Goal: Learn some of the latest research in genomics Learn/practice basic programming and data mining skills

Size: px
Start display at page:

Download "Goal: Learn some of the latest research in genomics Learn/practice basic programming and data mining skills"

Transcription

1 Course outline Goal: Learn some of the latest research in genomics Learn/practice basic programming and data mining skills Structure: Lectures (4) Paper discussion (6) Workshops (5) Grading: Problem sets (2) 20 points Class participation (paper discussion) 35 points Paper reviews (2) 30 points Data analysis (1) 15 points

2 Introduction to genomics and genome sequencing: Approaches and Platforms Bio472- Spring 2016 Amanda Larracuente

3 Outline 1. History 2. Basic assembly approaches 3. First generation technology 4. Second generation technology 5. Third generation technology 6. Challenges

4 1. History History of genomics Darwin: The Origin of Species 1859

5 1. History History of genomics Mendel: laws of inheritance 1865 Avery: DNA as inherited material 1944 Watson, Crick & Franklin: DNA structure 1953

6 1. History History of genomics Arthur Kornberg: DNA polymerase 1956 Nirenberg: genetic code 1961 Gilbert and Sanger: sequencing 1977

7 Genomics 1. History

8 1. History Sanger sequenced genomes Bacteriophage lambda H. influenzae Yeast C. elegans Drosophila melanogaster Arabidopsis Human Comparative genomics!

9 Human Genome Project Discussed Projected to finish in 2005 Completed ahead of schedule in 2000 Published in 2001

10 1. History Progress in genome sequencing NHGRI at genome.gov

11 2. Basic Assembly Approaches Sequence reads Reads Sequence output from a DNA fragment Base qualities Paired-end reads Paired-end reads DNA fragment Reads from both ends of a DNA fragment Similar to or same as mate pairs (depending on platform)

12 2. Basic Assembly Approaches Genome assemblies 10 9 short sequencing reads 3Gb whole genome Human male karyotype

13 2. Basic Assembly Approaches Whole Genome Shotgun (WGS) approach Overlapping reads 1. Shear genome into 3-5kb fragments, clone into plasmids and sequence 2. Find overlapping reads contig 3. Assemble overlapping reads into contigs Mate pairs ( ( 4. Assemble contigs into scaffolds GATCGTGTCCCATTGTCAGATCGTG Finished assembly scaffold Chromosomes 5. Link scaffolds into finished sequence corresponding to chromosomes

14 2. Basic Assembly Approaches Hierarchical Approach BACs kb inserts 1. Shear genome into 150kb fragments and put in BACs 2. Create map of BACs to genome and create a tiling path Tiling path 3. Shotgun sequence individual BACs from tiling path Mate pairs 4. Assemble BAC sequences ( ( scaffold 5. Use sequenced tiling path to reconstruct genome GATCGTGTCCCATTGTCAGATCGTG Finished assembly Chromosomes

15 2. Basic Assembly Approaches Comparing assembly approaches Whole Genome Shotgun Faster Assembly is a huge computational effort Celera Genomics approach to human genome Hierarchical Slower Labor-intensive Higher quality assembly in difficult-to-assemble regions Publicly funded Human Genome Project Took >10 years and cost $3 billion

16 3. First generation technology First generation sequencing technology Shear genomic DNA Subclone into vectors Bacterial replication Isolate amplified clones Capillary sequencing

17 3. First generation technology Sanger sequencing primer% Chain termination Fluorescently labeled, modified nucleotides Capillary gel electrophoresis Fragment%size% Template%DNA% Capillary%Gel% DNA% polymerase% TCTAGAGCCTGCAATACGATC% TCTAGAGCCTGCAATACGAT% TCTAGAGCCTGCAATACGA% TCTAGAGCCTGCAATACG% TCTAGAGCCTGCAATAC% TCTAGAGCCTGCAATA% TCTAGAGCCTGCAAT% TCTAGAGCCTGCAA% TCTAGAGCCTGCA% TCTAGAGCCTGC% TCTAGAGCCTG% TCTAGAGCCT% TCTAGAGCC% TCTAGAGC% TCTAGAG% TCTAGA% TCTAG% TCTA% TCT% TC% T% TCTAGAGCCTGCAATACGATC% +" Sequence%

