Molecular Diagnostics in the Clinical Microbiology Laboratory

Size: px
Start display at page:

Download "Molecular Diagnostics in the Clinical Microbiology Laboratory"

Transcription

1 Molecular Diagnostics in the Clinical Microbiology Laboratory Patrick Tang, MD, PhD, FRCPC B.C. Centre for Disease Control University of British Columbia

2 Molecular Diagnostics in the Clinical Microbiology Laboratory Introduction to molecular microbiology Overview of PCR Molecular genotyping methods

3 Traditional Microbiology Microscopy Culture Serology PCR

4 Detection of Organism Microscopy Culture Antigens Nucleic Acids

5 Detection of Host Response Serology (Host Immune Response)

6 Detection of Host Response (Future) Metabolomics Gene Expression

7 Nucleic Acid Detection Detection of organism-specific DNA or RNA Must know the sequence of the target region ATGATTTCGAGAACGGGACCTATTGCTAGTTGCGTACATGCTCTTCGAGTCACTGGCT Non-amplified Nucleic Acid Probe labelled DNA or RNA probe (enzyme, fluorescence, etc.) Signal Amplification increase concentration of labeled molecules attached to target Target Amplification enzyme-mediated synthesis of copies of the target nucleic acid Probe Amplification amplification products generated only from probes, not from target

8 Non-Amplified Nucleic Acid Probe Liquid-phase hybridization protection assay e.g., Gen-Probe Single-stranded DNA probe labeled with acridinium ester is added to sample If the probe binds to its complementary target sequence, the acridinium ester is protected from alkaline hydrolysis otherwise, acridinium ester will be hydrolyzed Acridinium ester emits light upon addition of peroxides DNA probe target sequence

9 Signal Amplification Branched DNA (Bayer) sandwich hybridization assay with multiple sets of probes bdna has 15 identical branches, each can bind 3 labeled probes bdna target sequence enzyme-labeled probes microwell with capture probes target probes capture probes Hybrid capture assay (Digene) target DNA is hybridized to RNA probe DNA:RNA hybrids are captured by immobilized antibodies soluble enzyme-conjugated antibodies then bind to the hybrids tube with capture antibodies enzyme-conjugated antibody RNA probe target DNA

10 Target Amplification Polymerase Chain Reaction (PCR) reverse transcriptase PCR (RT-PCR) nested PCR multiplex PCR real-time PCR (qpcr) Transcription-mediated amplification (TMA) / Nucleic acid sequence-based amplification (NASBA) isothermic amplification of RNA target Strand displacement amplification (SDA) isothermic amplification of DNA or RNA target

11 Polymerase Chain Reaction 95 C denaturation 72 C primer extension 50 C primer annealing 95 C 50 C 72 C exponential amplification 5 3

12 Probe Amplification Ligase Chain Reaction employs two sets of labeled probes that bind to adjacent target regions ligase enzyme joins the two contiguous probes into a linear product that can be captured and detected biotinylated probe 1 enzyme-labeled probe 2 ligase target DNA ligated probe streptavidin matrix

13 Probe Amplification Multiplex Ligation-dependent Probe Amplification employs two probes that bind to adjacent target regions one probe contains forward primer site, other probe contains reverse primer site multiple sets of probes bind to different targets each probe set has a different length linker region ligase enzyme joins the contiguous probes PCR with the forward and reverse primers is used to generate amplicons of variable length corresponding to each target probe A1 probe A2 probe B1 probe B2 target A target B

14 Polymerase Chain Reaction DNA Extraction Polymerase Chain Reaction Thermal cycling Components Primers Controls Detection of PCR amplicons Amplicon Contamination

15 DNA Extraction Sample homogenization tissues, viscous fluids, formalin-fixed tissue Mechanical lysis boiling, sonication, freeze/thaw, mortar/pestle Enzymatic lysis proteinase K Chemical lysis detergents guanidinium thiocyanate +/- phenol/chloroform DNA precipitation ethanol, isopropanol adsorption to silica matrix columns, silica beads/resin, silica-coated magnetic beads

16 Selecting a Method of Extraction Automated versus manual extraction cost per extraction, cost of equipment ease of use, hands-on time, turn-around time throughput (number of samples per run) Type of specimens being extracted Volume (mass) of specimen being extracted Efficiency of DNA recovery Quality of extracted DNA Extraction of DNA and/or RNA

17 Polymerase Chain Reaction

18 Stages of PCR Denaturation (90-95 C) separate the two strands in double stranded DNA Annealing (50-55 C) temperature depends upon primers Extension (65-72 C) depends upon enzyme and size of targeted region Final extension (65-72 C) fill in partially completed PCR products Cooling (4-10 C) keep cold to maintain DNA amplicons

19 PCR Thermal Cycling Temperature denaturation extension annealing

20 PCR Target Amplification

21 Choosing a Thermal Cycler Ramp rate rate of heating and cooling Temperature stability Block uniformity Single temperature or gradient Capacity Compatibility with PCR tubes and plates Cost Conventional or real-time PCR

