The NF1-gene a hotspot for de novo Alu- and L1-insertion?
|
|
- Marshall Woods
- 8 years ago
- Views:
Transcription
1 The NF1-gene a hotspot for de novo Alu- and L1-insertion? Katharina Wimmer Division Humangenetik, Medizinische Universität Innsbruck Molekulare Diagnostik 2013 Zürich, 1. März, 2013
2 2 Die im Vortrag vorgestellten Daten wurden zu einem großen Teil in dieser Publikation veröffentlicht:
3 NF1 gene Structure Chromosomal location: 17q11.2 Genomic sequence: 280 kb Coding sequence: 8454 bp (57 exons) Gene product neurofibromin: 220 kd Presence 3 of multiple pseudogene copies Mutations Point mutations: >90% Microdeletions: 5% Intragenic deletions/duplications: 2% Chromosomal alterations: <1%
4 Direct cdna sequencing of NF1 gene Blood sample RNA-Extraction cdna Synthesis with random hexamers Amplification of the entire coding sequence in 5 overlapping long-range (2-3 kb) PCR fragments F1 F2 F3 F4 F5 Fragment F1-F5 modified from Heim et al. (1995) Hum Mol Genet 4: Sequencing of the entire coding with 20 internal primers
5 Illegitimate splicing of the NF1 gene in aged blood samples mimics mutation-induced splicing alterations 5 Wimmer et al. Hum Genet (2000) 106:
6 0 hrs RT 24 hrs RT 48 hrs RT 24 hrs RT +72 hrs cult. 48 hrs RT +72 hrs cult. Short-term PHA-stimulated lymphocyte culture prevents illegitimate splicing 600 bp 400 bp M + exon 14 - exon 14 circumvents nonsense-mediated decay (NMD) by puromycine treatment of proliferating lymphocytes with puromycine treatment without puromycine treatment 6
7 Comprehensive NF1 mutation analysis protocol blood sample blood sample Short-term culture for RNA extraction inhibition illegitimate splicing inhibition NMD gdna extraction Direct cdna sequencing identification of all types of point mutations and many intragenic CNC gdna sequencing confirmation of mutation MLPA identification/ confirmation of deletions/ duplications 7
8 Spectrum of NF1 mutations reaching a detection rate of 95% complex other <1% frameshift 26% missense or 1-multi AA del/dup 18% nonsense 21% splice 27% 8 intragenic CNC 2% total gene deletion 5% Messiaen & Wimmer (2008) Monographs in Hum Genet 16:63-77
9 Types of splicing mutations found in 85 index cases 29 Classic splice-site mutations affecting GT-AG dinucleotides 34% 29 Splice-site mutations outside the GT-AG dinucleotides 34% 13 Exonic mutations creating novel 5 or 3 splice sites 15% 5 Exonic mutations causing exon skipping 6 % 6 Deep-intronic mutations causing insertion of cryptic exons 9 7 %
10 Unexplained NF1 splice alterations detected by direct cdna-sequencing blood sample Short-term lymphocyte culture for RNA extraction Inhibition of illegitimate splicing Inhibition of nonsense-mediated decay DNA extraction direct cdna sequencing gdna sequencing splice-mutation end ex 4b start ex 4c start ex 5 and/or wild-type 4b 4c 5 MLPA deletion 10 mutant 4b 5 exon skipping
11 gdna sequencing of exon 4c sequencing direction exon 4c c.650_651 Alu sequence 11
12 Alu & L1 elements are still amplifying retrotransposons in the human genome ~ 6000 bp < 290 bp 12
13 13 Mechanism of retrotansposition: target primed reverse transcription (TPRT)
14 gdna sequencing shows background sequence of an Alu element within the exon sequencing direction exon 4c c.650_651 Alu sequence IVS 4b Exon 4c Exon 4c IVS 4c 50nt + ATAAATAGCCTGGA AluYa5 + (A)n TSD + 4nt target site duplication (TSD) 14
15 Improved PCR conditions to detect Alu insertions A NF1 exon 4c B short PCR product control exon 4c c.650_651 short PCR long PCR M P C W P C W M short PCR product patient 1 kb 0.5 kb long PCR product patient IVS 4b exon 4c IVS 4c wild type 50nt + ATAAATAGCCTGGA + 4nt IVS 4b exon 4c exon 4c IVS 4c mutated 50nt + ATAAATAGCCTGGA AluYa5 + (A)n TSD + 4nt 15 TSD