18 3. First generation technology Applications Sequencing PCR fragments Sequencing off plasmids Sequencing genomes Sequencing cdna libraries

19 4. Second generation technology Second generation sequencing technology Shear genomic DNA Solid support fixation Amplification Wash and Scan Base detection

20 4. Second generation technology 454 pyrosequencing a. Isolate gdna, fragment and ligate adapters b. Bind to beads and carry out emulsion PCR (empcr 1 fragment/bead) c. Break emulsion and add beads to fiber-optic slide d. Pyrosequencing reaction, 1 nt added at a time (peak height corresponds to # of nucl) a b c d Rothberg and Leamon 2008

21 4. Second generation technology Illumina Fragment gdna Ligate adapters Fix fragments on solid surface Bridge amplification to generate clusters Sequence one end (using reversible terminators) If paired-end, regenerate cluster and sequence the other end Figure from Mardis 2013

22 *more like 2.5-generation technology 4. Second generation technology Ion Torrent 1. Shear DNA, ligate adapters 2. Attach fragments to beads and amplify with empcr 4. Flow nucleotides over wells, one at a time 5. DNA polymerase incorporates bases and give off H+ 3. Place bead in wells on plate 6. Mini semi-conductor reads ph change

23 4. Second generation technology Applications Genome re-sequencing (reference based assembly) Genome sequencing (de novo assembly) Sequencing transcriptome (RNAseq) Sequencing DNA associated with proteins (CHiPseq)

24 5. Third generation technology Third generation sequencing technology Shear genomic DNA No amplification solid support fixation Base detection Single-molecule sequencing

25 5. Third generation technology Single molecule sequencing e.g. Pacific Biosciences (PacBio) Single-molecule real-time (SMRT) sequencing Real time fluorescent nucleotides Average reads >15 kb; some reads >50 kb High (~15%) error rate Eid et al. 2009

26 5. Third generation technology Applications Low-depth: Scaffolding contigs (de novo assembly) High-depth: Genome sequencing of repetitive regions or structural rearrangements

27 De novo assembly of self-corrected reads Raw reads Errorcorrected reads (~25X) Assembled Contig Overlap-layout-consensus (e.g. Celera assembler) Chin et al. 2013; Huddleston et al. 2014; Berlin et al. 2014

28 6. Challenges Comparison of NGS technologies (non-exhaustive) Method strategy Read length Error type Error rate Output per run 454 Synthesis/ pyrosequencing Up to 700bp indels 1% Mbp SOLID DNA ligase 75bp AT bias > % Gbp Illumina (HiSeq) Synthesis/DNA poly 150bp Subs. >0.1% 600 Gbp Ion Torrent H+ detection 90bp indels 1.5% 1 Gbp PacBio Single molecule/ synthesis >15kb (up to 50kb) insertions 15% Mbp (5-10 Mbp usable)

29 6. Challenges The $1000 genome Illumina! Reported January : The HiSeq X Ten, composed of 10 HiSeq X Systems, is the first sequencing platform that breaks the $1000 barrier for a 30x human genome. The HiSeq X Ten System is ideal for population-scale projects focused on the discovery of genotypic variation to understand and improve human health

30 6. Challenges Summary of technology Point: Sequencing is cheap Individual labs Current challenge Computational Data management NHGRI at genome.gov

31 6. Challenges Repetitive DNA Interspersed repeats? e.g. transposable elements Tandem repeats? e.g. satellites, CNVs

