Goal: Learn some of the latest research in genomics Learn/practice basic programming and data mining skills
|
|
- Catherine Reynolds
- 7 years ago
- Views:
Transcription
1 Course outline Goal: Learn some of the latest research in genomics Learn/practice basic programming and data mining skills Structure: Lectures (4) Paper discussion (6) Workshops (5) Grading: Problem sets (2) 20 points Class participation (paper discussion) 35 points Paper reviews (2) 30 points Data analysis (1) 15 points
2 Introduction to genomics and genome sequencing: Approaches and Platforms Bio472- Spring 2016 Amanda Larracuente
3 Outline 1. History 2. Basic assembly approaches 3. First generation technology 4. Second generation technology 5. Third generation technology 6. Challenges
4 1. History History of genomics Darwin: The Origin of Species 1859
5 1. History History of genomics Mendel: laws of inheritance 1865 Avery: DNA as inherited material 1944 Watson, Crick & Franklin: DNA structure 1953
6 1. History History of genomics Arthur Kornberg: DNA polymerase 1956 Nirenberg: genetic code 1961 Gilbert and Sanger: sequencing 1977
7 Genomics 1. History
8 1. History Sanger sequenced genomes Bacteriophage lambda H. influenzae Yeast C. elegans Drosophila melanogaster Arabidopsis Human Comparative genomics!
9 Human Genome Project Discussed Projected to finish in 2005 Completed ahead of schedule in 2000 Published in 2001
10 1. History Progress in genome sequencing NHGRI at genome.gov
11 2. Basic Assembly Approaches Sequence reads Reads Sequence output from a DNA fragment Base qualities Paired-end reads Paired-end reads DNA fragment Reads from both ends of a DNA fragment Similar to or same as mate pairs (depending on platform)
12 2. Basic Assembly Approaches Genome assemblies 10 9 short sequencing reads 3Gb whole genome Human male karyotype
13 2. Basic Assembly Approaches Whole Genome Shotgun (WGS) approach Overlapping reads 1. Shear genome into 3-5kb fragments, clone into plasmids and sequence 2. Find overlapping reads contig 3. Assemble overlapping reads into contigs Mate pairs ( ( 4. Assemble contigs into scaffolds GATCGTGTCCCATTGTCAGATCGTG Finished assembly scaffold Chromosomes 5. Link scaffolds into finished sequence corresponding to chromosomes
14 2. Basic Assembly Approaches Hierarchical Approach BACs kb inserts 1. Shear genome into 150kb fragments and put in BACs 2. Create map of BACs to genome and create a tiling path Tiling path 3. Shotgun sequence individual BACs from tiling path Mate pairs 4. Assemble BAC sequences ( ( scaffold 5. Use sequenced tiling path to reconstruct genome GATCGTGTCCCATTGTCAGATCGTG Finished assembly Chromosomes
15 2. Basic Assembly Approaches Comparing assembly approaches Whole Genome Shotgun Faster Assembly is a huge computational effort Celera Genomics approach to human genome Hierarchical Slower Labor-intensive Higher quality assembly in difficult-to-assemble regions Publicly funded Human Genome Project Took >10 years and cost $3 billion
16 3. First generation technology First generation sequencing technology Shear genomic DNA Subclone into vectors Bacterial replication Isolate amplified clones Capillary sequencing
17 3. First generation technology Sanger sequencing primer% Chain termination Fluorescently labeled, modified nucleotides Capillary gel electrophoresis Fragment%size% Template%DNA% Capillary%Gel% DNA% polymerase% TCTAGAGCCTGCAATACGATC% TCTAGAGCCTGCAATACGAT% TCTAGAGCCTGCAATACGA% TCTAGAGCCTGCAATACG% TCTAGAGCCTGCAATAC% TCTAGAGCCTGCAATA% TCTAGAGCCTGCAAT% TCTAGAGCCTGCAA% TCTAGAGCCTGCA% TCTAGAGCCTGC% TCTAGAGCCTG% TCTAGAGCCT% TCTAGAGCC% TCTAGAGC% TCTAGAG% TCTAGA% TCTAG% TCTA% TCT% TC% T% TCTAGAGCCTGCAATACGATC% +" Sequence%
18 3. First generation technology Applications Sequencing PCR fragments Sequencing off plasmids Sequencing genomes Sequencing cdna libraries
19 4. Second generation technology Second generation sequencing technology Shear genomic DNA Solid support fixation Amplification Wash and Scan Base detection
