Biology. Lectures winter term st year of Pharmacy study
|
|
|
- Ashlee Sharp
- 7 years ago
- Views:
Transcription
1 Biology Lectures winter term st year of Pharmacy study
2 8th Lecture A. Trasport of signals between cells and intra cell B. Gene expression
3 Gene expresssion
4 What is gene expression? Gene in DNA mrna Proteins
5 Francis Crick a James Watson (1957) Sequnce hypothesis information in DNA and proteins is colinear (3 bases coded one of 20 amino acides) The central dogma information in line DNA -> RNA -> Protein
6 The central dogma J.Watson & F. Crick 1963
7 What is gene? Part of DNA sequence of nucleotides
8
9 How is stored gene? Structure of DNA Nuclear membrane Chromatin fiber Chromatin fiber (30 nm dia.) H1 Nucleosomes H1 Nuclear pore } Other DNA Chromatin factors Nuclear matrix
10 DNA folding
11 Nucleosome regulation of transcription integration of specific locus body guards of gene expression
12 What is gene? Type of gene: rrna trna mrna
13 Number of genes Walter Gilbert [1980s] 100k Antequera & Bird [1993] 70-80k John Quackenbush et al. (TIGR) [2000] 20k Ewing & Green [2000] 30k Tetraodon analysis [2001] 35k Human Genome Project (public) [2001] ~ 31k Human Genome Project (Celera) [2001] 24-40k Mouse Genome Project (public) [2002] 25k -30k Lee Rowen [2003] 25,947
14 Regulation of gene expression
15 Regulation of gene expression on the level of transcription
16 Regulation of gene expression on the level of transcription
17 Regulation of gene expression on the level of transcription Lodish DNA blue mrna red
18 Regulation of gene expression on the level of transcription
19 Gene expressio Lac operon system
20 Regulation of gene expression in eukaryotes on the level of transcription
21 Gene expression TATA homeobox Place for RNA polymerase
22 Gene expression Transcription factors TF
23 Gene expression factors of transcription
24 Gene expression factors of transcription
25 Gene expression factors of transcription
26 Gene expression factors of transcription
27
28
29 What is gene expression? Gene in DNA mrna Proteins
30 Génová expresia u eukaryotov môže byť regulovaná na viacerých miestach
31 mrna splicing PolyA+RNA red Splizozóm- green overlapping (red a green) = yellow
32 mrna splicing
33 mrna splicing DNA mrna primary trancription Splicing mrna final version
34 Regulation of gene expression
35 Nuclerar pores Freeze-fracture/freeze etch technique
36 Nuclear pores
37
38 Regulation of gene expression
39 What is gene expression? Gene in DNA mrna Proteins
40 Gén: proteín-kód DNA DNA CCTGAGCCAACTATTGATGAA transkription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE
41 Lodish et al, Fig 4-21 Translation
42
43
44 Lodish et al, Fig 4-21 Translation
45 Code of translation (Marshall Nirenberg 1961) Lodish et al, Fig 4-22
46 Genetic code
47
48 Proteins Biogenic amino acides, name, codes Aspartic Acid Asp D Glutamic Acid Glu E Phenylanine Phe F Glycine Gly G Alanine Ala A Cystine Cys C Histidine His H Isoleucine Ile I Lysine Lys K Leucine Leu L Methionine Met M Asparagine Asn N Proline Pro P Glutamine Gln Q Arginine Arg R Serine Ser S Threonine Thr T Valine Val V Tryptophan Trp W Tyrosine Tyr Y
