DNA Sequencing: The Past, the Present and the Future
|
|
|
- Emery McDonald
- 9 years ago
- Views:
Transcription
1 STARS Mini-Symposium 9/12/2016 DNA Sequencing: The Past, the Present and the Future Ralf Kittler, Ph.D. McDermott Center for Human Growth and Development Outline DNA sequencing is a biochemical method to determine the sequence of the nucleotide bases that make up the DNA 1. The Past Sanger Sequencing 2. The Present Illumina Sequencing 3. The Future Single Molecule Sequencing 1
2 Part 1 The past Sanger Sequencing (First-Generation Sequencing) The Discovery of the DNA Structure 1953 WATSON and CRICK describe the structure of DNA based on the X-ray analyses of FRANKLIN and WILKINS Photograph 51 Watson-Crick Model (Franklin R and Gosling R, 1953) (Watson J and Crick F, 1953) 2
3 DNA Structure Genetic information is contained in the order of the bases (Sequence) DNA structure provides the basis for replication and transcription by using a single strand as a template (Base pairing) 2013 Nature Education DNA Polymerase 1957 KORNBERG discovers DNA polymerase as enzyme for DNA replication (Molecular Biology: Principles and Practice, 2012) Complementary nucleotide is incorporated by forming a phosphoester bond with the 3 OH of the deoxyribose of the preceding nucleotide (strand extension) 3
4 Molecular Cloning 1970 BERG, BOYER, and COHEN develop Molecular Cloning Restric0on enzyme + Ligase Molecular cloning allows isolation, amplification and manipulation of specific DNA fragments First-Generation Sequencing 1977 SANGER develops chain-termination sequencing (Sanger sequencing) GILBERT and MAXAM develop sequencing by base-specific chemical fragmentation Walter Gilbert Frederick Sanger 4
5 Sanger Sequencing: Dideoxynucleotides (ddntps) Chain Termination by ddntp Incorporation (Molecular Biology: Principles and Practice, 2012) For Sanger sequencing ratio of dntp:ddntp 100:1 è Mixture of terminated strands is produced è The identity of the last incorporated base can be identified by gel electrophoresis and radioactive, or fluorescent detection 5
6 Sanger Sequencing 1.0 ( s) Gel electrophoresis Detection of radioactive DNA strands Manual process Sanger Sequencing 1.0 ( s) (Sanger et al., 1977, PNAS) 6
7 Fluorescent ddntps Fluorophore ddatp ddttp ddgtp ddctp Sanger Sequencing 2.0 (1990s-present) Fluorescently labeled ddntps Gel electrophoresis T Detection of fluorescent products Automated process 7
8 Sanger Sequencing at UT Southwestern ABI 3730xl DNA Analyzer (Capillary Sequencer) 96 DNA samples with ~700 nucleotide reads (~ 70,000 bases) in 2.5 hours Sanger Sequencing at UT Southwestern Detected fluorescent DNA products A single trace (electropherogram) CCACCCGCAGTTCGAAAAAGG Sequence 8
9 Sanger Sequencing Enabled Genome Sequencing 1995 First bacterial genome (Haemophilus influenzae) sequenced 2001 First draft of the human genome published Part 2 The Present Illumina Sequencing (Next-Generation Sequencing) 9
10 Impact of Next-Generation Sequencing Illumina NextSeq Flow Cell 400,000,000 DNA fragments X 300 nucleotides = 120,000,000,000 nucleotides in 29 hours 10
11 Illumina Sequencing Benchmarks NextSeq 500 The Human Genome Project vs. 1 Technician 29 hours $ ,000,000,000 nucleotides Human genome X 40 >1000 Scientists 13 years ( ) $3,000,000,000 24,000,000,000 nucleotides Human genome X 8 Illumina Sequencing is Scalable HiSeq X Ten: Single device has 15X capacity of the NextSeq 500 Cost for sequencing of a human genome (at 40X): ~$
12 Next-Generation Sequencing Technological advances that enabled massively parallel sequencing: 1. Miniaturization of clonal amplification of millions of individual DNA fragments on a solid support Illumina sequencing: Bridge Polymerase Chain Reaction (PCR) 2. Sequencing reaction chemistry that can be performed on clonally amplified DNA fragments on a solid support Illumina sequencing: Cyclic-reversible termination sequencing DNA Amplification: Polymerase Chain Reaction (PCR) 2014 Nature Education 12
13 Illumina Sequencing: Bridge PCR Library generation Attach DNA to surface Bridge PCR Illumina, Inc. Illumina Sequencing: Bridge PCR DNA fragment after 1 st amplification step Denaturation and next amplification step Clusters after multiple amplification cycles Illumina, Inc. 13
14 Reversible Terminator Nucleotides Sanger Sequencing Fluorophore Illumina Sequencing Fluorophore Cleavable Cleavable 3 blocking group Reversible terminator nucleotide Illumina Sequencing Reaction Sequencing by synthesis with reversible terminators Imaging after each cycle (Metzker M, 2010) 14