16 16 14 Alus introduced into NF1 gene belong to the youngest Alu families: 2x AluY, 6x AluYa5, 6x AluYb8
17 17 Identification of a full-length (~6000bp) L1 insertion in NF1 exon 30
18 Table 1: List of all Alu, L1 and poly(t) insertions uncovered in the NF1 gene No. Location Element Mutation nomenclature 1 IVS 14 (10c) Alu Y c _1642insaluy 2 IVS 10 (8) AluY c _ delinsaluy 3 E6 (4c) Alu Ya5 c.650_651insaluya5 4 E21 (16) Alu Ya5 c.2835_2836insaluya5 5 E21 (16) Alu Ya5 c.2835_2836insaluya5 6 E22 (17) Alu Ya5 c.2858_2859insaluya5 7 E33 (25) Alu Ya5 c.4319_4320insaluya5 8 E47 (38) Alu Ya5 c.6951_6952ins AluYa5 9 E12 (10a) Alu Yb8 c.1354_1355insaluyb8 10 IVS 14 (10c) Alu Yb8 c _ insaluyb8 11 E21 (16) Alu Yb8 c.2439_2440insaluyb8 12 E22 (17) Alu Yb8 c.2979_2980insaluyb8 13 E33 (25) Alu Yb8 c.4319_4320insaluyb8 14 IVS48 (39) Alu Yb8 c _7127_4insaluyb8 15 E25 (19b) poly (T) strech or: c.3312_313inst (n~120) 16 E23 (18) L1 (5'-truncated) c.3048_3049l1 17 E39 (30) L1 (full-length) c.5606_5607insl1 18 IVS9 (7) L1 (inverted) c _ ins L1 18
19 19 Splice effects of 18 Alu & L1 insertions
20 Alignment of the integration sites in NF1 Table 2: Sequences at the integration sites aligned to the L1 endonuclease cleavage consensus site Integration sites TSD Orientation Alu family NF1 location 3'AAAGAGAAAAAA TTTTTTAAGTCCGAGACGACCAAG 5' 11 sense Y I 14 (10c) 3'TTGTCGTTTATC TTTCAAATTTTTTTGTGATTCAAA 5' * - antisense Y I 10 (8) 3'GTCAATCGTCAA TATTTATCGGACCTTTTCCATTCA 5' 14 sense Ya5 E 6 (4c) 3'AGGAACCCTCAG TTTTTTGAACGACTACCATAAGAA 5' # 12 antisense Ya5 E 21 (16) 3'AGGAACCCTCAG TTTTTTGAACGACTACCATAAGAA 5' # 17 antisense Ya5 E 21 (16) 3'CCATAGTCAGTT ATTTTGGATTTCTTTCTTGTTTAT 5' 13 antisense Ya5 E 22 (17) 3'ACAAGAGAAGTG TTTTCTTCTTGTATACGCCGGAAA 5' 15 sense Ya5 E 33 (25) 3'GTCCAAAACAAG TTCTTCACGCCATGGACGACTTAT 5' 16 antisense Ya5 E 47 (38) 3'CTTTGTGAAGTA TTTCGTCACGTTCCAACACCTCGT 5' 10 sense Yb8 E 12 (10a) 3'GGACTTAAAAAA TTTTTTCTCTTTCTGTTCCGGCCC 5' 17 antisense Yb8 I 14 (10c) 3'GTAAGCGGAGAA TTGTTACCAGAACACTTCCGAAAG 5' 12 antisense Yb8 E 21 (16) 3'TTCGATCGTAAC TTTGTTACTACAATTTAGACCAGT 5' 14 sense Yb8 E 22 (17) 3'ACAAGAGAAGTG TTTTCTTCTTGTATACGCCGGAAA 5' 15 sense Yb8 E 33 (25) 3'GGACATGGGATG TTTTTTGTTTGTTTGTTTGTTTGT 5' 16 antisense Yb8 I 48 (39) 3'ACGTTAAGTTTA TTTTTGCTTTGACACAGTTAATCA 5' 16 sense L1P1_orf2 E 23 (18) 3'CATGGAAATTAA ATTTTTAGCTCCCGGTCAATGATC 5' 13 sense LINE 1 E 39 (30) 3'AATACGAATAAA TTCTTTTACCAAGTAACATCTAAG 5' 3'ACTTTAAATGAA TTCTTTATTGACACTAAACCGAAG 5' 11 6 antisense antisense L1 T (n~120) I 9 (7) E 25 (19b) AA-TTTT L1 endonuclease cleavage consensus site *This integration site cannot be unequivocally determined due to an associated 71-bp deletion and the lack of a TSD. 20
21 Distribution of Alu & L1 insertions within the NF1 gene 1 (1) 6 (4c) (7)(8)(10a) (11)(16-18)(19b) ~1500 bp 33 (25) ~ 282 kb 39 (30) 47 (38) 49 (40) 58 (49) 21
22 Summary 18 pathogenic Alu and L1 insertions: highest no. of this type of mutations identified in a single disease gene Explanation: 1) RNA-based mutation analysis protocol improves detection of Alu/L1 insertions 2) NF1 gene may be a preferred target of L1- endonuclease mediated retrotransposition 22
23 Many thanks to: Tom Callens, Anne Wernstedt, Ludwine Messiaen all doctors who referred patients all patients and their families 23 Barbara McClintock ( ) Nobel Laureate 1983
Recombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
More informationQuantitative 1-Schritt-DNA-Methylierungsanalyse aus genomischer DNA