49
50
51 trna
52 Ribozómy
53
54 Ribosomes 60% rrna + 40% proteins Translation and proteosynthesis free vs, bound ribosomes
55 rrna secondary structure
56
57 Ribosomes
58 Free vs Bound ribosomes
59 Endoplasmatic reticulum
60
61 What is gene expression? Gene in DNA mrna Proteins
62
63 Lodish et al, Fig 4-26 trnas
64 Creation of translate unit (complex) -ribosome+mrna+trna met
65 Continue to next slide
66
67 Lodish et al, Fig 4-20
68
69 Plug keeps the translocator closed when it is not being used for co-translational insertion See notes page
70 It not the end!
71 Global view Protein Structures Protein Functions Metabolites Chromosomal Location Medical expert knowledge DNA Microarrays
72 The Biologist s Wishlist A complete and accurate set of all genes and their genomic positions A set of all the transcripts produced by each gene The location and timing of expression of each transcript The protein produced from each transcript The location and timing of each protein s expression The complete structure of each protein The functions of each protein
73
74
Pipe Cleaner Proteins. Essential question: How does the structure of proteins relate to their function in the cell?
Pipe Cleaner Proteins GPS: SB1 Students will analyze the nature of the relationships between structures and functions in living cells. Essential question: How does the structure of proteins relate to their
BOC334 (Proteomics) Practical 1. Calculating the charge of proteins
BC334 (Proteomics) Practical 1 Calculating the charge of proteins Aliphatic amino acids (VAGLIP) N H 2 H Glycine, Gly, G no charge Hydrophobicity = 0.67 MW 57Da pk a CH = 2.35 pk a NH 2 = 9.6 pi=5.97 CH
Concluding lesson. Student manual. What kind of protein are you? (Basic)
Concluding lesson Student manual What kind of protein are you? (Basic) Part 1 The hereditary material of an organism is stored in a coded way on the DNA. This code consists of four different nucleotides:
IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon. V. Polypeptides and Proteins
IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon A. Acid/Base properties 1. carboxyl group is proton donor! weak acid 2. amino group is proton acceptor! weak base 3. At physiological ph: H
Amino Acids, Peptides, Proteins
Amino Acids, Peptides, Proteins Functions of proteins: Enzymes Transport and Storage Motion, muscle contraction Hormones Mechanical support Immune protection (Antibodies) Generate and transmit nerve impulses
Shu-Ping Lin, Ph.D. E-mail: splin@dragon.nchu.edu.tw
Amino Acids & Proteins Shu-Ping Lin, Ph.D. Institute te of Biomedical Engineering ing E-mail: splin@dragon.nchu.edu.tw Website: http://web.nchu.edu.tw/pweb/users/splin/ edu tw/pweb/users/splin/ Date: 10.13.2010
Advanced Medicinal & Pharmaceutical Chemistry CHEM 5412 Dept. of Chemistry, TAMUK
Advanced Medicinal & Pharmaceutical Chemistry CHEM 5412 Dept. of Chemistry, TAMUK Dai Lu, Ph.D. dlu@tamhsc.edu Tel: 361-221-0745 Office: RCOP, Room 307 Drug Discovery and Development Drug Molecules Medicinal
Molecular Facts and Figures
Nucleic Acids Molecular Facts and Figures DNA/RNA bases: DNA and RNA are composed of four bases each. In DNA the four are Adenine (A), Thymidine (T), Cytosine (C), and Guanine (G). In RNA the four are
http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets
http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets by Louise Brown Jasko John Anthony Campbell Jack Dennis Cassidy Michael Nickelsburg Stephen Prentis Rohm Objectives: 1) Using plastic beads, construct
Application Note. Determination of 17 AQC derivatized Amino acids in baby food samples. Summary. Introduction. Category Bio science, food Matrix
Application Note Determination of 17 AQC derivatized Amino acids in baby food samples Category Bio science, food Matrix Baby food Method UHPLC Keywords Proteinogenic amino acids, canonical amino acids,
Guidelines for Writing a Scientific Paper
Guidelines for Writing a Scientific Paper Writing an effective scientific paper is not easy. A good rule of thumb is to write as if your paper will be read by a person who knows about the field in general
UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet
1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:.
From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
Part A: Amino Acids and Peptides (Is the peptide IAG the same as the peptide GAI?)