20 4. Second generation technology 454 pyrosequencing a. Isolate gdna, fragment and ligate adapters b. Bind to beads and carry out emulsion PCR (empcr 1 fragment/bead) c. Break emulsion and add beads to fiber-optic slide d. Pyrosequencing reaction, 1 nt added at a time (peak height corresponds to # of nucl) a b c d Rothberg and Leamon 2008
21 4. Second generation technology Illumina Fragment gdna Ligate adapters Fix fragments on solid surface Bridge amplification to generate clusters Sequence one end (using reversible terminators) If paired-end, regenerate cluster and sequence the other end Figure from Mardis 2013
22 *more like 2.5-generation technology 4. Second generation technology Ion Torrent 1. Shear DNA, ligate adapters 2. Attach fragments to beads and amplify with empcr 4. Flow nucleotides over wells, one at a time 5. DNA polymerase incorporates bases and give off H+ 3. Place bead in wells on plate 6. Mini semi-conductor reads ph change
23 4. Second generation technology Applications Genome re-sequencing (reference based assembly) Genome sequencing (de novo assembly) Sequencing transcriptome (RNAseq) Sequencing DNA associated with proteins (CHiPseq)
24 5. Third generation technology Third generation sequencing technology Shear genomic DNA No amplification solid support fixation Base detection Single-molecule sequencing
25 5. Third generation technology Single molecule sequencing e.g. Pacific Biosciences (PacBio) Single-molecule real-time (SMRT) sequencing Real time fluorescent nucleotides Average reads >15 kb; some reads >50 kb High (~15%) error rate Eid et al. 2009
26 5. Third generation technology Applications Low-depth: Scaffolding contigs (de novo assembly) High-depth: Genome sequencing of repetitive regions or structural rearrangements
27 De novo assembly of self-corrected reads Raw reads Errorcorrected reads (~25X) Assembled Contig Overlap-layout-consensus (e.g. Celera assembler) Chin et al. 2013; Huddleston et al. 2014; Berlin et al. 2014
28 6. Challenges Comparison of NGS technologies (non-exhaustive) Method strategy Read length Error type Error rate Output per run 454 Synthesis/ pyrosequencing Up to 700bp indels 1% Mbp SOLID DNA ligase 75bp AT bias > % Gbp Illumina (HiSeq) Synthesis/DNA poly 150bp Subs. >0.1% 600 Gbp Ion Torrent H+ detection 90bp indels 1.5% 1 Gbp PacBio Single molecule/ synthesis >15kb (up to 50kb) insertions 15% Mbp (5-10 Mbp usable)
29 6. Challenges The $1000 genome Illumina! Reported January : The HiSeq X Ten, composed of 10 HiSeq X Systems, is the first sequencing platform that breaks the $1000 barrier for a 30x human genome. The HiSeq X Ten System is ideal for population-scale projects focused on the discovery of genotypic variation to understand and improve human health
30 6. Challenges Summary of technology Point: Sequencing is cheap Individual labs Current challenge Computational Data management NHGRI at genome.gov
31 6. Challenges Repetitive DNA Interspersed repeats? e.g. transposable elements Tandem repeats? e.g. satellites, CNVs
32 6. Challenges Challenges for repetitive DNA Repeat unit longer than read length (e.g. Transposable elements) Repeat unit longer than insert sizes (e.g. Transposable elements)
33 6. Challenges Challenges for repetitive DNA True Genomic sequence CCTGCGATAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGTGTACCC
34 6. Challenges Challenges for repetitive DNA True Genomic sequence CCTGCGATAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGTGTACCC Single end libraries Assembly CCTGCGATAATATGGAATATGGTGTACCC CCTGCGATAATATG CCTGCGATAATATG CGATAATATGGAA TAATATGGAATA AATATGGAATATGG AATATGGAATATGG AATATGGAATATGG AATATGGAATATGG AATATGGAATATGG AATATGGAATATGG AATATGGAATATGG GAATATGGTGTA AATATGGTGTACCC AATATGGTGTACCC
35 6. Challenges Challenges for repetitive DNA True Genomic sequence CCTGCGATAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGTGTACCC Paired end libraries Assembly CCTGCGATAATATGGAATATGGAATATGGAATATGGAATATGGTGTACCC CCTGCGATAATATG GGAATATGGA GCGATAATATGGAA ATATGGA TAATATGGAATATG GGAATATGG ATGGAATATGGAA AATATGGAATAT AATATGGAATA TATGGAATATG AATATGGAA AATATGGTGTA AATATGGAATAT TGGTGTACCC