Quantitative 1-Schritt-DNA-Methylierungsanalyse aus genomischer DNA Molekulare Diagnostik 2011 Departement Klinische Forschung Abteilung für Humangenetik Experimentelle Hämatologie DKF und Labor für Molekulare
More informationMRC-Holland MLPA. Related SALSA MLPA probemix P091 CFTR: contains probes for the CFTR gene, related to chronic pancreatitis.
SALSA MLPA probemix P242-B3 Pancreatitis Lot B3-0215. As compared to version B2 (lot B2-1212), one flanking probe has been removed and four reference probes have been replaced. Hereditary Pancreatitis
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID papillary renal cell carcinoma (translocation-associated) PRCC Human This gene
More informationAppendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
More informationIndication criteria for disease: Tuberous sclerosis (TSC) [TSC1, TSC2]
deutsche gesellschaft für humangenetik e.v. Indication Criteria for Genetic Testing Evaluation of validity and clinical utility german society of human genetics www.gfhev.de Indication criteria for disease:
More informationMRC-Holland MLPA. Description version 12; 02-12-2012
SALSA MLPA probemix P083-C1 CDH1 Lot C1-0211. As compared to previous B1 version, new in version C1: two CDH1 probes and several reference probes have been replaced/added. In addition, the 88 and 96nt
More informationChapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
More informationescience and Post-Genome Biomedical Research
escience and Post-Genome Biomedical Research Thomas L. Casavant, Adam P. DeLuca Departments of Biomedical Engineering, Electrical Engineering and Ophthalmology Coordinated Laboratory for Computational
More informationMUTATION, DNA REPAIR AND CANCER
MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful
More informationRecombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
More informationCompleteⅡ 1st strand cdna Synthesis Kit
Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:
More informationBecker Muscular Dystrophy
Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency
More informationThe world of non-coding RNA. Espen Enerly
The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often
More informationReal-time quantitative RT -PCR (Taqman)
Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR
More informationThe sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:
Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How
More informationrestriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
More informationHow many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
More informationRecombinant DNA Technology
Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium
More informationGene mutation and molecular medicine Chapter 15
Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to
More informationTools for human molecular diagnosis. Joris Vermeesch
Tools for human molecular diagnosis Joris Vermeesch Chromosome > DNA Genetic Code Effect of point mutations/polymorphisms Effect of deletions/insertions Effect of splicing mutations IVS2-2A>G Normal splice
More informationDevelopment of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples
Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples Sudhir K. Sinha, Ph.D.*, Anne H. Montgomery, M.S., Gina Pineda, M.S., and Hiromi Brown, Ph.D.
More informationPCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI,
Supplemental Text/Tables PCR Amplification and Sequencing PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Foster City, CA). Each PCR reaction contained 20 ng genomic
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationNew Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.