ChemActivity 46 Amino Acids, Polypeptides and Proteins 1 ChemActivity 46 Part A: Amino Acids and Peptides (Is the peptide IAG the same as the peptide GAI?) Model 1: The 20 Amino Acids at Biological p See
Molecular Genetics. RNA, Transcription, & Protein Synthesis
Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and
PRACTICE TEST QUESTIONS
PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
13.2 Ribosomes & Protein Synthesis
13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.au What is Gene Expression & Gene Regulation? 1. Gene Expression
The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:
Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How
Chem 465 Biochemistry II
Chem 465 Biochemistry II Name: 2 points Multiple choice (4 points apiece): 1. Formation of the ribosomal initiation complex for bacterial protein synthesis does not require: A) EF-Tu. B) formylmethionyl
Basic Concepts of DNA, Proteins, Genes and Genomes
Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate
Academic Nucleic Acids and Protein Synthesis Test
Academic Nucleic Acids and Protein Synthesis Test Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. Each organism has a unique combination
Multiple Choice Write the letter that best answers the question or completes the statement on the line provided.
Name lass Date hapter 12 DN and RN hapter Test Multiple hoice Write the letter that best answers the question or completes the statement on the line provided. Pearson Education, Inc. ll rights reserved.
Application Note. Determination of Amino acids by UHPLC with automated OPA- Derivatization by the Autosampler. Summary. Fig. 1.
Application Note Determination of Amino acids by UHPLC with automated PA- Derivatization by the Autosampler Category Bio Analysis Matrix - Method UHPLC Keywords Proteinogenic Amino acids, Canonical Amino
Ms. Campbell Protein Synthesis Practice Questions Regents L.E.
Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide
THE CHEMICAL SYNTHESIS OF PEPTIDES
TE EMIAL SYTESIS F PEPTIDES Peptides are the long molecular chains that make up proteins. Synthetic peptides are used either as drugs (as they are biologically active) or in the diagnosis of disease. Peptides
RNA and Protein Synthesis
Name lass Date RN and Protein Synthesis Information and Heredity Q: How does information fl ow from DN to RN to direct the synthesis of proteins? 13.1 What is RN? WHT I KNOW SMPLE NSWER: RN is a nucleic
Protein Synthesis How Genes Become Constituent Molecules
Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein
Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown
1 DNA Coloring - Transcription & Translation Transcription RNA, Ribonucleic Acid is very similar to DNA. RNA normally exists as a single strand (and not the double stranded double helix of DNA). It contains
Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects
Mutation Mutation provides raw material to evolution Different kinds of mutations have different effects Mutational Processes Point mutation single nucleotide changes coding changes (missense mutations)
Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.
Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.
Structure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.
Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.
Journal of Chemical and Pharmaceutical Research
Available on line www.jocpr.com Journal of Chemical and Pharmaceutical Research J. Chem. Pharm. Res., 2010, 2(2): 372-380 ISSN No: 0975-7384 Determination of amino acid without derivatization by using
Chapter 9. Applications of probability. 9.1 The genetic code
Chapter 9 Applications of probability In this chapter we use the tools of elementary probability to investigate problems of several kinds. First, we study the language of life by focusing on the universal
The Steps. 1. Transcription. 2. Transferal. 3. Translation
Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order
1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
Name: Date: Period: DNA Unit: DNA Webquest
Name: Date: Period: DNA Unit: DNA Webquest Part 1 History, DNA Structure, DNA Replication DNA History http://www.dnaftb.org/dnaftb/1/concept/index.html Read the text and answer the following questions.