32 6. Challenges Challenges for repetitive DNA Repeat unit longer than read length (e.g. Transposable elements) Repeat unit longer than insert sizes (e.g. Transposable elements)

33 6. Challenges Challenges for repetitive DNA True Genomic sequence CCTGCGATAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGTGTACCC

34 6. Challenges Challenges for repetitive DNA True Genomic sequence CCTGCGATAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGTGTACCC Single end libraries Assembly CCTGCGATAATATGGAATATGGTGTACCC CCTGCGATAATATG CCTGCGATAATATG CGATAATATGGAA TAATATGGAATA AATATGGAATATGG AATATGGAATATGG AATATGGAATATGG AATATGGAATATGG AATATGGAATATGG AATATGGAATATGG AATATGGAATATGG GAATATGGTGTA AATATGGTGTACCC AATATGGTGTACCC

35 6. Challenges Challenges for repetitive DNA True Genomic sequence CCTGCGATAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGTGTACCC Paired end libraries Assembly CCTGCGATAATATGGAATATGGAATATGGAATATGGAATATGGTGTACCC CCTGCGATAATATG GGAATATGGA GCGATAATATGGAA ATATGGA TAATATGGAATATG GGAATATGG ATGGAATATGGAA AATATGGAATAT AATATGGAATA TATGGAATATG AATATGGAA AATATGGTGTA AATATGGAATAT TGGTGTACCC

36 6. Challenges Challenges for repetitive DNA True Genomic sequence CCTGCGATAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGTGTACCC Paired end + Mate pair libraries Assembly CCTGCGATAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGAATATGGTGTACCC CCTGCGATAATATG GGAATATGGA GCGATAATATGGAA ATATGGA TAATATGGAATATG GGAATATGG AATATGGAATA TATGGAATATG GCGATAATATG GGAATATGGAATA AATATGGAA ATATGGAATATGG TATGGAATAT ATGGAATATG AATATGGAA AATATGGTGTA AATATGGAATAT TGGTGTACCC

37 6. Challenges Repeats cause Misassemblies Complex rearrangements Gaps

38 6. Challenges Next gen applications and repeats WGS with Sanger Repetitive DNA unstable in cloning vectors Paired end/mate pairs help with assembly 454 pyrosequencing Problems with homopolymers Paired end/mate pairs help with assembly Illumina Repetitive elements longer than read length Deep coverage and mate pairs help with assembly PacBio Problem is very high error rate: requires deep coverage PacBio or short reads Read length plows through repeats

39 Further reading: Metzker Sequencing technologies the next generation. Nature Reviews. 11: Mardis Next-Generation Sequencing Platforms. Ann. Rev. Anal. Chem 6: Treangen and Salzberg Repetitive DNA and nextgeneration sequencing: computational challenges and solutions. Nature Reviews Genetics 13:36-46.

40

41 Getting on BlueHive Course scratch space: /scratch/bio472_2016 In terminal: ssh bluehive.circ.rochester.edu l username

42 Running graphical software on BlueHive Please go to: Getting_Started And Install X11 application if needed

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977

More information

Introduction to next-generation sequencing data

Introduction to next-generation sequencing data Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS

More information

An Overview of DNA Sequencing

An Overview of DNA Sequencing An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure

More information

July 7th 2009 DNA sequencing

July 7th 2009 DNA sequencing July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer

More information

Next generation DNA sequencing technologies. theory & prac-ce

Next generation DNA sequencing technologies. theory & prac-ce Next generation DNA sequencing technologies theory & prac-ce Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing

More information

DNA Sequencing & The Human Genome Project

DNA Sequencing & The Human Genome Project DNA Sequencing & The Human Genome Project An Endeavor Revolutionizing Modern Biology Jutta Marzillier, Ph.D Lehigh University Biological Sciences November 13 th, 2013 Guess, who turned 60 earlier this

More information

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova

New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova New generation sequencing: current limits and future perspectives Giorgio Valle CRIBI Università di Padova Around 2004 the Race for the 1000$ Genome started A few questions... When? How? Why? Standard

