Tools for human molecular diagnosis. Joris Vermeesch

Transcription

1 Tools for human molecular diagnosis Joris Vermeesch

2 Chromosome > DNA

3 Genetic Code

4 Effect of point mutations/polymorphisms

5 Effect of deletions/insertions

6 Effect of splicing mutations IVS2-2A>G Normal splice site Exon 1 Exon 2...CCCCACATAgtaagg......gagtagCCATTCCACAGATTTT......CCCCACATAgtaagg... Cryptic splice site...gagtggccattccacagatttt...

7 Genetic testing 1 gene <> multiple genes Molecular testing 1 disease 1 (single) mutation 1 disease 1 gene different diseases 1 (single) gene (un)known defect karyotyping 1 disease few genes 1 disease 1 chromosomal anomaly different diseases many genes different diseases different anomalies Molecular cytogenetic testing total genome Cytogenetics

8 How do we test which tools to use? Mutation-specific test - Restriction enzyme digestion - Southern blot - Dot blot / reverse dot blot - PCR hybridization - PCR applications PCR/fragment sizing MLPA: large deletion/duplications Mutation detection - Mutation scanning o SSCP o DGGE o DHPLC o HRM-CA - Sequencing o Sanger sequencing o Next Generation Sequencing

9 How do we test which tools to use? Mutation-specific test - Restriction enzyme digestion - Southern blot - Dot blot / reverse dot blot - PCR hybridization - PCR applications PCR/fragment sizing MLPA: large deletion/duplications Mutation detection - Mutation scanning o SSCP o DGGE o DHPLC o HRM-CA - Sequencing o Sanger sequencing o Next Generation Sequencing

10 Factor V (Leiden mutatie 1691A) Mnl I 5 - GGCGAGG GGCAAGG 3 Arg(R) to Gln(Q) at position

11 How do we test which tools to use? Mutation-specific test - Restriction enzyme digestion - Southern blot - Dot blot / reverse dot blot - PCR hybridization - PCR applications PCR/fragment sizing MLPA: large deletion/duplications Mutation detection - Mutation scanning o SSCP o DGGE o DHPLC o HRM-CA - Sequencing o Sanger sequencing o Next Generation Sequencing

12 Southern blot

13 Southern blot FMR

14 How do we test which tools to use? Mutation-specific test - Restriction enzyme digestion - Southern blot - Dot blot / reverse dot blot - PCR hybridization - PCR applications PCR/fragment sizing MLPA: large deletion/duplications Mutation detection - Mutation scanning o SSCP o DGGE o DHPLC o HRM-CA - Sequencing o Sanger sequencing o Next Generation Sequencing

15 Distribution of Cystic Fibrosis Mutations a 6b a 14b a 17b ' 3' Missense AA deletion Nonsense Frameshift Splice site Amino acid Variation Total Membrane spanning ATP-binding R-domain Membrane spanning ATP-binding (Data from the CF Genetic Analysis Consortium- July, 1995)

16 F508del (ex.10) 72.5 % G542X (ex.11) 5.5 % N1303K (ex.21) 3.5 % G>A (in. 10) 2.5 % W1282X (ex.20) 1.0 % G551D (ex.10) 0.5 % R553X (ex.10) 0.5 % I 507del (ex.10) 0.5 %

17 Reverse Dot Blot principe chromogeen paars precipitaat alkalisch fosfatase streptavidine biotine geamplificeerd DNA DNA-probe membraan

18

19 How do we test which tools to use? Mutation-specific test - Restriction enzyme digestion - Southern blot - Dot blot / reverse dot blot - PCR hybridization - PCR applications PCR/fragment sizing MLPA: large deletion/duplications Mutation detection - Mutation scanning o SSCP o DGGE o DHPLC o HRM-CA - Sequencing o Sanger sequencing o Next Generation Sequencing

20 TaqMan

21

22 TaqMan output

23 Molecular beacon

24 FRET (Fluorescence Resonance Energy Transfer) Principe

25 FRET (Fluorescence Resonance Energy Transfer) Principle

26 FRET (Fluorescence Resonance Energy Transfer) Principle

27

28 How do we test which tools to use? Mutation-specific test - Restriction enzyme digestion - Southern blot - Dot blot / reverse dot blot - PCR hybridization - PCR applications PCR/fragment sizing MLPA: large deletion/duplications Mutation detection - Mutation scanning o SSCP o DGGE o DHPLC o HRM-CA - Sequencing o Sanger sequencing o Next Generation Sequencing

29

30 MLPA: Multiplex Ligation-dependent Probe Amplification

31 1,2 1 0,8 0,6 0,4 0,2 0 MLH1 exon 1 MSH2 exon 1 MLH1 exon 2 MSH2 exon 2 MLH1 exon 3 MSH2 exon 3 MLH1 exon 4 MSH2 exon 4 MLH1 exon 5 MSH2 exon 5 MLH1 exon 6 MSH2 exon 6 MLH1 exon 7 MSH2 exon 7 MLH1 exon 8 MSH2 exon 8 MLH1 exon 9 MSH2 exon 9 MLH1 exon 10 MSH2 exon 10 MLH1 exon 11 MSH2 exon 11 MLH1 exon 12 MSH2 exon 12 MLH1 exon 13 MSH2 exon 13 MLH1 exon 14 MSH2 exon 14 MLH1 exon 15 MSH2 exon 15 MLH1 exon 16 MSH2 exon 16 MLH1 exon 17 MLH1 exon 18 MLH1 exon 19 MLPA MSL1&2