H H N - C - C 2 R. Three possible forms (not counting R group) depending on ph
Amino acids - 0 common amino acids there are others found naturally but much less frequently - Common structure for amino acid - C, -N, and functional groups all attached to the alpha carbon N - C - C
Chapter 26 Biomolecules: Amino Acids, Peptides, and Proteins
John E. McMurry www.cengage.com/chemistry/mcmurry Chapter 26 Biomolecules: Amino Acids, Peptides, and Proteins Proteins Amides from Amino Acids Amino acids contain a basic amino group and an acidic carboxyl
The Organic Chemistry of Amino Acids, Peptides, and Proteins
Essential rganic Chemistry Chapter 16 The rganic Chemistry of Amino Acids, Peptides, and Proteins Amino Acids a-amino carboxylic acids. The building blocks from which proteins are made. H 2 N C 2 H Note:
AMINO ACIDS & PEPTIDE BONDS STRUCTURE, CLASSIFICATION & METABOLISM
AMINO ACIDS & PEPTIDE BONDS STRUCTURE, CLASSIFICATION & METABOLISM OBJECTIVES At the end of this session the student should be able to, recognize the structures of the protein amino acid and state their
Peptide bonds: resonance structure. Properties of proteins: Peptide bonds and side chains. Dihedral angles. Peptide bond. Protein physics, Lecture 5
Protein physics, Lecture 5 Peptide bonds: resonance structure Properties of proteins: Peptide bonds and side chains Proteins are linear polymers However, the peptide binds and side chains restrict conformational
Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein
Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of
Introduction to Chemical Biology
Professor Stuart Conway Introduction to Chemical Biology University of xford Introduction to Chemical Biology ecommended books: Professor Stuart Conway Department of Chemistry, Chemistry esearch Laboratory,
Chapter 18 Regulation of Gene Expression
Chapter 18 Regulation of Gene Expression 18.1. Gene Regulation Is Necessary By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection
2007 7.013 Problem Set 1 KEY
2007 7.013 Problem Set 1 KEY Due before 5 PM on FRIDAY, February 16, 2007. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Where in a eukaryotic cell do you
Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary
Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page
Structure and properties of proteins. Vladimíra Kvasnicová
Structure and properties of proteins Vladimíra Kvasnicová Chemical nature of proteins biopolymers of amino acids macromolecules (M r > 10 000) Classification of proteins 1) by localization in an organism
Amino Acids and Proteins
Amino Acids and Proteins Proteins are composed of amino acids. There are 20 amino acids commonly found in proteins. All have: N2 C α R COO Amino acids at neutral p are dipolar ions (zwitterions) because
Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
INFORMATIKA ANGOL NYELVEN INFORMATION TECHNOLOGY
ÉRETTSÉGI VIZSGA 2006. május 17. INFORMATIKA ANGOL NYELVEN INFORMATION TECHNOLOGY 2006. május 17. 8:00 EMELT SZINTŰ GYAKORLATI VIZSGA ADVANCED LEVEL PRACTICAL EXAM A gyakorlati vizsga időtartama: 240 perc
ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes
ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination
Control of Gene Expression
Home Gene Regulation Is Necessary? Control of Gene Expression By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring
Transcription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
AP Biology TEST #5 - Chapters 11-14, 16 - REVIEW SHEET
NAME: AP Biology TEST #5 - Chapters 11-14, 16 - REVIEW SHEET 1. Griffith's experiments showing the transformation of R strain pneumococcus bacteria to S strain pneumococcus bacteria in the presence of
Lecture 8. Protein Trafficking/Targeting. Protein targeting is necessary for proteins that are destined to work outside the cytoplasm.
Protein Trafficking/Targeting (8.1) Lecture 8 Protein Trafficking/Targeting Protein targeting is necessary for proteins that are destined to work outside the cytoplasm. Protein targeting is more complex
GENE REGULATION. Teacher Packet
AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures
Human Tubal Fluid (HTF) Media & Modifi ed Human Tubal Fluid (mhtf) Medium with Gentamicin
Human Tubal Fluid (HTF) Media & Modifi ed Human Tubal Fluid (mhtf) Medium with Gentamicin HTF Media are intended for use in assisted reproductive procedures which include gamete and embryo manipulation
From Sequence to Structure
1 From Sequence to Structure The genomics revolution is providing gene sequences in exponentially increasing numbers. onverting this sequence information into functional information for the gene products
Amino Acids. Amino acids are the building blocks of proteins. All AA s have the same basic structure: Side Chain. Alpha Carbon. Carboxyl. Group.