36 6. Challenges Challenges for repetitive DNA True Genomic sequence CCTGCGATAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGTGTACCC Paired end + Mate pair libraries Assembly CCTGCGATAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGTGTACCC CCTGCGATAATATG GGAATATGGA GCGATAATATGGAA ATATGGA TAATATGGAATATG GGAATATGG AATATGGAATA TATGGAATATG GCGATAATATG GGAATATGGAATA AATATGGAA ATATGGAATATGG TATGGAATAT ATGGAATATG AATATGGAA AATATGGTGTA AATATGGAATAT TGGTGTACCC
37 6. Challenges Repeats cause Misassemblies Complex rearrangements Gaps
38 6. Challenges Next gen applications and repeats WGS with Sanger Repetitive DNA unstable in cloning vectors Paired end/mate pairs help with assembly 454 pyrosequencing Problems with homopolymers Paired end/mate pairs help with assembly Illumina Repetitive elements longer than read length Deep coverage and mate pairs help with assembly PacBio Problem is very high error rate: requires deep coverage PacBio or short reads Read length plows through repeats
39 Further reading: Metzker Sequencing technologies the next generation. Nature Reviews. 11: Mardis Next-Generation Sequencing Platforms. Ann. Rev. Anal. Chem 6: Treangen and Salzberg Repetitive DNA and nextgeneration sequencing: computational challenges and solutions. Nature Reviews Genetics 13:36-46.
40
41 Getting on BlueHive Course scratch space: /scratch/bio472_2016 In terminal: ssh bluehive.circ.rochester.edu l username
42 Running graphical software on BlueHive Please go to: Getting_Started And Install X11 application if needed
Next Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
More informationIntroduction to next-generation sequencing data
Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS
More informationAn Overview of DNA Sequencing
An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure
More informationJuly 7th 2009 DNA sequencing
July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer
More informationNext generation DNA sequencing technologies. theory & prac-ce
Next generation DNA sequencing technologies theory & prac-ce Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing
More informationDNA Sequencing & The Human Genome Project
DNA Sequencing & The Human Genome Project An Endeavor Revolutionizing Modern Biology Jutta Marzillier, Ph.D Lehigh University Biological Sciences November 13 th, 2013 Guess, who turned 60 earlier this
More informationGenetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
More informationNew generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova
New generation sequencing: current limits and future perspectives Giorgio Valle CRIBI Università di Padova Around 2004 the Race for the 1000$ Genome started A few questions... When? How? Why? Standard
More informationComputational Genomics. Next generation sequencing (NGS)
Computational Genomics Next generation sequencing (NGS) Sequencing technology defies Moore s law Nature Methods 2011 Log 10 (price) Sequencing the Human Genome 2001: Human Genome Project 2.7G$, 11 years
More informationNext Generation Sequencing for DUMMIES
Next Generation Sequencing for DUMMIES Looking at a presentation without the explanation from the author is sometimes difficult to understand. This document contains extra information for some slides that
More informationAutomated DNA sequencing 20/12/2009. Next Generation Sequencing
DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing
More informationIntroduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
More informationNext Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took
More informationGo where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe
Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. To published results faster With proven scalability To the forefront of discovery To limitless applications
More informationWelcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation.