New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System
More informationDescription: Molecular Biology Services and DNA Sequencing
Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:
More informationData Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
More informationPrimePCR Assay Validation Report
Gene Information Gene Name sorbin and SH3 domain containing 2 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SORBS2 Human Arg and c-abl represent the mammalian
More informationSMRT Analysis v2.2.0 Overview. 1. SMRT Analysis v2.2.0. 1.1 SMRT Analysis v2.2.0 Overview. Notes:
SMRT Analysis v2.2.0 Overview 100 338 400 01 1. SMRT Analysis v2.2.0 1.1 SMRT Analysis v2.2.0 Overview Welcome to Pacific Biosciences' SMRT Analysis v2.2.0 Overview 1.2 Contents This module will introduce
More information1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
More information2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
More informationRevertAid Premium First Strand cdna Synthesis Kit
RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent
More informationA Guide to LAMP primer designing (PrimerExplorer V4)
A Guide to LAMP primer designing (PrimerExplorer V4) Eiken Chemical Co., Ltd. _ Contents Key factors in designing LAMP primers 1. The LAMP primer 2. 2 Key factors in the LAMP primer design 3. The steps
More informationLecture 3: Mutations
Lecture 3: Mutations Recall that the flow of information within a cell involves the transcription of DNA to mrna and the translation of mrna to protein. Recall also, that the flow of information between
More information***Next Generation sequencing testing options available effective April 18 th, 2016***
***Next Generation sequencing testing options available effective April 18 th, 2016*** Genetic Test Next Generation Sequencing NF1-RASopathy Panel Testing NF1-only NGS testing and copy number analysis
More informationCastillo et al. Rice Archaeogenetics electronic supplementary information
Castillo et al. Rice Archaeogenetics electronic supplementary information Figure S1: PCR amplification for the nuclear genome region Sh4; and the sequence analysis. (a) Electrophoresis of 10 PCR products
More informationIntroduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
More informationNext Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took
More informationBiotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
More informationThermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...
More informationAdvances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage
Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research March 17, 2011 Rendez-Vous Séquençage Presentation Overview Core Technology Review Sequence Enrichment Application
More informationONLINE SUPPLEMENTAL MATERIAL. Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue
ONLINE SUPPLEMENTAL MATERIAL Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue Sungmi Park 1, Ko-Ting Lu 1, Xuebo Liu 1, Tapan K. Chatterjee 2, Steven M. Rudich 3, Neal
More informationMRC-Holland MLPA. Description version 14; 03-12-2012
mix P106-B1 MRX Lot 0609. As compared to previous lots (0307, 1005 & 0405), two probes for the HUWE gene and one extra AGTR2 probe have been included. In addition, two ARX probes and one SLC6A8 probe have
More informationNext Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
More informationNOVEL FOXC2 MISSENSE MUTATION IDENTIFIED IN PATIENT WITH LYMPHEDEMA-DISTICHIASIS SYNDROME AND REVIEW
98 Lymphology 41 (2008) 98-102 NOVEL FOXC2 MISSENSE MUTATION IDENTIFIED IN PATIENT WITH LYMPHEDEMA-DISTICHIASIS SYNDROME AND REVIEW M.T. Dellinger, K. Thome, M.J. Bernas, R.P. Erickson, M.H. Witte Departments
More informationIntroduction to next-generation sequencing data
Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS
More informationTrasposable elements: P elements
Trasposable elements: P elements In 1938 Marcus Rhodes provided the first genetic description of an unstable mutation, an allele of a gene required for the production of pigment in maize. This instability
More informationLECTURE 6 Gene Mutation (Chapter 16.1-16.2)
LECTURE 6 Gene Mutation (Chapter 16.1-16.2) 1 Mutation: A permanent change in the genetic material that can be passed from parent to offspring. Mutant (genotype): An organism whose DNA differs from the
More informationBioBoot Camp Genetics
BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before
More informationBRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls?
BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? Giovanni Luca Scaglione, PhD ------------------------ Laboratory of Clinical Molecular Diagnostics and Personalized Medicine, Institute
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
More informationContents. molecular biology techniques. - Mutations in Factor II. - Mutations in MTHFR gene. - Breast cencer genes. - p53 and breast cancer
Contents Introduction: biology and medicine, two separated compartments What we need to know: - boring basics in DNA/RNA structure and overview of particular aspects of molecular biology techniques - How
More informationLocalised Sex, Contingency and Mutator Genes. Bacterial Genetics as a Metaphor for Computing Systems
Localised Sex, Contingency and Mutator Genes Bacterial Genetics as a Metaphor for Computing Systems Outline Living Systems as metaphors Evolutionary mechanisms Mutation Sex and Localized sex Contingent
More informationTargeted. sequencing solutions. Accurate, scalable, fast TARGETED
Targeted TARGETED Sequencing sequencing solutions Accurate, scalable, fast Sequencing for every lab, every budget, every application Ion Torrent semiconductor sequencing Ion Torrent technology has pioneered
More informationChapter 5: Organization and Expression of Immunoglobulin Genes
Chapter 5: Organization and Expression of Immunoglobulin Genes I. Genetic Model Compatible with Ig Structure A. Two models for Ab structure diversity 1. Germ-line theory: maintained that the genome contributed
More informationGenomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011
Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)
More informationHuman Genome and Human Genome Project. Louxin Zhang
Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular
More informationHow To Understand How Gene Expression Is Regulated
What makes cells different from each other? How do cells respond to information from environment? Regulation of: - Transcription - prokaryotes - eukaryotes - mrna splicing - mrna localisation and translation
More informationGene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook)
Name Date Per Look at the diagrams, then answer the questions. Gene Mutations affect a single gene by changing its base sequence, resulting in an incorrect, or nonfunctional, protein being made. (a) A
More informationIntroduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov
More informationAP BIOLOGY 2010 SCORING GUIDELINES (Form B)
AP BIOLOGY 2010 SCORING GUIDELINES (Form B) Question 2 Certain human genetic conditions, such as sickle cell anemia, result from single base-pair mutations in DNA. (a) Explain how a single base-pair mutation
More informationREAL TIME PCR USING SYBR GREEN
REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM
More informationThe Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics
The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long
More informationSickle cell anemia: Altered beta chain Single AA change (#6 Glu to Val) Consequence: Protein polymerizes Change in RBC shape ---> phenotypes
Protein Structure Polypeptide: Protein: Therefore: Example: Single chain of amino acids 1 or more polypeptide chains All polypeptides are proteins Some proteins contain >1 polypeptide Hemoglobin (O 2 binding
More informationDesign of conditional gene targeting vectors - a recombineering approach
Recombineering protocol #4 Design of conditional gene targeting vectors - a recombineering approach Søren Warming, Ph.D. The purpose of this protocol is to help you in the gene targeting vector design
More informationab185916 Hi-Fi cdna Synthesis Kit
ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1
More informationSeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications
Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each
More informationPreciseTM Whitepaper
Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis
More informationPolymorphism of retrotransposons in Bos taurus
Polymorphism of retrotransposons in Bos taurus Bernt Guldbrandtsen Goutam Sahana Mogens Sandø Lund Center for Quantitative Genetics and Genomics Aarhus University Denmark Transposons Type of jumping genes
More informationSTUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS
STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS THESIS SUBMITTED FOR THE DEGREB OF DOCTOR OF PHILOSOPHY (SCIENCE) OF THE UNIVERSITY OF CALCUTTA 1996 NRISINHA DE, M.Sc DEPARTMENT OF BIOCHEMISTRY
More informationValidation parameters: An introduction to measures of
Validation parameters: An introduction to measures of test accuracy Types of tests All tests are fundamentally quantitative Sometimes we use the quantitative result directly However, it is often necessary
More informationSpeed Matters - Fast ways from template to result
qpcr Symposium 2007 - Weihenstephan Speed Matters - Fast ways from template to result March 28, 2007 Dr. Thorsten Traeger Senior Scientist, Research and Development - 1 - Overview Ạgenda Fast PCR The Challenges
More informationA complete workflow for pharmacogenomics using the QuantStudio 12K Flex Real-Time
Application NOte QuantStudio 12K Flex Real-Time PCR System A complete workflow for pharmacogenomics using the QuantStudio 12K Flex Real-Time PCR System Introduction Pharmacogenomics (PGx) is the study
More informationPyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)
PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608)
More informationFinal Project Report
CPSC545 by Introduction to Data Mining Prof. Martin Schultz & Prof. Mark Gerstein Student Name: Yu Kor Hugo Lam Student ID : 904907866 Due Date : May 7, 2007 Introduction Final Project Report Pseudogenes