15 Part 3 The Future Single-Molecule Sequencing (Third-Generation Sequencing) PacBio Sequencing PacBio RSII 15
16 PacBio Sequencing Single Molecule, Real-Time (SMRT) Sequencing DNA polymerase PacBio Sequencing Advantages No amplification required Fast (> 1 nucleotide per second) Long reads (10,000-15,000 bases vs bases for Illumina) Disadvantages Lower throughput (35,000-70,000 reads per run) Lower sequence yield (~5% of Illumina) High sequencing error rate (single pass 13% vs. 0.1%) 16
17 Nanopore Sequencing Phi29 polymerase Hemolysin Electric field because of differences in ion concentration across the membrane DNA moving through pore affects ion current in a base-specific manner ( electric signature ) Electric field Changes in current are measured and recorded to determine the DNA sequence (Nature Biotechnology 30, , 2012) Oxford Nanopore Technologies: MinIon Real-time, long reads, but low through-put and high error rate Forbes.com 17
18 The Future: Solid-state Nanopore Sequencing (Nature 467, , 2010) The McDermott NGS Core 18
- In 1976 1977, Allan Maxam and walter Gilbert devised the first method for sequencing DNA fragments containing up to ~ 500 nucleotides.
DNA Sequencing - DNA sequencing includes several methods and technologies that are used for determining the order of the nucleotide bases adenine, guanine, cytosine, and thymine in a molecule of DNA. -
Introduction to next-generation sequencing data
Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS
Next Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
1/12 Dideoxy DNA Sequencing
1/12 Dideoxy DNA Sequencing Dideoxy DNA sequencing utilizes two steps: PCR (polymerase chain reaction) amplification of DNA using dideoxy nucleoside triphosphates (Figures 1 and 2)and denaturing polyacrylamide
Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
July 7th 2009 DNA sequencing
July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer
An Overview of DNA Sequencing
An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure
Universidade Estadual de Maringá
Universidade Estadual de Maringá Disciplina: Biologia Molecular Sequenciamento de ácidos nucléicos Profa. Dra. Maria Aparecida Fernandez Maxan e Gilbert - quebra química Berg, Gilbert and Sanger dideoxinucleotideos
How is genome sequencing done?
How is genome sequencing done? Using 454 Sequencing on the Genome Sequencer FLX System, DNA from a genome is converted into sequence data through four primary steps: Step One DNA sample preparation; Step
Electrophoresis, cleaning up on spin-columns, labeling of PCR products and preparation extended products for sequencing
Electrophoresis, cleaning up on spin-columns, labeling of PCR products and preparation extended products for sequencing PAGE electrophoresis Polyacrylamide gel electrophoresis (PAGE) is used for separating
1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.
Chapter IV Molecular Computation These lecture notes are exclusively for the use of students in Prof. MacLennan s Unconventional Computation course. c 2013, B. J. MacLennan, EECS, University of Tennessee,
Concepts and methods in sequencing and genome assembly
BCM-2004 Concepts and methods in sequencing and genome assembly B. Franz LANG, Département de Biochimie Bureau: H307-15 Courrier électronique: [email protected] Outline 1. Concepts in DNA and RNA
The Techniques of Molecular Biology: Forensic DNA Fingerprinting
Revised Fall 2011 The Techniques of Molecular Biology: Forensic DNA Fingerprinting The techniques of molecular biology are used to manipulate the structure and function of molecules such as DNA and proteins
Illumina Sequencing Technology
Illumina Sequencing Technology Highest data accuracy, simple workflow, and a broad range of applications. Introduction Figure 1: Illumina Flow Cell Illumina sequencing technology leverages clonal array
How many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
Automated DNA sequencing 20/12/2009. Next Generation Sequencing
DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing
DNA Sequence Analysis
DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide
NGS data analysis. Bernardo J. Clavijo
NGS data analysis Bernardo J. Clavijo 1 A brief history of DNA sequencing 1953 double helix structure, Watson & Crick! 1977 rapid DNA sequencing, Sanger! 1977 first full (5k) genome bacteriophage Phi X!
Biotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
Forensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
Sequencing the Human Genome
Revised and Updated Edvo-Kit #339 Sequencing the Human Genome 339 Experiment Objective: In this experiment, students will read DNA sequences obtained from automated DNA sequencing techniques. The data
The Structure, Replication, and Chromosomal Organization of DNA
Michael Cummings Chapter 8 The Structure, Replication, and Chromosomal Organization of DNA David Reisman University of South Carolina History of DNA Discoveries Friedrich Miescher Isolated nuclein from
Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
Next generation DNA sequencing technologies. theory & prac-ce
Next generation DNA sequencing technologies theory & prac-ce Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing
DNA Sequencing & The Human Genome Project
DNA Sequencing & The Human Genome Project An Endeavor Revolutionizing Modern Biology Jutta Marzillier, Ph.D Lehigh University Biological Sciences November 13 th, 2013 Guess, who turned 60 earlier this
The Biotechnology Education Company
EDVTEK P.. Box 1232 West Bethesda, MD 20827-1232 The Biotechnology 106 EDV-Kit # Principles of DNA Sequencing Experiment bjective: The objective of this experiment is to develop an understanding of DNA
Computational Genomics. Next generation sequencing (NGS)
Computational Genomics Next generation sequencing (NGS) Sequencing technology defies Moore s law Nature Methods 2011 Log 10 (price) Sequencing the Human Genome 2001: Human Genome Project 2.7G$, 11 years
DNA. Discovery of the DNA double helix
DNA Replication DNA Discovery of the DNA double helix A. 1950 s B. Rosalind Franklin - X-ray photo of DNA. C. Watson and Crick - described the DNA molecule from Franklin s X-ray. What is DNA? Question:
Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling
Lectures 1 and 8 15 February 7, 2013 This is a review of the material from lectures 1 and 8 14. Note that the material from lecture 15 is not relevant for the final exam. Today we will go over the material
Introduction. Preparation of Template DNA
Procedures and Recommendations for DNA Sequencing at the Plant-Microbe Genomics Facility Ohio State University Biological Sciences Building Room 420, 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204;
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA
DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence
2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
Name: Date: Period: DNA Unit: DNA Webquest
Name: Date: Period: DNA Unit: DNA Webquest Part 1 History, DNA Structure, DNA Replication DNA History http://www.dnaftb.org/dnaftb/1/concept/index.html Read the text and answer the following questions.
DNA sequencing. Dideoxy-terminating sequencing or Sanger dideoxy sequencing
DNA sequencing Dideoxy-terminating sequencing or Sanger dideoxy sequencing Tools DNA template (single stranded) Specific primer (usually 17-23 mer, free 3 -OH) dntps DNA polymerase capacity of polymerizing
Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.
Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists
Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne
Sanger Sequencing and Quality Assurance Zbigniew Rudzki Department of Pathology University of Melbourne Sanger DNA sequencing The era of DNA sequencing essentially started with the publication of the enzymatic
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
Chapter 11: Molecular Structure of DNA and RNA
Chapter 11: Molecular Structure of DNA and RNA Student Learning Objectives Upon completion of this chapter you should be able to: 1. Understand the major experiments that led to the discovery of DNA as
IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR)
IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) Background Infectious diseases caused by pathogenic organisms such as bacteria, viruses, protozoa,
First generation" sequencing technologies and genome assembly. Roger Bumgarner Associate Professor, Microbiology, UW [email protected].
First generation" sequencing technologies and genome assembly Roger Bumgarner ssociate Professor, Microbiology, UW [email protected] Why discuss a technology that appears to be being replaced? Next
Answer: 2. Uracil. Answer: 2. hydrogen bonds. Adenine, Cytosine and Guanine are found in both RNA and DNA.