Introduction to SMRTbell Template Preparation 100 338 500 01 1. SMRTbell Template Preparation 1.1 Introduction to SMRTbell Template Preparation Welcome to Pacific Biosciences' Introduction to SMRTbell
More informationrestriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
More informationIntroduction to NGS data analysis
Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High
More informationNext Generation Sequencing
Next Generation Sequencing DNA sequence represents a single format onto which a broad range of biological phenomena can be projected for high-throughput data collection Over the past three years, massively
More informationNGS data analysis. Bernardo J. Clavijo
NGS data analysis Bernardo J. Clavijo 1 A brief history of DNA sequencing 1953 double helix structure, Watson & Crick! 1977 rapid DNA sequencing, Sanger! 1977 first full (5k) genome bacteriophage Phi X!
More informationDNA Sequence Analysis
DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide
More informationOverview of Next Generation Sequencing platform technologies
Overview of Next Generation Sequencing platform technologies Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Outline 1. Technologies
More informationRecombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
More informationHow is genome sequencing done?
How is genome sequencing done? Using 454 Sequencing on the Genome Sequencer FLX System, DNA from a genome is converted into sequence data through four primary steps: Step One DNA sample preparation; Step
More informationConcepts and methods in sequencing and genome assembly
BCM-2004 Concepts and methods in sequencing and genome assembly B. Franz LANG, Département de Biochimie Bureau: H307-15 Courrier électronique: Franz.Lang@Umontreal.ca Outline 1. Concepts in DNA and RNA
More informationLecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
More informationIllumina Sequencing Technology
Illumina Sequencing Technology Highest data accuracy, simple workflow, and a broad range of applications. Introduction Figure 1: Illumina Flow Cell Illumina sequencing technology leverages clonal array
More informationFirst generation" sequencing technologies and genome assembly. Roger Bumgarner Associate Professor, Microbiology, UW Rogerb@u.washington.
First generation" sequencing technologies and genome assembly Roger Bumgarner ssociate Professor, Microbiology, UW Rogerb@u.washington.edu Why discuss a technology that appears to be being replaced? Next
More informationCCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
More informationShouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center
Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing
More informationGenome Sequencing. Phil McClean September, 2005
Genome Sequencing Phil McClean September, 2005 The concept of genome sequencing is quite simple. Break your genome up into many different small fragments, clone those fragments into a cloning vector, isolate
More informationKeeping up with DNA technologies
Keeping up with DNA technologies Mihai Pop Department of Computer Science Center for Bioinformatics and Computational Biology University of Maryland, College Park The evolution of DNA sequencing Since
More informationThe Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics
The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long
More informationNGS Technologies for Genomics and Transcriptomics
NGS Technologies for Genomics and Transcriptomics Massimo Delledonne Department of Biotechnologies - University of Verona http://profs.sci.univr.it/delledonne 13 years and $3 billion required for the Human
More informationChapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
More informationRecombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
More informationReading DNA Sequences:
Reading DNA Sequences: 18-th Century Mathematics for 21-st Century Technology Michael Waterman University of Southern California Tsinghua University DNA Genetic information of an organism Double helix,
More informationNazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office
2013 Laboratory Accreditation Program Audioconferences and Webinars Implementing Next Generation Sequencing (NGS) as a Clinical Tool in the Laboratory Nazneen Aziz, PhD Director, Molecular Medicine Transformation
More informationSanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne
Sanger Sequencing and Quality Assurance Zbigniew Rudzki Department of Pathology University of Melbourne Sanger DNA sequencing The era of DNA sequencing essentially started with the publication of the enzymatic
More informationHistory of DNA Sequencing & Current Applications
History of DNA Sequencing & Current Applications Christopher McLeod President & CEO, 454 Life Sciences, A Roche Company IMPORTANT NOTICE Intended Use Unless explicitly stated otherwise, all Roche Applied
More informationRecombinant DNA Unit Exam
Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the
More informationGenotyping by sequencing and data analysis. Ross Whetten North Carolina State University
Genotyping by sequencing and data analysis Ross Whetten North Carolina State University Stein (2010) Genome Biology 11:207 More New Technology on the Horizon Genotyping By Sequencing Timeline 2007 Complexity
More informationData Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms
Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Introduction Mate pair sequencing enables the generation of libraries with insert sizes in the range of several kilobases (Kb).