More informationTroubleshooting the Single-step PCR Site-directed Mutagenesis Procedure Intended to Create a Non-functional rop Gene in the pbr322 Plasmid
Troubleshooting the Single-step PCR Site-directed Mutagenesis Procedure Intended to Create a Non-functional rop Gene in the pbr322 Plasmid Lina Jew Department of Microbiology & Immunology, University of
More informationReliable PCR Components for Molecular Diagnostic Assays
Reliable PCR Components for Molecular Diagnostic Assays Terri McDonnell, MBA, PMP Senior Program Manager, Molecular Diagnostics March 2014 In this webinar we will: Discuss requirements for amplification
More informationBiological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
More informationSpecial report. Chronic Lymphocytic Leukemia (CLL) Genomic Biology 3020 April 20, 2006
Special report Chronic Lymphocytic Leukemia (CLL) Genomic Biology 3020 April 20, 2006 Gene And Protein The gene that causes the mutation is CCND1 and the protein NP_444284 The mutation deals with the cell
More informationAutomated DNA sequencing 20/12/2009. Next Generation Sequencing
DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing
More informationRecombinant DNA Technology
Recombinant DNA Technology Stephen B. Gruber, MD, PhD Division of Molecular Medicine and Genetics November 4, 2002 Learning Objectives Know the basics of gene structure, function and regulation. Be familiar
More informationRT-PCR: Two-Step Protocol
RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed
More informationMRC-Holland MLPA. Description version 24; 23-11-2011
SALSA MS-MLPA probemix ME030-C1 BWS/RSS Lot C1-0711. As compared to version B2 (lots B2-0309, B2-1109 & B2-1110), three probes for H19 and two for KCNQ1 have been replaced. One H19 has been removed and
More informationBreast cancer and the role of low penetrance alleles: a focus on ATM gene
Modena 18-19 novembre 2010 Breast cancer and the role of low penetrance alleles: a focus on ATM gene Dr. Laura La Paglia Breast Cancer genetic Other BC susceptibility genes TP53 PTEN STK11 CHEK2 BRCA1
More informationGene Expression Assays
APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency
More informationUser Manual. Reference Gene Panel Mouse Probe protocol. Version 1.1 August 2014 For use in quantitative real-time PCR
User Manual Reference Gene Panel Mouse Probe protocol Version 1.1 August 2014 For use in quantitative real-time PCR Reference Gene Panel Mouse Table of contents Background 4 Assays included in the panel
More informationTable of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3
Table of Contents I. Description... 2 II. Kit Components... 2 III. Storage... 2 IV. 1st Strand cdna Synthesis Reaction... 3 V. RT-PCR, Real-time RT-PCR... 4 VI. Application... 5 VII. Preparation of RNA
More informationFocusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
More informationIntroduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
More informationTest Information Sheet
Test Information Sheet GeneDx 207 Perry Parkway Gaithersburg, MD 20877 Phone: 888-729-1206 Fax: 301-710-6594 E-mail: wecare@genedx.com www.genedx.com/oncology OncoGene Dx: High/Moderate Risk Panel Sequence
More informationLecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
More informationMir-X mirna First-Strand Synthesis Kit User Manual
User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.
More informationUser Manual Mouse Endogenous Control Gene Panel
User Manual Mouse Endogenous Control Gene Panel Version 1.5 March 2008 For use in quantitative real-time PCR Mouse Endogenous Control Gene Panel Table of contents Background 4 Contents 4 Additionally required
More informationMicroarray Data Analysis Workshop. Custom arrays and Probe design Probe design in a pangenomic world. Carsten Friis. MedVetNet Workshop, DTU 2008
Microarray Data Analysis Workshop MedVetNet Workshop, DTU 2008 Custom arrays and Probe design Probe design in a pangenomic world Carsten Friis Media glna tnra GlnA TnrA C2 glnr C3 C5 C6 K GlnR C1 C4 C7
More informationIntended Use: The kit is designed to detect the 5 different mutations found in Asian population using seven different primers.
Unzipping Genes MBPCR014 Beta-Thalassemia Detection Kit P r o d u c t I n f o r m a t i o n Description: Thalassemia is a group of genetic disorders characterized by quantitative defects in globin chain
More informationJune 09, 2009 Random Mutagenesis
Why Mutagenesis? Analysis of protein function June 09, 2009 Random Mutagenesis Analysis of protein structure Protein engineering Analysis of structure-function relationship Analysis of the catalytic center
More informationHistory of DNA Sequencing & Current Applications
History of DNA Sequencing & Current Applications Christopher McLeod President & CEO, 454 Life Sciences, A Roche Company IMPORTANT NOTICE Intended Use Unless explicitly stated otherwise, all Roche Applied
More informationDiscovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat
Bioinformatique et Séquençage Haut Débit, Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat 1 RNA Transcription to RNA and subsequent
More informationSingle-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples
DATA Sheet Single-Cell DNA Sequencing with the C 1 Single-Cell Auto Prep System Reveal hidden populations and genetic diversity within complex samples Single-cell sensitivity Discover and detect SNPs,
More informationPROYECTO GENOMA HUMANO. Medicina Molecular 2011 Maestría en Biología Molecular Médica- UBA
PROYECTO GENOMA HUMANO Medicina Molecular 2011 Maestría en Biología Molecular Médica- UBA GENOMA HUMANO Medicina Molecular 2011 Maestría en Biología Molecular Médica- UBA Some landmarks on the way to 1940s
More information