22 PCR Reaction Components Master mix (typically µl) Target (DNA/RNA) typically 5-10% of total volume Polymerase Primers (~0.2 µm) Nucleotides dntps ( µm) KCl ( 50 mm) salts affect stability of dsdna stringency of reaction Mg 2+ (0.5 to 2.5 mm greater than [dntp]) binds to DNA and dntp required for activity of polymerase Buffer Water Available as commercial pre-mixes just add water, primers and sample

23 PCR Primers Proper PCR primer design is crucial in the success of the assay requires access to database of sequences sensitivity, specificity Typically 20bp and 50-60% GC content GC clamp at 3 end of primer too many G and C at 3 end may lead to mispriming Typical melting temperature (Tm) C Must pick sequences to avoid: self dimerization secondary structures (hairpins) dimerization with other primer

24 Degenerate Primers Mix of primers with variable bases at one or more sites GCATCTATATAACGTACGT GCATCTATATAACGTCCGT GCATCTATATAACGTGCGT Inosine can be used as a base instead universal base (found in trna) more expensive

25 Controls for PCR Positive control (low titer) ensure reagents were added and working properly Negative control(s) detect amplicon contamination, non-specific amplification Extraction control ensure that DNA was efficiently extracted Internal positive control ensure that amplification is occurring in each sample i.e., no PCR inhibitors are present in sample

26 Variations of PCR Reverse-transcriptase PCR (RT-PCR) use reverse transcriptase to convert RNA to cdna other steps are identical to regular PCR Nested PCR amplify a larger target region in first PCR reaction amplify a sub-region of the initial target in second PCR Multiplex PCR detect multiple targets in a single reaction multiple sets of primers Real-time PCR (rt-pcr or qpcr) real-time PCR can be quantitative

27 Detection of PCR product Agarose gel electrophoresis Polyacrylamide gel electrophoresis DNA separated by size Visualized with intercalating dye Ethidium bromide SYBR green

28 Agarose Gel Electrophoresis - larger fragments slower migration + smaller fragments faster migration

29 water PCR control weak pos PCR control strong pos PCR control water extraction control neg extraction control pos extraction control

30 PCR Contamination PCR clean room/area vs. dirty area one-way flow of samples amplicons from previous PCR reactions highly positive samples or controls laminar flow hood gloves filtered pipette tips change lab coats careful technique open one tube at a time, avoid aerosols bleach, high concentration NaOH, ultraviolet, commercial products uracil N-glycosylase use dutp instead of dttp in PCR reactions

31 Conventional PCR vs. Real-Time PCR Real-time PCR detection of amplification during exponential and linear phase measure amount of PCR product at each PCR cycle Conventional PCR detection of amplification with ethidium bromide when reaction complete results are not quantifiable because of variability of the endpoint yield of PCR product

32 Amplification Plot Fluorescence Cycle Number C t (cycle threshold)

33 Intercalating Dyes SYBR Green, SYBR Gold, Yo-Yo-1, Yo-Pro-1 Dye binds to double stranded DNA once extension is complete Only fluorescent when bound to the dsdna

34 SYBR Green PCR Standard PCR reaction with SYBR Green added to detect total DNA amplification

35 Melting Curve Analysis Different sizes of DNA molecules melt at a different temperatures Melting curves are needed to confirm amplification of desired DNA target

36 SYBR Green Disadvantages Binds to all the double stranded DNA in the reaction including non-specific amplification products and primer-dimers Melt-curve analysis is required to resolve amplification products Real-time (quantitative) PCR reactions that use non-specific dyes must be VERY well optimized to give good results

37 DNA Probes 5 exonuclease probes (TaqMan) Molecular beacons Hybridizes to specific region of PCR product Based on the principle of fluorescent resonant energy transfer (FRET)

38 Fluorescent Resonant Energy Transfer (FRET) distance-dependent interaction between the electronic excited states of two dye molecules in which excitation is transferred from a donor molecule to an acceptor molecule

39 Anatomy of a TaqMan Probe Fluorescent reporter dye (donor) R Quencher molecule (acceptor) Q Target-specific single stranded DNA (13-24 base pairs in length)

40 Polymerization Primers and probe anneal to target DNA 5 3 Forward Primer R TaqMan Probe Q 5 5 Reverse Primer 3 5

41 Displacement Taq polymerase displaces the probe strand Forward Primer R Q Reverse Primer 5 3 5

42 Cleavage 5 exonuclease activity of Taq polymerase cleaves reporter molecule R Q 5 3 5

43 Polymerization Completed R Q

44 Molecular Beacons Target specific DNA in loop Probe forms hairpin loop when not hybridized to template Reporter and quencher in proximity when loop closed Hybridized to template Hairpin loop Melted Annealing exactly to correct template favored over stemloop formation

45 Quantitative PCR There is a quantitative relationship between the amount of target nucleic acid present at the start of PCR and the amount of product amplified during its exponential (geometric) phase Exponential phase Threshold Baseline