More informationBioinformatics I, WS 09-10, D. Huson, January 27, 2010 145
Bioinformatics I, WS 09-10, D. Huson, January 27, 2010 145 10 DNA sequencing This exposition is very closely based on the following sources, which are all recommended reading: 1. Clyde A. Hutchison, DNA
More informationData Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
More information14.3 Studying the Human Genome
14.3 Studying the Human Genome Lesson Objectives Summarize the methods of DNA analysis. State the goals of the Human Genome Project and explain what we have learned so far. Lesson Summary Manipulating
More informationG E N OM I C S S E RV I C ES
GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E
More informationMolecular and Cell Biology Laboratory (BIOL-UA 223) Instructor: Ignatius Tan Phone: 212-998-8295 Office: 764 Brown Email: ignatius.tan@nyu.
Molecular and Cell Biology Laboratory (BIOL-UA 223) Instructor: Ignatius Tan Phone: 212-998-8295 Office: 764 Brown Email: ignatius.tan@nyu.edu Course Hours: Section 1: Mon: 12:30-3:15 Section 2: Wed: 12:30-3:15
More informationIntroduction Bioo Scientific
Next Generation Sequencing Catalog 2014-2015 Introduction Bioo Scientific Bioo Scientific is a global life science company headquartered in Austin, TX, committed to providing innovative products and superior
More informationDNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE
DNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE We recommend for the sequence visualization the use of software that allows the examination of raw data in order to determine quantitatively how good has
More informationFOR REFERENCE PURPOSES
BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit
More informationBioinformatic Approaches for Genome Finishing
Bioinformatic Approaches for Genome Finishing Ph. D. Thesis submitted to the Faculty of Technology, Bielefeld University, Germany for the degree of Dr. rer. nat. by Peter Husemann July, 2011 Referees:
More informationTechniques in Molecular Biology (to study the function of genes)
Techniques in Molecular Biology (to study the function of genes) Analysis of nucleic acids: Polymerase chain reaction (PCR) Gel electrophoresis Blotting techniques (Northern, Southern) Gene expression
More informationAn Introduction to Next-Generation Sequencing Technology
An Introduction to Next-eneration Sequencing Technology Deciphering DNA sequences is essential for virtually all branches of biological research. With the advent of capillary electrophoresis (CE)-based
More informationForensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
More informationHow many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
More informationCore Facility Genomics
Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray
More informationBioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing
STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAAC GTGCAC GTGAAC Wouter Coppieters Head of the genomics core facility GIGA center, University of Liège Bioruptor NGS: Unbiased DNA
More informationBecker Muscular Dystrophy
Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency
More informationTribuna Académica. Overview of Metagenomics for Marine Biodiversity Research 1. Barton E. Slatko* Metagenomics defined
Tribuna Académica 117 Overview of Metagenomics for Marine Biodiversity Research 1 Barton E. Slatko* We are in the midst of the fastest growing revolution in molecular biology, perhaps in all of life science,
More informationIntroduction. Preparation of Template DNA
Procedures and Recommendations for DNA Sequencing at the Plant-Microbe Genomics Facility Ohio State University Biological Sciences Building Room 420, 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204;
More informationSEQUENCING. From Sample to Sequence-Ready
SEQUENCING From Sample to Sequence-Ready ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES, NOT ONCE, BUT EVERY TIME The highest-quality amplicons more sensitive, accurate, and specific Full support for all major
More informationBiotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
More informationHCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:
HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone
More informationUniversidade Estadual de Maringá
Universidade Estadual de Maringá Disciplina: Biologia Molecular Sequenciamento de ácidos nucléicos Profa. Dra. Maria Aparecida Fernandez Maxan e Gilbert - quebra química Berg, Gilbert and Sanger dideoxinucleotideos
More informationChapter 6 DNA Replication
Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore
More informationSNP genotyping. Gene expression. And now Solexa sequencing.