Protein Structure Amino Acids Amino acids are the building blocks of proteins. All AA s have the same basic structure: Side Chain Alpha Carbon Amino Group Carboxyl Group Amino Acid Properties There are
Translation. Translation: Assembly of polypeptides on a ribosome
Translation Translation: Assembly of polypeptides on a ribosome Living cells devote more energy to the synthesis of proteins than to any other aspect of metabolism. About a third of the dry mass of a cell
AP BIOLOGY 2009 SCORING GUIDELINES
AP BIOLOGY 2009 SCORING GUIDELINES Question 4 The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following
From DNA to Protein
Nucleus Control center of the cell contains the genetic library encoded in the sequences of nucleotides in molecules of DNA code for the amino acid sequences of all proteins determines which specific proteins
a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled
Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino
Insulin mrna to Protein Kit
Insulin mrna to Protein Kit A 3DMD Paper BioInformatics and Mini-Toober Folding Activity Teacher Key and Teacher Notes www. Insulin mrna to Protein Kit Contents Becoming Familiar with the Data... 3 Identifying
CCR Biology - Chapter 8 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 8 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What did Hershey and Chase know
Specific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons
Tutorial II Gene expression: mrna translation and protein synthesis Piergiorgio Percipalle, PhD Program Control of gene transcription and RNA processing mrna translation and protein synthesis KAROLINSKA
Sickle cell anemia: Altered beta chain Single AA change (#6 Glu to Val) Consequence: Protein polymerizes Change in RBC shape ---> phenotypes
Protein Structure Polypeptide: Protein: Therefore: Example: Single chain of amino acids 1 or more polypeptide chains All polypeptides are proteins Some proteins contain >1 polypeptide Hemoglobin (O 2 binding
Name: Date: Problem How do amino acid sequences provide evidence for evolution? Procedure Part A: Comparing Amino Acid Sequences
Name: Date: Amino Acid Sequences and Evolutionary Relationships Introduction Homologous structures those structures thought to have a common origin but not necessarily a common function provide some of
Recap. Lecture 2. Protein conformation. Proteins. 8 types of protein function 10/21/10. Proteins.. > 50% dry weight of a cell
Lecture 2 Protein conformation ecap Proteins.. > 50% dry weight of a cell ell s building blocks and molecular tools. More important than genes A large variety of functions http://www.tcd.ie/biochemistry/courses/jf_lectures.php
Modeling DNA Replication and Protein Synthesis
Skills Practice Lab Modeling DNA Replication and Protein Synthesis OBJECTIVES Construct and analyze a model of DNA. Use a model to simulate the process of replication. Use a model to simulate the process
RNA & Protein Synthesis
RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis
Gene Switches Teacher Information
STO-143 Gene Switches Teacher Information Summary Kit contains How do bacteria turn on and turn off genes? Students model the action of the lac operon that regulates the expression of genes essential for
Lab # 12: DNA and RNA
115 116 Concepts to be explored: Structure of DNA Nucleotides Amino Acids Proteins Genetic Code Mutation RNA Transcription to RNA Translation to a Protein Figure 12. 1: DNA double helix Introduction Long
Bioinformatics, Sequences and Genomes
Bioinformatics, Sequences and Genomes BL4273 Bioinformatics for Biologists Week 1 Daniel Barker, School of Biology, University of St Andrews Email db60@st-andrews.ac.uk BL4273 and 4273π 4273π is a custom
The chemistry of insulin
FREDERICK S ANGER The chemistry of insulin Nobel Lecture, December 11, 1958 It is great pleasure and privilege for me to give an account of my work on protein structure and I am deeply sensitive of the
Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription
Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional
Genomes and SNPs in Malaria and Sickle Cell Anemia
Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing
Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
CHAPTER 30: PROTEIN SYNTHESIS
CHAPTER 30: PROTEIN SYNTHESIS (Translation) Translation: mrna protein LECTURE TOPICS Complexity, stages, rate, accuracy Amino acid activation [trna charging] trnas and translating the Genetic Code - Amino
Chemistry 110. Bettelheim, Brown, Campbell & Farrell. Introduction to General, Organic and Biochemistry Chapter 22 Proteins
hemistry 110 Bettelheim, Brown, ampbell & Farrell Ninth Edition Introduction to General, rganic and Biochemistry hapter 22 Proteins Step-growth polyamide (polypeptide) polymers or oligomers of L-α-aminoacids.