46 Relationship Between Initial Copy Number and Cycle Number Cycle number Threshold Copy No

47 Advantages of real-time PCR Faster than conventional PCR Faster cycling and no need to run samples on agarose gels Higher analytical sensitivity Detection limit at 1-10 copies versus copies Results available during testing/thermocycling Reduced chance for PCR contamination Closed system

48 Molecular Typing Methods

49 Laboratory Methods for Epidemiological Analysis of Microorganisms Biotyping (Phenotyping) Biochemicals Assimilation of different biochemicals Can combine with antibiotic susceptibility profile Serotyping Recognition by type-specific antibodies Phage typing Susceptibility to different bacteriophage Multilocus enzyme electrophoresis (MLEE) Compare electrophoretic mobility of a set of proteins

50 Laboratory Methods for Epidemiological Analysis of Microorganisms Genotyping Restriction fragment-length polymorphism (RFLP) Pulsed-field gel electrophoresis (PFGE) Random amplification of polymorphic DNA (RAPD) Amplified fragment length polymorphism (AFLP) Variable number of tandem repeats (VNTR) Multilocus sequence typing (MLST) Single nucleotide polymorphism (SNP) typing Microarray typing Whole genome sequencing

51 RFLP 1. AMPLIFY ORGANISM 3. RUN GEL FRAGMENT GENOME 3 Restriction Endonucleases 1 2

52 IS6110-based RFLP for Genotyping of Mycobacterium tuberculosis

53 PFGE Restriction enzyme Voltage gradient Switch interval Reorientation angle Agarose content of gel Temperature Run time A- B+ B- A+

54 PFGE of Shigella flexneri (BlnI)

55 RAPD 1. AMPLIFY GENOME 3 Short Primers GENERATE PCR FRAGMENTS RUN GEL 1 2 3

56 AFLP 1. FRAGMENT GENOME 2. LIGATE ADAPTERS 3. PCR 3 Restriction Endonucleases Adapters RUN GEL 1 2 Primers 3

57 Laboratory Methods for Epidemiological Analysis of Microorganisms Restriction fragment-length polymorphism (RFLP) Amplify DNA by culturing the organism Restriction endonuclease digestion of DNA into small pieces Resolve DNA fragments on agarose gel Pulsed-field gel electrophoresis (PFGE) PFGE is a type of RFLP DNA is cut into large fragments that can only be resolved using pulsedfield gel apparatus Random amplification of polymorphic DNA (RAPD) A defined set of short primers are used to PCR amplify the genomic DNA The short primers bind at multiple locations creating a band pattern when resolved by agarose gel electrophoresis Amplified fragment-length polymorphism (AFLP) Restriction digest DNA first Amplify by PCR and resolve with gel electrophoresis

58 VNTR 1. AMPLIFY TARGET REGIONS different PCR reactions 2. GENERATE PCR FRAGMENTS 1 2 Determine number of tandem repeats 3 3. CAPILLARY ELECTROPHORESIS 5 VNTR pattern =

59 MLST 1. AMPLIFY MULTIPLE LOCI 2. GENERATE PCR FRAGMENTS different PCR reactions 3. DNA SEQUENCING ATCGTTAGGAAGCAT TTACAACCAGTAGCACCC GAGCTTACCAATCGGAC 1 2 3

60 SNP Genotyping DETERMINE MULTIPLE LOCI T G A 1. qpcr 2. PYROSEQUENCING 3. MICROARRAY A T A C G C P SNP1 = T SNP2 = G SNP3 = A G A A T C

61 Microarray Genotyping Oligonucleotide probes targeting different regions of the genome different alleles of the same gene different SNPs unique genes A1 A2 A3 A4 A5 A6 A7 B1 B2 B3 B4 B5 B6 B7 C1 C2 C3 C4 D1 D2 D3 E1 E2 E3 F G1 G2 G3 H1 H2 I J1 J2 K L

62 Microarray Genotyping Isolate No.1 A1 A2 A3 A4 A5 A6 A7 B1 B2 B3 B4 B5 B6 B7 C1 C2 C3 C4 D1 D2 D3 Isolate No.2 A1 A2 A3 A4 A5 A6 A7 B1 B2 B3 B4 B5 B6 B7 C1 C2 C3 C4 D1 D2 D3 E1 E2 E3 F G1 G2 G3 E1 E2 E3 F G1 G2 G3 H1 H2 I J1 J2 K L H1 H2 I J1 J2 K L Isolates 1 and 2 are related but not identical

63 Laboratory Methods for Epidemiological Analysis of Microorganisms Variable number of tandem repeats (VNTR) PCR amplify genetic regions containing tandem repeats Electrophoresis to resolve size of PCR products Multilocus sequence typing (MLST) Sequence a defined set of loci within the genome Single nucleotide polymorphism (SNP) typing Determine the SNP at a set of defined positions in the genome by PCR, sequencing or microarray Microarray typing Determine presence or absence of a defined set of markers within the genome

64 Laboratory Methods for Epidemiological Analysis of Microorganisms Whole genome sequencing Fragment genome into smaller overlapping pieces PCR, restriction digest, sonication, etc. Sequence fragments Assemble contigs Bioinformatics analysis Whole genome alignments Detection of mutations Genomic islands Insertions/deletions Point mutations, SNPs

65 Phylogenetics Compare the genetic relatedness between organisms Distance-based methods are used to create trees which approximate phylogenetic relationships Based on genotyping data RFLP, MLST, etc.