SNP genotyping. Gene expression. And now Solexa sequencing. Let s find the answers together. It s your research. You question. You test. You want answers quickly, accurately, and at a good value. Illumina
More informationAn example of bioinformatics application on plant breeding projects in Rijk Zwaan
An example of bioinformatics application on plant breeding projects in Rijk Zwaan Xiangyu Rao 17-08-2012 Introduction of RZ Rijk Zwaan is active worldwide as a vegetable breeding company that focuses on
More informationA Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
More informationGenomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011
Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)
More informationGenetics 301 Sample Final Examination Spring 2003
Genetics 301 Sample Final Examination Spring 2003 50 Multiple Choice Questions-(Choose the best answer) 1. A cross between two true breeding lines one with dark blue flowers and one with bright white flowers
More informationGenetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.
Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists
More informationPROYECTO GENOMA HUMANO. Medicina Molecular 2011 Maestría en Biología Molecular Médica- UBA
PROYECTO GENOMA HUMANO Medicina Molecular 2011 Maestría en Biología Molecular Médica- UBA GENOMA HUMANO Medicina Molecular 2011 Maestría en Biología Molecular Médica- UBA Some landmarks on the way to 1940s
More informationAn Introduction to Next-Generation Sequencing Technology
n Introduction to Next-eneration Sequencing echnology Part II: n overview of DN Sequencing pplications Diverse pplications Next-generation sequencing (NS) platforms enable a wide variety of applications,
More informationGenomics Services @ GENterprise
Genomics Services @ GENterprise since 1998 Mainz University spin-off privately financed 6-10 employees since 2006 Genomics Services @ GENterprise Sequencing Service (Sanger/3730, 454) Genome Projects (Bacteria,
More informationRecombinant DNA Technology
Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium
More informationTruSeq Custom Amplicon v1.5
Data Sheet: Targeted Resequencing TruSeq Custom Amplicon v1.5 A new and improved amplicon sequencing solution for interrogating custom regions of interest. Highlights Figure 1: TruSeq Custom Amplicon Workflow
More informationNucleic Acid Techniques in Bacterial Systematics
Nucleic Acid Techniques in Bacterial Systematics Edited by Erko Stackebrandt Department of Microbiology University of Queensland St Lucia, Australia and Michael Goodfellow Department of Microbiology University
More informationDNA sequencing is the process of determining the precise order of the nucleotide bases in a particular DNA molecule. In 1974, two methods of DNA
BIO440 Genetics Laboratory DNA sequencing DNA sequencing is the process of determining the precise order of the nucleotide bases in a particular DNA molecule. In 1974, two methods of DNA sequencing were
More informationComplete Genomics Sequencing
TECHNOLOGY OVERVIEW Complete Genomics Sequencing Introduction With advances in nanotechnology, high-throughput instruments, and large-scale computing, it has become possible to sequence a complete human
More informationLectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling
Lectures 1 and 8 15 February 7, 2013 This is a review of the material from lectures 1 and 8 14. Note that the material from lecture 15 is not relevant for the final exam. Today we will go over the material
More informationAriella Syma Sasson ALL RIGHTS RESERVED
2010 Ariella Syma Sasson ALL RIGHTS RESERVED FROM MILLIONS TO ONE: THEORETICAL AND CONCRETE APPROACHES TO DE NOVO ASSEMBLY USING SHORT READ DNA SEQUENCES by ARIELLA SYMA SASSON A Dissertation submitted
More informationBioanalyzer Applications for
Bioanalyzer Applications for Next-Gen Sequencing: Updates and Tips March 1 st, 2011 Charmian Cher, Ph.D Field Applications Scientist Page 1 Agenda 1 2 3 Next-gen sequencing library preparation workflow