More information

Computational Genomics. Next generation sequencing (NGS)

Computational Genomics. Next generation sequencing (NGS) Computational Genomics Next generation sequencing (NGS) Sequencing technology defies Moore s law Nature Methods 2011 Log 10 (price) Sequencing the Human Genome 2001: Human Genome Project 2.7G$, 11 years

More information

Next Generation Sequencing for DUMMIES

Next Generation Sequencing for DUMMIES Next Generation Sequencing for DUMMIES Looking at a presentation without the explanation from the author is sometimes difficult to understand. This document contains extra information for some slides that

More information

Automated DNA sequencing 20/12/2009. Next Generation Sequencing

Automated DNA sequencing 20/12/2009. Next Generation Sequencing DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing

More information

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,

More information

Next Generation Sequencing: Technology, Mapping, and Analysis

Next Generation Sequencing: Technology, Mapping, and Analysis Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took

More information

Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe

Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. To published results faster With proven scalability To the forefront of discovery To limitless applications

More information

Welcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation.

Welcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation. Introduction to SMRTbell Template Preparation 100 338 500 01 1. SMRTbell Template Preparation 1.1 Introduction to SMRTbell Template Preparation Welcome to Pacific Biosciences' Introduction to SMRTbell

More information

restriction enzymes 350 Home R. Ward: Spring 2001

restriction enzymes 350 Home R. Ward: Spring 2001 restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually

More information

Introduction to NGS data analysis

Introduction to NGS data analysis Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing DNA sequence represents a single format onto which a broad range of biological phenomena can be projected for high-throughput data collection Over the past three years, massively

More information

NGS data analysis. Bernardo J. Clavijo

NGS data analysis. Bernardo J. Clavijo NGS data analysis Bernardo J. Clavijo 1 A brief history of DNA sequencing 1953 double helix structure, Watson & Crick! 1977 rapid DNA sequencing, Sanger! 1977 first full (5k) genome bacteriophage Phi X!

More information

DNA Sequence Analysis

DNA Sequence Analysis DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide

More information

Overview of Next Generation Sequencing platform technologies

Overview of Next Generation Sequencing platform technologies Overview of Next Generation Sequencing platform technologies Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Outline 1. Technologies

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

How is genome sequencing done?

How is genome sequencing done? How is genome sequencing done? Using 454 Sequencing on the Genome Sequencer FLX System, DNA from a genome is converted into sequence data through four primary steps: Step One DNA sample preparation; Step

More information

Concepts and methods in sequencing and genome assembly

Concepts and methods in sequencing and genome assembly BCM-2004 Concepts and methods in sequencing and genome assembly B. Franz LANG, Département de Biochimie Bureau: H307-15 Courrier électronique: Franz.Lang@Umontreal.ca Outline 1. Concepts in DNA and RNA

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

Illumina Sequencing Technology

Illumina Sequencing Technology Illumina Sequencing Technology Highest data accuracy, simple workflow, and a broad range of applications. Introduction Figure 1: Illumina Flow Cell Illumina sequencing technology leverages clonal array

More information

First generation" sequencing technologies and genome assembly. Roger Bumgarner Associate Professor, Microbiology, UW Rogerb@u.washington.

First generation sequencing technologies and genome assembly. Roger Bumgarner Associate Professor, Microbiology, UW Rogerb@u.washington. First generation" sequencing technologies and genome assembly Roger Bumgarner ssociate Professor, Microbiology, UW Rogerb@u.washington.edu Why discuss a technology that appears to be being replaced? Next

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing

More information

Genome Sequencing. Phil McClean September, 2005

Genome Sequencing. Phil McClean September, 2005 Genome Sequencing Phil McClean September, 2005 The concept of genome sequencing is quite simple. Break your genome up into many different small fragments, clone those fragments into a cloning vector, isolate