66 The End

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR Roche Applied Science Technical Note No. LC 18/2004 Purpose of this Note Assay Formats for Use in Real-Time PCR The LightCycler Instrument uses several detection channels to monitor the amplification of

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

Real-Time PCR Vs. Traditional PCR

Real-Time PCR Vs. Traditional PCR Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives

More information

Essentials of Real Time PCR. About Sequence Detection Chemistries

Essentials of Real Time PCR. About Sequence Detection Chemistries Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected

More information

VLLM0421c Medical Microbiology I, practical sessions. Protocol to topic J10

VLLM0421c Medical Microbiology I, practical sessions. Protocol to topic J10 Topic J10+11: Molecular-biological methods + Clinical virology I (hepatitis A, B & C, HIV) To study: PCR, ELISA, your own notes from serology reactions Task J10/1: DNA isolation of the etiological agent

More information

BIOTECHNOLOGY. What can we do with DNA?

BIOTECHNOLOGY. What can we do with DNA? BIOTECHNOLOGY What can we do with DNA? Biotechnology Manipulation of biological organisms or their components for research and industrial purpose Usually manipulate DNA itself How to study individual gene?

More information

Protocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR

Protocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR Protocol Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR Copyright 2008, 2010 Applied Biosystems. All rights reserved. Ambion and Applied Biosystems products are for Research Use Only.

More information

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot Recombinant technology Gene analysis Sequencing PCR RNA Northern-blot RT PCR Protein Western-blot Sequencing Southern-blot in situ hybridization in situ hybridization Function analysis Histochemical analysis

More information

Co Extra (GM and non GM supply chains: Their CO EXistence and TRAceability) Outcomes of Co Extra

Co Extra (GM and non GM supply chains: Their CO EXistence and TRAceability) Outcomes of Co Extra GM and non GM supply chains: Their CO EXistence and TRAceability Outcomes of Co Extra Comparison of different real time PCR chemistries and their suitability for detection and quantification of genetically

More information

Optimizing Real Time PCR: A Focused Approach for Exceptional Real-Time qpcr Results

Optimizing Real Time PCR: A Focused Approach for Exceptional Real-Time qpcr Results Optimizing Real Time PCR: A Focused Approach for Exceptional Real-Time qpcr Results Michael Wakem M.Sc Bio-Rad Laboratories Canada Ltd (800) 268-0213 Ext 3360 michael_wakem@bio-rad.com Overview Fundamentals

More information

DNA Sequence Analysis

DNA Sequence Analysis DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide

More information

The Techniques of Molecular Biology: Forensic DNA Fingerprinting

The Techniques of Molecular Biology: Forensic DNA Fingerprinting Revised Fall 2011 The Techniques of Molecular Biology: Forensic DNA Fingerprinting The techniques of molecular biology are used to manipulate the structure and function of molecules such as DNA and proteins

More information

PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)

PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608)

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

Nucleic Acid Techniques in Bacterial Systematics

Nucleic Acid Techniques in Bacterial Systematics Nucleic Acid Techniques in Bacterial Systematics Edited by Erko Stackebrandt Department of Microbiology University of Queensland St Lucia, Australia and Michael Goodfellow Department of Microbiology University

More information

GENOTYPING ASSAYS AT ZIRC

GENOTYPING ASSAYS AT ZIRC GENOTYPING ASSAYS AT ZIRC A. READ THIS FIRST - DISCLAIMER Dear ZIRC user, We now provide detailed genotyping protocols for a number of zebrafish lines distributed by ZIRC. These protocols were developed

More information

Methods and Application Guide. Introduction to Quantitative PCR

Methods and Application Guide. Introduction to Quantitative PCR Methods and Application Guide Introduction to Quantitative PCR Introduction to Quantitative PCR Methods and Application Guide Stratagene USA and Canada Order: 800-424-5444 x3 Technical Services: 800-894-1304

More information

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

Introduction to Quantitative PCR

Introduction to Quantitative PCR Introduction to Quantitative PCR Methods and Applications Guide Introduction to Quantitative PCR Methods and Applications Guide IN 70200 D US and Canada Orders: 800-227-9770 x3 Technical Service: 800-227-9770

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

Application Note. Biotechnology Explorer Crime Scene Investigator PCR Basics. Kit: A Real-Time PCR Extension

Application Note. Biotechnology Explorer Crime Scene Investigator PCR Basics. Kit: A Real-Time PCR Extension Biotechnology Explorer Crime Scene Investigator PCR Basics Kit: Table of Contents Introduction.............................................. 2 Learning Objectives......................................

