirna research
Intended Use: The kit is designed to detect the 5 different mutations found in Asian population using seven different primers.
Unzipping Genes MBPCR014 Beta-Thalassemia Detection Kit P r o d u c t I n f o r m a t i o n Description: Thalassemia is a group of genetic disorders characterized by quantitative defects in globin chain
Western Blot Protocol Protein isolation
Western Blot Protocol Protein isolation A. Preparation of cell lysates. - Preparation of materials: -Dial the microcentrifuge temperature control setting to 4 C -Prepare a bucket of ice -Prepare lysis