More information

Keeping up with DNA technologies

Keeping up with DNA technologies Keeping up with DNA technologies Mihai Pop Department of Computer Science Center for Bioinformatics and Computational Biology University of Maryland, College Park The evolution of DNA sequencing Since

More information

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long

More information

NGS Technologies for Genomics and Transcriptomics

NGS Technologies for Genomics and Transcriptomics NGS Technologies for Genomics and Transcriptomics Massimo Delledonne Department of Biotechnologies - University of Verona http://profs.sci.univr.it/delledonne 13 years and $3 billion required for the Human

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just

More information

Recombinant DNA and Biotechnology

Recombinant DNA and Biotechnology Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study

More information

Reading DNA Sequences:

Reading DNA Sequences: Reading DNA Sequences: 18-th Century Mathematics for 21-st Century Technology Michael Waterman University of Southern California Tsinghua University DNA Genetic information of an organism Double helix,

More information

Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office

Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office 2013 Laboratory Accreditation Program Audioconferences and Webinars Implementing Next Generation Sequencing (NGS) as a Clinical Tool in the Laboratory Nazneen Aziz, PhD Director, Molecular Medicine Transformation

More information

Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne

Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne Sanger Sequencing and Quality Assurance Zbigniew Rudzki Department of Pathology University of Melbourne Sanger DNA sequencing The era of DNA sequencing essentially started with the publication of the enzymatic

More information

History of DNA Sequencing & Current Applications

History of DNA Sequencing & Current Applications History of DNA Sequencing & Current Applications Christopher McLeod President & CEO, 454 Life Sciences, A Roche Company IMPORTANT NOTICE Intended Use Unless explicitly stated otherwise, all Roche Applied

More information

Recombinant DNA Unit Exam

Recombinant DNA Unit Exam Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the

More information

Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University

Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University Genotyping by sequencing and data analysis Ross Whetten North Carolina State University Stein (2010) Genome Biology 11:207 More New Technology on the Horizon Genotyping By Sequencing Timeline 2007 Complexity

More information

Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms

Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Introduction Mate pair sequencing enables the generation of libraries with insert sizes in the range of several kilobases (Kb).

More information

Bioinformatics I, WS 09-10, D. Huson, January 27, 2010 145

Bioinformatics I, WS 09-10, D. Huson, January 27, 2010 145 Bioinformatics I, WS 09-10, D. Huson, January 27, 2010 145 10 DNA sequencing This exposition is very closely based on the following sources, which are all recommended reading: 1. Clyde A. Hutchison, DNA

More information

Data Analysis for Ion Torrent Sequencing

Data Analysis for Ion Torrent Sequencing IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page

More information

14.3 Studying the Human Genome

14.3 Studying the Human Genome 14.3 Studying the Human Genome Lesson Objectives Summarize the methods of DNA analysis. State the goals of the Human Genome Project and explain what we have learned so far. Lesson Summary Manipulating

More information

G E N OM I C S S E RV I C ES

G E N OM I C S S E RV I C ES GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E

More information

Molecular and Cell Biology Laboratory (BIOL-UA 223) Instructor: Ignatius Tan Phone: 212-998-8295 Office: 764 Brown Email: ignatius.tan@nyu.

Molecular and Cell Biology Laboratory (BIOL-UA 223) Instructor: Ignatius Tan Phone: 212-998-8295 Office: 764 Brown Email: ignatius.tan@nyu. Molecular and Cell Biology Laboratory (BIOL-UA 223) Instructor: Ignatius Tan Phone: 212-998-8295 Office: 764 Brown Email: ignatius.tan@nyu.edu Course Hours: Section 1: Mon: 12:30-3:15 Section 2: Wed: 12:30-3:15

More information

Introduction Bioo Scientific

Introduction Bioo Scientific Next Generation Sequencing Catalog 2014-2015 Introduction Bioo Scientific Bioo Scientific is a global life science company headquartered in Austin, TX, committed to providing innovative products and superior