More information

Applications Guide. Real-Time PCR Applications Guide

Applications Guide. Real-Time PCR Applications Guide Applications Guide Real-Time PCR Applications Guide table of contents Table of Contents 1. Overview of Real-Time PCR 2 1.1 Key Concepts of Real-Time PCR 2 1.1.1 What Is Real-Time PCR? 2 1.1.2 How Real-Time

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

Chapter 20: Biotechnology: DNA Technology & Genomics

Chapter 20: Biotechnology: DNA Technology & Genomics Biotechnology Chapter 20: Biotechnology: DNA Technology & Genomics The BIG Questions How can we use our knowledge of DNA to: o Diagnose disease or defect? o Cure disease or defect? o Change/improve organisms?

More information

Realtime PCR Master Mix

Realtime PCR Master Mix Instruction manual Realtime PCR Master Mix 0810 F0923K Realtime PCR Master Mix Contents [1] Introduction [2] Components [3] Primer/Probe design [4] Detection [5] Specimens [6] Protocol 1. TaqMan assay

More information

ab185916 Hi-Fi cdna Synthesis Kit

ab185916 Hi-Fi cdna Synthesis Kit ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1

More information

SYBR Green Realtime PCR Master Mix -Plus-

SYBR Green Realtime PCR Master Mix -Plus- Instruction manual SYBR Green Realtime PCR Master Mix -Plus- 0810 F0925K SYBR Green Realtime PCR Master Mix -Plus- Contents QPK-212T 1mLx1 QPK-212 1mLx5 Store at -20 C, protected from light [1] Introduction

More information

Application Guide... 2

Application Guide... 2 Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied

More information

RevertAid Premium First Strand cdna Synthesis Kit

RevertAid Premium First Strand cdna Synthesis Kit RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent

More information

Real-time PCR handbook

Real-time PCR handbook Real-time PCR handbook Single-tube assays 96- and 384-well plates 384-well TaqMan Array cards OpenArray plates The image on this cover is of an OpenArray plate which is primarily used for mid-density real-time

More information

QPCR Applications using Stratagene s Mx Real-Time PCR Platform

QPCR Applications using Stratagene s Mx Real-Time PCR Platform QPCR Applications using Stratagene s Mx Real-Time PCR Platform Dan Schoeffner, Ph.D Field Applications Scientist Dan.Schoeffner@Stratagene.com Tech. Services 800-894-1304 Polymerase Chain Reaction Melt

More information

Validating Microarray Data Using RT 2 Real-Time PCR Products

Validating Microarray Data Using RT 2 Real-Time PCR Products Validating Microarray Data Using RT 2 Real-Time PCR Products Introduction: Real-time PCR monitors the amount of amplicon as the reaction occurs. Usually, the amount of product is directly related to the

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information

DNA Sequencing Dr. Serageldeen A. A. Sultan

DNA Sequencing Dr. Serageldeen A. A. Sultan DNA Sequencing Dr. Serageldeen A. A. Sultan PhD in Molecular virology Yamaguchi University, Japan (2010) Lecturer of virology Dept. of Microbiology SVU, Qena, Egypt seaas@lycos.com What is DNA sequencing?

More information

PrimeSTAR HS DNA Polymerase

PrimeSTAR HS DNA Polymerase Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction

More information

Reagent Guide. Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems

Reagent Guide. Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems Reagent Guide Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems Reagent Guide Copyright 2008, 2010 Applied Biosystems. All

More information

BacReady TM Multiplex PCR System

BacReady TM Multiplex PCR System BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental

More information

Identification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes

Identification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes Identification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes 1. Aim and field of application The present method concerns the identification

More information

DNA: A Person s Ultimate Fingerprint

DNA: A Person s Ultimate Fingerprint A partnership between the UAB Center for Community Outreach Development and McWane Center DNA: A Person s Ultimate Fingerprint This project is supported by a Science Education Partnership Award (SEPA)

More information

PCR & DNA Sequencing. PCR= Polymerase Chain Reaction. PCR applications

PCR & DNA Sequencing. PCR= Polymerase Chain Reaction. PCR applications PCR= Polymerase Chain Reaction PCR & DNA Sequencing Biology 224 Instructor: Tom Peavy March 20, 2006 DNA photocopier integral tool for molecular biologists work horse versatile (many applications) not

More information

Hepatitis B Virus Genemer Mix

Hepatitis B Virus Genemer Mix Product Manual Hepatitis B Virus Genemer Mix Primer Pair for amplification of HBV Specific DNA Fragment Includes Internal Negative Control Primers and Template Catalog No.: 60-2007-12 Store at 20 o C For

More information

American Society of Cytopathology Core Curriculum in Molecular Biology

American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology Chapter 4 Laboratory Operations Designing Molecular Laboratories

More information

Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011

Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011 Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)

More information

PCR Polymerase Chain Reaction

PCR Polymerase Chain Reaction Biological Sciences Initiative HHMI PCR Polymerase Chain Reaction PCR is an extremely powerful technique used to amplify any specific piece of DNA of interest. The DNA of interest is selectively amplified

More information

1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.