Complex multicellular organisms are produced by cells that switch genes on and off during development.
Home Control of Gene Expression Gene Regulation Is Necessary? By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring
Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison
Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov
Mutations and Genetic Variability. 1. What is occurring in the diagram below?
Mutations and Genetic Variability 1. What is occurring in the diagram below? A. Sister chromatids are separating. B. Alleles are independently assorting. C. Genes are replicating. D. Segments of DNA are
A. A peptide with 12 amino acids has the following amino acid composition: 2 Met, 1 Tyr, 1 Trp, 2 Glu, 1 Lys, 1 Arg, 1 Thr, 1 Asn, 1 Ile, 1 Cys
Questions- Proteins & Enzymes A. A peptide with 12 amino acids has the following amino acid composition: 2 Met, 1 Tyr, 1 Trp, 2 Glu, 1 Lys, 1 Arg, 1 Thr, 1 Asn, 1 Ile, 1 Cys Reaction of the intact peptide
Biochemistry - I. Prof. S. Dasgupta Department of Chemistry Indian Institute of Technology, Kharagpur Lecture-11 Enzyme Mechanisms II
Biochemistry - I Prof. S. Dasgupta Department of Chemistry Indian Institute of Technology, Kharagpur Lecture-11 Enzyme Mechanisms II In the last class we studied the enzyme mechanisms of ribonuclease A
13.4 Gene Regulation and Expression
13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.
BCH401G Lecture 39 Andres
BCH401G Lecture 39 Andres Lecture Summary: Ribosome: Understand its role in translation and differences between translation in prokaryotes and eukaryotes. Translation: Understand the chemistry of this
Translation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
Hands on Simulation of Mutation
Hands on Simulation of Mutation Charlotte K. Omoto P.O. Box 644236 Washington State University Pullman, WA 99164-4236 omoto@wsu.edu ABSTRACT This exercise is a hands-on simulation of mutations and their
Announcements. Chapter 15. Proteins: Function. Proteins: Function. Proteins: Structure. Peptide Bonds. Lab Next Week. Help Session: Monday 6pm LSS 277
Lab Next Week Announcements Help Session: Monday 6pm LSS 277 Office Hours Chapter 15 and Translation Proteins: Function Proteins: Function Enzymes Transport Structural Components Regulation Communication
DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3
DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can
The Nucleus: DNA, Chromatin And Chromosomes
The Nucleus: DNA, Chromatin And Chromosomes Professor Alfred Cuschieri Department of Anatomy, University of Malta. Objectives By the end of this unit the student should be able to: 1. List the major structural
Actual Quiz 1 (closed book) will be given Monday10/4 at 10:00 am
MIT Biology Department 7.012: Introductory Biology Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. laudette Gardel 7.012 Practice Quiz 1 Actual Quiz 1 (closed book) will
The Puzzle of Life A Lesson Plan for Life S cien ce Teach ers From: The G reat Lakes S cien ce C ent er, C lev elan d, OH
Introduction: The Puzzle of Life A Lesson Plan for Life S cien ce Teach ers From: The G reat Lakes S cien ce C ent er, C lev elan d, OH In the Puzzle of Life activity, students will demonstrate how the