More information

DNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE

DNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE DNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE We recommend for the sequence visualization the use of software that allows the examination of raw data in order to determine quantitatively how good has

More information

FOR REFERENCE PURPOSES

FOR REFERENCE PURPOSES BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit

More information

Bioinformatic Approaches for Genome Finishing

Bioinformatic Approaches for Genome Finishing Bioinformatic Approaches for Genome Finishing Ph. D. Thesis submitted to the Faculty of Technology, Bielefeld University, Germany for the degree of Dr. rer. nat. by Peter Husemann July, 2011 Referees:

More information

Techniques in Molecular Biology (to study the function of genes)

Techniques in Molecular Biology (to study the function of genes) Techniques in Molecular Biology (to study the function of genes) Analysis of nucleic acids: Polymerase chain reaction (PCR) Gel electrophoresis Blotting techniques (Northern, Southern) Gene expression

More information

An Introduction to Next-Generation Sequencing Technology

An Introduction to Next-Generation Sequencing Technology An Introduction to Next-eneration Sequencing Technology Deciphering DNA sequences is essential for virtually all branches of biological research. With the advent of capillary electrophoresis (CE)-based

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

Core Facility Genomics

Core Facility Genomics Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray

More information

Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing

Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAAC GTGCAC GTGAAC Wouter Coppieters Head of the genomics core facility GIGA center, University of Liège Bioruptor NGS: Unbiased DNA

More information

Becker Muscular Dystrophy

Becker Muscular Dystrophy Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency

More information

Tribuna Académica. Overview of Metagenomics for Marine Biodiversity Research 1. Barton E. Slatko* Metagenomics defined

Tribuna Académica. Overview of Metagenomics for Marine Biodiversity Research 1. Barton E. Slatko* Metagenomics defined Tribuna Académica 117 Overview of Metagenomics for Marine Biodiversity Research 1 Barton E. Slatko* We are in the midst of the fastest growing revolution in molecular biology, perhaps in all of life science,

More information

Introduction. Preparation of Template DNA

Introduction. Preparation of Template DNA Procedures and Recommendations for DNA Sequencing at the Plant-Microbe Genomics Facility Ohio State University Biological Sciences Building Room 420, 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204;

More information

SEQUENCING. From Sample to Sequence-Ready

SEQUENCING. From Sample to Sequence-Ready SEQUENCING From Sample to Sequence-Ready ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES, NOT ONCE, BUT EVERY TIME The highest-quality amplicons more sensitive, accurate, and specific Full support for all major

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise: HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone

More information

Universidade Estadual de Maringá

Universidade Estadual de Maringá Universidade Estadual de Maringá Disciplina: Biologia Molecular Sequenciamento de ácidos nucléicos Profa. Dra. Maria Aparecida Fernandez Maxan e Gilbert - quebra química Berg, Gilbert and Sanger dideoxinucleotideos

More information

Chapter 6 DNA Replication

Chapter 6 DNA Replication Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore

More information

SNP genotyping. Gene expression. And now Solexa sequencing.

SNP genotyping. Gene expression. And now Solexa sequencing. SNP genotyping. Gene expression. And now Solexa sequencing. Let s find the answers together. It s your research. You question. You test. You want answers quickly, accurately, and at a good value. Illumina

More information

An example of bioinformatics application on plant breeding projects in Rijk Zwaan

An example of bioinformatics application on plant breeding projects in Rijk Zwaan An example of bioinformatics application on plant breeding projects in Rijk Zwaan Xiangyu Rao 17-08-2012 Introduction of RZ Rijk Zwaan is active worldwide as a vegetable breeding company that focuses on

More information

A Primer of Genome Science THIRD

A Primer of Genome Science THIRD A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:

More information

Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011

Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011 Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)

More information

Genetics 301 Sample Final Examination Spring 2003

Genetics 301 Sample Final Examination Spring 2003 Genetics 301 Sample Final Examination Spring 2003 50 Multiple Choice Questions-(Choose the best answer) 1. A cross between two true breeding lines one with dark blue flowers and one with bright white flowers

More information

Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.

Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question. Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists

More information

PROYECTO GENOMA HUMANO. Medicina Molecular 2011 Maestría en Biología Molecular Médica- UBA

PROYECTO GENOMA HUMANO. Medicina Molecular 2011 Maestría en Biología Molecular Médica- UBA PROYECTO GENOMA HUMANO Medicina Molecular 2011 Maestría en Biología Molecular Médica- UBA GENOMA HUMANO Medicina Molecular 2011 Maestría en Biología Molecular Médica- UBA Some landmarks on the way to 1940s

More information

An Introduction to Next-Generation Sequencing Technology

An Introduction to Next-Generation Sequencing Technology n Introduction to Next-eneration Sequencing echnology Part II: n overview of DN Sequencing pplications Diverse pplications Next-generation sequencing (NS) platforms enable a wide variety of applications,

More information

Genomics Services @ GENterprise

Genomics Services @ GENterprise Genomics Services @ GENterprise since 1998 Mainz University spin-off privately financed 6-10 employees since 2006 Genomics Services @ GENterprise Sequencing Service (Sanger/3730, 454) Genome Projects (Bacteria,

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium

More information

TruSeq Custom Amplicon v1.5

TruSeq Custom Amplicon v1.5 Data Sheet: Targeted Resequencing TruSeq Custom Amplicon v1.5 A new and improved amplicon sequencing solution for interrogating custom regions of interest. Highlights Figure 1: TruSeq Custom Amplicon Workflow

More information

Nucleic Acid Techniques in Bacterial Systematics

Nucleic Acid Techniques in Bacterial Systematics Nucleic Acid Techniques in Bacterial Systematics Edited by Erko Stackebrandt Department of Microbiology University of Queensland St Lucia, Australia and Michael Goodfellow Department of Microbiology University

More information

DNA sequencing is the process of determining the precise order of the nucleotide bases in a particular DNA molecule. In 1974, two methods of DNA

DNA sequencing is the process of determining the precise order of the nucleotide bases in a particular DNA molecule. In 1974, two methods of DNA BIO440 Genetics Laboratory DNA sequencing DNA sequencing is the process of determining the precise order of the nucleotide bases in a particular DNA molecule. In 1974, two methods of DNA sequencing were

More information

Complete Genomics Sequencing

Complete Genomics Sequencing TECHNOLOGY OVERVIEW Complete Genomics Sequencing Introduction With advances in nanotechnology, high-throughput instruments, and large-scale computing, it has become possible to sequence a complete human

More information

Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling

Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling Lectures 1 and 8 15 February 7, 2013 This is a review of the material from lectures 1 and 8 14. Note that the material from lecture 15 is not relevant for the final exam. Today we will go over the material

More information

Ariella Syma Sasson ALL RIGHTS RESERVED

Ariella Syma Sasson ALL RIGHTS RESERVED 2010 Ariella Syma Sasson ALL RIGHTS RESERVED FROM MILLIONS TO ONE: THEORETICAL AND CONCRETE APPROACHES TO DE NOVO ASSEMBLY USING SHORT READ DNA SEQUENCES by ARIELLA SYMA SASSON A Dissertation submitted

More information

Bioanalyzer Applications for

Bioanalyzer Applications for Bioanalyzer Applications for Next-Gen Sequencing: Updates and Tips March 1 st, 2011 Charmian Cher, Ph.D Field Applications Scientist Page 1 Agenda 1 2 3 Next-gen sequencing library preparation workflow