1. Molecular computation uses molecules to represent information and molecular processes to implement information processing. Chapter IV Molecular Computation These lecture notes are exclusively for the use of students in Prof. MacLennan s Unconventional Computation course. c 2013, B. J. MacLennan, EECS, University of Tennessee,

More information

T08-003A. Figure 1: The Results Editor home screen.

T08-003A. Figure 1: The Results Editor home screen. Technical Note Dissociation Curve Analysis T08-003A General Introduction to Data Analysis The aim of this Technical Note is to explain the principle of dissociation curve analysis and to guide you through

More information

Speed Matters - Fast ways from template to result

Speed Matters - Fast ways from template to result qpcr Symposium 2007 - Weihenstephan Speed Matters - Fast ways from template to result March 28, 2007 Dr. Thorsten Traeger Senior Scientist, Research and Development - 1 - Overview Ạgenda Fast PCR The Challenges

More information

TaqMan Fast Advanced Master Mix. Protocol

TaqMan Fast Advanced Master Mix. Protocol TaqMan Fast Advanced Master Mix Protocol For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice. APPLIED

More information

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites.

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites. 1. A recombinant DNA molecules is one that is a. produced through the process of crossing over that occurs in meiosis b. constructed from DNA from different sources c. constructed from novel combinations

More information

Fluorescent dyes for use with the

Fluorescent dyes for use with the Detection of Multiple Reporter Dyes in Real-time, On-line PCR Analysis with the LightCycler System Gregor Sagner, Cornelia Goldstein, and Rob van Miltenburg Roche Molecular Biochemicals, Penzberg, Germany

More information

Welcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation.

Welcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation. Introduction to SMRTbell Template Preparation 100 338 500 01 1. SMRTbell Template Preparation 1.1 Introduction to SMRTbell Template Preparation Welcome to Pacific Biosciences' Introduction to SMRTbell

More information

CompleteⅡ 1st strand cdna Synthesis Kit

CompleteⅡ 1st strand cdna Synthesis Kit Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:

More information

RT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl

RT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl Components RT31-020 20 rxns RT31-050 50 rxns RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl 2x RT Master Mix (2) 200 µl 2 x 250 µl 5 x 200 µl RNase H (E. coli) 20 µl 2 x 25 µl

More information

GoTaq Amplification Maximum performance, flexibility, control and convenience

GoTaq Amplification Maximum performance, flexibility, control and convenience GoTaq Amplification Maximum performance, flexibility, control and convenience GoTaq products and formulations designed to improve your amplification needs Reverse Transcription GoScript Reverse Transcriptase

More information

PCR Optimization: Reaction Conditions and Components Sample Volume and Reaction Tubes Vapor Barrier and Thermal Transfer Fluid Template DNA or RNA

PCR Optimization: Reaction Conditions and Components Sample Volume and Reaction Tubes Vapor Barrier and Thermal Transfer Fluid Template DNA or RNA PCR Optimization: Reaction Conditions and Components The GeneAmp PCR process is widely employed in a tremendous variety of experimental applications to produce high yields of specific DNA target sequences.

More information

qpcr Technical Guide Detection Methods Primer and Probe Design Instrumentation Applications Guide

qpcr Technical Guide Detection Methods Primer and Probe Design Instrumentation Applications Guide qpcr Technical Guide Detection Methods Primer and Probe Design Instrumentation Applications Guide Table of Contents qpcr Technical Guide Introduction... 1 Quantitative PCR: How does it work?... 2 qpcr

More information

Real-Time PCR UNIT 10.3 OVERVIEW AND PRINCIPLES

Real-Time PCR UNIT 10.3 OVERVIEW AND PRINCIPLES UNIT.3 Real-Time PCR Dean Fraga, 1 Tea Meulia, 2 and Steven Fenster 3 1 College of Wooster, Wooster, Ohio 2 Ohio Agricultural Research and Development Center, Wooster, Ohio 3 Ashland University, Ashland,

More information

Protocols. Internal transcribed spacer region (ITS) region. Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013)

Protocols. Internal transcribed spacer region (ITS) region. Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013) Protocols Internal transcribed spacer region (ITS) region Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013) The nuclear ribosomal RNA (rrna) genes (small subunit, large subunit and 5.8S) are

More information

All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna

All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One TM mirna First-Strand cdna Synthesis Kit AMRT-0020 (20 RT reactions), AMRT-0060 (60 RT reactions) Used in combination

More information

Troubleshooting Sequencing Data

Troubleshooting Sequencing Data Troubleshooting Sequencing Data Troubleshooting Sequencing Data No recognizable sequence (see page 7-10) Insufficient Quantitate the DNA. Increase the amount of DNA in the sequencing reactions. See page

More information

Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website

Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website Biomolecular Core Facility AI Dupont Hospital for Children, Rockland Center One, Room 214 Core: (302) 651-6712, Office: (302) 651-6707, mbcore@nemours.org Katia Sol-Church, Ph.D., Director Jennifer Frenck