32 MLPA - SMA normal patient - SMA

33 How do we test which tools to use? Mutation-specific test - Restriction enzyme digestion - Southern blot - Dot blot / reverse dot blot - PCR hybridization - PCR applications PCR/fragment sizing MLPA: large deletion/duplications Mutation detection - Mutation scanning o SSCP o DGGE o DHPLC o HRM-CA - Sequencing o Sanger sequencing o Next Generation Sequencing

34 SSCP: Single strand conformation polymorphism

35 DGGE: Denaturing gradient gel electrophoresis Denaturant (Formamide/Urea) 0% 100% Separation Based on Differences in Nucleotide Sequence (G+C content) and Melting Characteristics Partially melted Single strands Or with GC-clamp Electrophoresis Double strand

36 DHPLC: Denaturing high performance liquid chromatography wild type mutant heteroduplexes homoduplexes A T G C A C G T A T G C

37 HRM: High resolution melting curve analysis wild type mutant heteroduplexes homoduplexes A T G C A C G T A T G C

38 How do we test which tools to use? Mutation-specific test - Restriction enzyme digestion - Southern blot - Dot blot / reverse dot blot - PCR hybridization - PCR applications PCR/fragment sizing MLPA: large deletion/duplications Mutation detection - Mutation scanning o SSCP o DGGE o DHPLC o HRM-CA - Sequencing o Sanger sequencing o Next Generation Sequencing

39 Sanger sequencing

40 Sequencing - ddntp

41 Sanger sequencing universal primers e1f 5 UTR e2f e3af e3bf e4/5f e6f Exon 1 Exon 2 Exon 3 Exons 4/5Exon 6 500bp 3 UTR 18bp M13-F e1r e2r e3ar e3br e4/5r e6r A30V intron 1 V L A Q D Y Q Q intron 2 ctagctattacgctactagc ctttccccag. gtc CTG GCT CAG gac tac cag cag.gtgggtatgc ctagctattacgctactagc 198C>T 18bp M13-R

42 Asp 90 G C T G A C A A A Asp/Ala 90 G C T G C C A A A A Controle Patiënt

43 Hereditarybreastand ovariancancer BRCA1 /BRCA2 BRCA1(on chromosome 17) BRCA2(on chromosome 13) 5.6 kb, 1863 aa - Affected patients identify the disease-causing mutation in the family - Dominantly inherited heterozygous mutations - Scattered thoughout the genes whole coding regions analyzed - Mostly truncating(nonsense, frameshifts(indels)) 10.3 kb, 3418 aa

44

45 Apostolou P, 2013

46 100 families

47 Aangepast van Fackenthal JD and Olopade OI, Nature Rev Cancer (2007) 185delAG IVS5+3A>G c.2197del5 c.2359dup c.3481del11 c.5266dupc IVS6+1G>A c.5213del4 c.6270del2 c.6275del2 c.8243g> A Exon19d el c.8904del

48

49 Vroeger Per patiënt= 110 PCR stalen 220 sequencing reacties Elke dag= 5 PCR platen 10 sequencing platen

50

51 BRCA MASTR v2.0 (Titanium) : 94 amplicons ng per multiplex PCR reaction

52

53 ROI Extra Specifieke primer Universeel deel Index 1 Complementair aan seq primer

54

55 Genetictesting Molecular testing 1 disease 1 (single) mutation 1 disease 1 gene different diseases 1 (single) gene (un)known defect karyotyping Cytogenetics 1 disease few genes 1 disease 1 chromosomal anomaly different diseases many genes different diseases different anomalies Molecular cytogenetic testing total genome

56

57

58 Projecten in het laboratorium Massive Parallel Sequencing (Illumina HiSeq ) Read Alignment, Mapping, Variant Calling and Annotation (Annovar) Variant Filtering (trio analysis) + CNV database mining IlluminaLibrary Prep and Exome Enrichment (NimbleGen) DE NOVO VARIANTS IN KNOWN MC GENES (8 PTS) DIAGNOSTIC VALUE e.g. CASK, CREBBP, TUBG1, KIF11 SYNDROMIC SPORADIC MC COHORT (19/20 trios) DE NOVO VARIANTS IN CANDIDATE MC GENES (7 PTS) e.g. LMNB1, SEMA4B, PKDL1, SNX21, SBSPON, FAT4, CCDC51 DE NOVO MUTATIONS TESTING IN ZEBRAFISH NO CANDIDATE DE NOVO VARIANTS (3 PTS)

59 Identification of causative mutations in rare disorders

60 Diagnostische exoom sequencing 100 patients 79 de novo mutations Diagnostic yield: 16% 51patients 87 de novo mutations Diagnostic yield: 45-55%

61 Limitations?! Exome is not entirely covered Limited to exons (and flanking regions) Impossible to detect (deep) intronic mutations Not quantitative Impossible to detect deletions or duplications Thousands of SNPs and variants

62 Gen en variant prioritisatie om causale SNPs te detecteren. Sifrim et al., Nature Methods, 2013

63 Volledige genoom analyse

64 Volledige genoom analyse 1.58 exomic variants/individual/generation Diagnostic yield: 62%

65 Wat met genetica in de maatschappij?