More information

RESTRICTION DIGESTS Based on a handout originally available at

RESTRICTION DIGESTS Based on a handout originally available at RESTRICTION DIGESTS Based on a handout originally available at http://genome.wustl.edu/overview/rst_digest_handout_20050127/restrictiondigest_jan2005.html What is a restriction digests? Cloned DNA is cut

More information

Sanger Sequencing. Troubleshooting Guide. Failed sequence

Sanger Sequencing. Troubleshooting Guide. Failed sequence Sanger Sequencing Troubleshooting Guide Below are examples of the main problems experienced in ABI Sanger sequencing. Possible causes for failure and their solutions are listed below each example. The

More information

1865 Discovery: Heredity Transmitted in Units

1865 Discovery: Heredity Transmitted in Units 1859 Discovery: Natural Selection Genetic Timeline Charles Darwin wrote On the Origin of Species by Means of Natural Selection, or the Preservation of Favored Races in the Struggle for Life. 1865 Discovery:

More information

Difficult DNA Templates Sequencing. Primer Walking Service

Difficult DNA Templates Sequencing. Primer Walking Service Difficult DNA Templates Sequencing Primer Walking Service Result 16/18s (ITS 5.8s) rrna Sequencing Phylogenetic tree 16s rrna Region ITS rrna Region ITS and 26s rrna Region Order and Result Cloning Service

More information

Human Genome and Human Genome Project. Louxin Zhang

Human Genome and Human Genome Project. Louxin Zhang Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular

More information

Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes

Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes 2.1 Introduction Large-scale insertional mutagenesis screening in

More information

Gene Cloning. Reference. T.A. Brown, Gene Cloning, Chapman and Hall. S.B. Primrose, Molecular Biotechnology, Blackwell

Gene Cloning. Reference. T.A. Brown, Gene Cloning, Chapman and Hall. S.B. Primrose, Molecular Biotechnology, Blackwell Gene Cloning 2004 Seungwook Kim Chem. & Bio. Eng. Reference T.A. Brown, Gene Cloning, Chapman and Hall S.B. Primrose, Molecular Biotechnology, Blackwell Why Gene Cloning is Important? A century ago, Gregor

More information

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold

More information

Description: Molecular Biology Services and DNA Sequencing

Description: Molecular Biology Services and DNA Sequencing Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:

More information

Genome Sequencer 20 System. First to the Finish. www.roche-applied-science.com

Genome Sequencer 20 System. First to the Finish. www.roche-applied-science.com Genome Sequencer 20 System First to the Finish www.roche-applied-science.com Technology 4-5 Process Steps 8-11 DNA Library Preparation 8 empcr Amplification 9 Sequencing-by-Synthesis 10-11 The Genome Sequencer

More information

BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls?

BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? Giovanni Luca Scaglione, PhD ------------------------ Laboratory of Clinical Molecular Diagnostics and Personalized Medicine, Institute

More information

1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.

1. Molecular computation uses molecules to represent information and molecular processes to implement information processing. Chapter IV Molecular Computation These lecture notes are exclusively for the use of students in Prof. MacLennan s Unconventional Computation course. c 2013, B. J. MacLennan, EECS, University of Tennessee,

More information

DNA Sequencing Troubleshooting Guide

DNA Sequencing Troubleshooting Guide DNA Sequencing Troubleshooting Guide Successful DNA Sequencing Read Peaks are well formed and separated with good quality scores. There is a small area at the beginning of the run before the chemistry

More information

Gene Expression Assays

Gene Expression Assays APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency

More information

Biological Sciences Initiative. Human Genome

Biological Sciences Initiative. Human Genome Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.

More information

Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation

Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation PN 100-9879 A1 TECHNICAL NOTE Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation Introduction Cancer is a dynamic evolutionary process of which intratumor genetic and phenotypic

More information

Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform

Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Introduction, 2 Sample Prep Workflow, 3 Best Practices, 4 DNA Input Recommendations, 6

More information

TIANquick Mini Purification Kit

TIANquick Mini Purification Kit TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer

More information