More information

GenScript BloodReady TM Multiplex PCR System

GenScript BloodReady TM Multiplex PCR System GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI

More information

Absolute Quantification Getting Started Guide

Absolute Quantification Getting Started Guide 5 cdna Reverse Primer Oligo d(t) or random hexamer Synthesis of 1st cdna strand 3 5 cdna Applied Biosystems 7300/7500/7500 Fast Real-Time PCR System Absolute Quantification Getting Started Guide Introduction

More information

Terra PCR Direct Polymerase Mix User Manual

Terra PCR Direct Polymerase Mix User Manual Clontech Laboratories, Inc. Terra PCR Direct Polymerase Mix User Manual Cat. Nos. 639269, 639270, 639271 PT5126-1 (031416) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain

More information

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 BioScience quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 This method describes a Real-time semi-quantitative TaqMan PCR procedure for the determination of

More information

Single Nucleotide Polymorphisms (SNPs)

Single Nucleotide Polymorphisms (SNPs) Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded

More information

Power SYBR Green PCR Master Mix and Power SYBR Green RT-PCR Reagents Kit

Power SYBR Green PCR Master Mix and Power SYBR Green RT-PCR Reagents Kit USER GUIDE Power SYBR Green PCR Master Mix and Power SYBR Green RT-PCR Reagents Kit Catalog Number 4368577, 4367659, 4367660, 4368706, 4368702, 4368708 (Master Mix) and 4368711 (RT-PCR Reagents Kit) Publication

More information

Real-Time PCR UNIT 10.3 OVERVIEW AND PRINCIPLES

Real-Time PCR UNIT 10.3 OVERVIEW AND PRINCIPLES UNIT.3 Dean Fraga, 1 Tea Meulia, 2 and Steven Fenster 3 1 College of Wooster, Wooster, Ohio 2 Ohio Agricultural Research and Development Center, Wooster, Ohio 3 Ashland University, Ashland, Ohio OVERVIEW

More information

PreciseTM Whitepaper

PreciseTM Whitepaper Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis

More information

DNA and Forensic Science

DNA and Forensic Science DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief

More information

Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3

Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3 Table of Contents I. Description... 2 II. Kit Components... 2 III. Storage... 2 IV. 1st Strand cdna Synthesis Reaction... 3 V. RT-PCR, Real-time RT-PCR... 4 VI. Application... 5 VII. Preparation of RNA

More information

Gene Mapping Techniques

Gene Mapping Techniques Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction

More information

SYBR Green PCR Master Mix and SYBR Green RT-PCR Reagents Kit

SYBR Green PCR Master Mix and SYBR Green RT-PCR Reagents Kit USER GUIDE SYBR Green PCR Master Mix and SYBR Green RT-PCR Reagents Kit Catalog Number 4309155 (Master Mix) and 4306736 (RT-PCR Reagents Kit) Publication Part Number 4310251 Rev. G Revision Date September

More information

Molecular typing of VTEC: from PFGE to NGS-based phylogeny

Molecular typing of VTEC: from PFGE to NGS-based phylogeny Molecular typing of VTEC: from PFGE to NGS-based phylogeny Valeria Michelacci 10th Annual Workshop of the National Reference Laboratories for E. coli in the EU Rome, November 5 th 2015 Molecular typing

More information

Real time and Quantitative (RTAQ) PCR. so I have an outlier and I want to see if it really is changed

Real time and Quantitative (RTAQ) PCR. so I have an outlier and I want to see if it really is changed Real time and Quantitative (RTAQ) PCR or.. for this audience so I have an outlier and I want to see if it really is changed Nigel Walker, Ph.D. Laboratory of Computational Biology and Risk Analysis, Environmental

More information

Mir-X mirna First-Strand Synthesis Kit User Manual

Mir-X mirna First-Strand Synthesis Kit User Manual User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.

More information

PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System) 50 preps Product #60200

PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System) 50 preps Product #60200 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System)

More information

Troubleshooting Guide for DNA Electrophoresis

Troubleshooting Guide for DNA Electrophoresis Troubleshooting Guide for Electrophoresis. ELECTROPHORESIS Protocols and Recommendations for Electrophoresis electrophoresis problem 1 Low intensity of all or some bands 2 Smeared bands 3 Atypical banding

More information

STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR)

STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR) STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR) jmvizcaino@vet.ucm.es Av/ Puerta de Hierro s/n. 28040 Madrid. Tel: (34) 913944082

More information

Scorpions Technology for Real Time PCR and Genotyping

Scorpions Technology for Real Time PCR and Genotyping Scorpions Technology for Real Time PCR and Genotyping Outline Origins of Scorpions Principles of Scorpions Performance Applications Conclusions Origins of Scorpions A Bit of History At Zeneca Diagnostics,