More informationRESTRICTION DIGESTS Based on a handout originally available at
RESTRICTION DIGESTS Based on a handout originally available at http://genome.wustl.edu/overview/rst_digest_handout_20050127/restrictiondigest_jan2005.html What is a restriction digests? Cloned DNA is cut
More informationSanger Sequencing. Troubleshooting Guide. Failed sequence
Sanger Sequencing Troubleshooting Guide Below are examples of the main problems experienced in ABI Sanger sequencing. Possible causes for failure and their solutions are listed below each example. The
More information1865 Discovery: Heredity Transmitted in Units
1859 Discovery: Natural Selection Genetic Timeline Charles Darwin wrote On the Origin of Species by Means of Natural Selection, or the Preservation of Favored Races in the Struggle for Life. 1865 Discovery:
More informationDifficult DNA Templates Sequencing. Primer Walking Service
Difficult DNA Templates Sequencing Primer Walking Service Result 16/18s (ITS 5.8s) rrna Sequencing Phylogenetic tree 16s rrna Region ITS rrna Region ITS and 26s rrna Region Order and Result Cloning Service
More informationHuman Genome and Human Genome Project. Louxin Zhang
Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular
More informationChapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes
Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes 2.1 Introduction Large-scale insertional mutagenesis screening in
More informationGene Cloning. Reference. T.A. Brown, Gene Cloning, Chapman and Hall. S.B. Primrose, Molecular Biotechnology, Blackwell
Gene Cloning 2004 Seungwook Kim Chem. & Bio. Eng. Reference T.A. Brown, Gene Cloning, Chapman and Hall S.B. Primrose, Molecular Biotechnology, Blackwell Why Gene Cloning is Important? A century ago, Gregor
More informationAppendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
More informationDescription: Molecular Biology Services and DNA Sequencing
Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:
More informationGenome Sequencer 20 System. First to the Finish. www.roche-applied-science.com
Genome Sequencer 20 System First to the Finish www.roche-applied-science.com Technology 4-5 Process Steps 8-11 DNA Library Preparation 8 empcr Amplification 9 Sequencing-by-Synthesis 10-11 The Genome Sequencer
More informationBRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls?
BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? Giovanni Luca Scaglione, PhD ------------------------ Laboratory of Clinical Molecular Diagnostics and Personalized Medicine, Institute
More information1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.
Chapter IV Molecular Computation These lecture notes are exclusively for the use of students in Prof. MacLennan s Unconventional Computation course. c 2013, B. J. MacLennan, EECS, University of Tennessee,
More informationDNA Sequencing Troubleshooting Guide
DNA Sequencing Troubleshooting Guide Successful DNA Sequencing Read Peaks are well formed and separated with good quality scores. There is a small area at the beginning of the run before the chemistry
More informationGene Expression Assays
APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency
More informationBiological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
More informationSingle-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation
PN 100-9879 A1 TECHNICAL NOTE Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation Introduction Cancer is a dynamic evolutionary process of which intratumor genetic and phenotypic
More informationWhole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform
Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Introduction, 2 Sample Prep Workflow, 3 Best Practices, 4 DNA Input Recommendations, 6
More informationTIANquick Mini Purification Kit
TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer
More information