More information

User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube

User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube User Manual CelluLyser Lysis and cdna Synthesis Kit Version 1.4 Oct 2012 From cells to cdna in one tube CelluLyser Lysis and cdna Synthesis Kit Table of contents Introduction 4 Contents 5 Storage 5 Additionally

More information

DNA Sequencing Handbook

DNA Sequencing Handbook Genomics Core 147 Biotechnology Building Ithaca, New York 14853-2703 Phone: (607) 254-4857; Fax (607) 254-4847 Web: http://cores.lifesciences.cornell.edu/brcinfo/ Email: DNA_Services@cornell.edu DNA Sequencing

More information

RT-PCR: Two-Step Protocol

RT-PCR: Two-Step Protocol RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed

More information

REAL-TIME PCR: Put the odds in your favor with SuperScript RT. FROM THEORY TO PRACTICE

REAL-TIME PCR: Put the odds in your favor with SuperScript RT. FROM THEORY TO PRACTICE i REAL-TIME PCR: FROM THEORY TO PRACTICE ii Put the odds in your favor with SuperScript RT. Engineered to be RNase H and incredibly thermostable, SuperScript III RT delivers robust first-strand synthesis

More information

Quantitative Telomerase Detection Kit (QTD Kit)

Quantitative Telomerase Detection Kit (QTD Kit) Quantitative Telomerase Detection Kit (QTD Kit) Catalog No. MT3010, MT3011, MT3012 For Research Use Only. Not for use in diagnostic procedures 1 Table of Contents 1. Introduction Background Product Overview

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

HBV Quantitative Real Time PCR Kit

HBV Quantitative Real Time PCR Kit Revision No.: ZJ0002 Issue Date: Aug 7 th, 2008 HBV Quantitative Real Time PCR Kit Cat. No.: HD-0002-01 For Use with LightCycler 1.0/LightCycler2.0/LightCycler480 (Roche) Real Time PCR Systems (Pls ignore

More information

Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit

Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit Product Bulletin Human Identification Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit The Quantifiler kits produce reliable and reproducible results, helping to

More information

DyNAmo cdna Synthesis Kit for qrt-pcr

DyNAmo cdna Synthesis Kit for qrt-pcr DyNAmo cdna Synthesis Kit for qrt-pcr Instruction manual F- 470S Sufficient for 20 cdna synthesis reactions (20 µl each) F- 470L Sufficient for 100 cdna synthesis reactions (20 µl each) Description...

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

A closed tube format for amplification and detection of DNA based on energy transfer

A closed tube format for amplification and detection of DNA based on energy transfer 2516 2521 Nucleic Acids Research, 1997, Vol. 25, No. 12 1997 Oxford University Press A closed tube format for amplification and detection of DNA based on energy transfer I. A. Nazarenko*, S. K. Bhatnagar

More information

Technical Manual No. 0173 Update Date 10112010

Technical Manual No. 0173 Update Date 10112010 TissueDirect TM Multiplex PCR System Technical Manual No. 0173 Update Date 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed

More information

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Chapter 9 Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Q&A Interferons are species specific, so that interferons to be used in humans must be produced in human cells. Can you think

More information

ChIP TROUBLESHOOTING TIPS

ChIP TROUBLESHOOTING TIPS ChIP TROUBLESHOOTING TIPS Creative Diagnostics Abstract ChIP dissects the spatial and temporal dynamics of the interactions between chromatin and its associated factors CD Creative Diagnostics info@creative-

More information

IMBB 2013. Genomic DNA purifica8on

IMBB 2013. Genomic DNA purifica8on IMBB 2013 Genomic DNA purifica8on Why purify DNA? The purpose of DNA purifica8on from the cell/8ssue is to ensure it performs well in subsequent downstream applica8ons, e.g. Polymerase Chain Reac8on (PCR),

More information

ADVANCES IN REAL TIME PCR: APPLICATION TO CLINICAL LABORATORY DIAGNOSTICS

ADVANCES IN REAL TIME PCR: APPLICATION TO CLINICAL LABORATORY DIAGNOSTICS ADVANCES IN CLINICAL CHEMISTRY, VOL. 40 ADVANCES IN REAL TIME PCR: APPLICATION TO CLINICAL LABORATORY DIAGNOSTICS Bernhard Kaltenboeck and Chengming Wang Department of Pathobiology, College of Veterinary

More information

Microbiology Laboratory: MOLECULAR IDENTIFICATION OF UNKNOWN BACTERIA

Microbiology Laboratory: MOLECULAR IDENTIFICATION OF UNKNOWN BACTERIA Microbiology Laboratory: MOLECULAR IDENTIFICATION OF UNKNOWN BACTERIA Classical Microbiology courses are typically structured to introduce the identification of bacterial species using a series of biochemical

More information

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

Optimizing and Analyzing Real-Time Assays on the SmartCycler II System

Optimizing and Analyzing Real-Time Assays on the SmartCycler II System Optimizing and Analyzing Real-Time Assays on the SmartCycler II System Cepheid Technical Support Overview This technical note provides guidelines on transferring, optimizing, and evaluating real-time PCR

More information