Answer: 2. Uracil Adenine, Cytosine and Guanine are found in both RNA and DNA. Thymine is found only in DNA; Uracil takes its (Thymine) place in RNA molecules. Answer: 2. hydrogen bonds The complementary
2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
Structure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
CCR Biology - Chapter 8 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 8 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What did Hershey and Chase know
Gene Mapping Techniques
Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction
DNA sequencing is the process of determining the precise order of the nucleotide bases in a particular DNA molecule. In 1974, two methods of DNA
BIO440 Genetics Laboratory DNA sequencing DNA sequencing is the process of determining the precise order of the nucleotide bases in a particular DNA molecule. In 1974, two methods of DNA sequencing were
Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
Welcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation.
Introduction to SMRTbell Template Preparation 100 338 500 01 1. SMRTbell Template Preparation 1.1 Introduction to SMRTbell Template Preparation Welcome to Pacific Biosciences' Introduction to SMRTbell
New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova
New generation sequencing: current limits and future perspectives Giorgio Valle CRIBI Università di Padova Around 2004 the Race for the 1000$ Genome started A few questions... When? How? Why? Standard
Biology Final Exam Study Guide: Semester 2
Biology Final Exam Study Guide: Semester 2 Questions 1. Scientific method: What does each of these entail? Investigation and Experimentation Problem Hypothesis Methods Results/Data Discussion/Conclusion
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office
2013 Laboratory Accreditation Program Audioconferences and Webinars Implementing Next Generation Sequencing (NGS) as a Clinical Tool in the Laboratory Nazneen Aziz, PhD Director, Molecular Medicine Transformation
Real-Time PCR Vs. Traditional PCR
Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives
Procedures For DNA Sequencing
Procedures For DNA Sequencing Plant-Microbe Genomics Facility (PMGF) Ohio State University 420 Biological Sciences Building 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204 FAX: 614/292-6337
DNA Replication in Prokaryotes
OpenStax-CNX module: m44488 1 DNA Replication in Prokaryotes OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,
Replication Study Guide
Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have
Chapter 6 DNA Replication
Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore
DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3
DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can
Next Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University [email protected] http://tandem.bu.edu/ The Human Genome Project took
Nucleic Acid Techniques in Bacterial Systematics
Nucleic Acid Techniques in Bacterial Systematics Edited by Erko Stackebrandt Department of Microbiology University of Queensland St Lucia, Australia and Michael Goodfellow Department of Microbiology University
Basic Concepts of DNA, Proteins, Genes and Genomes
Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate
DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
DNA SEQUENCING (using an ABI automated sequencer)
DNA SEQUENCING (using an ABI automated sequencer) OBTECTIVE: To label and separate DNA fragments varying by single nucleotides, in order to determine the sequence of nucleotides. INTRODUCTION: Determination
Recombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
Molecular and Cell Biology Laboratory (BIOL-UA 223) Instructor: Ignatius Tan Phone: 212-998-8295 Office: 764 Brown Email: ignatius.tan@nyu.
Molecular and Cell Biology Laboratory (BIOL-UA 223) Instructor: Ignatius Tan Phone: 212-998-8295 Office: 764 Brown Email: [email protected] Course Hours: Section 1: Mon: 12:30-3:15 Section 2: Wed: 12:30-3:15
Bioinformatics I, WS 09-10, D. Huson, January 27, 2010 145
Bioinformatics I, WS 09-10, D. Huson, January 27, 2010 145 10 DNA sequencing This exposition is very closely based on the following sources, which are all recommended reading: 1. Clyde A. Hutchison, DNA
Part One Sanger DNA Sequencing
Part One Sanger DNA Sequencing Next-Generation Genome Sequencing: Towards Personalized Medicine. Edited by Michal Janitz Copyright Ó 2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim ISBN: 978-3-527-32090-5
DNA and Forensic Science
DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
Next Generation Sequencing for DUMMIES
Next Generation Sequencing for DUMMIES Looking at a presentation without the explanation from the author is sometimes difficult to understand. This document contains extra information for some slides that
HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:
HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone
VLLM0421c Medical Microbiology I, practical sessions. Protocol to topic J10
Topic J10+11: Molecular-biological methods + Clinical virology I (hepatitis A, B & C, HIV) To study: PCR, ELISA, your own notes from serology reactions Task J10/1: DNA isolation of the etiological agent
Ms. Campbell Protein Synthesis Practice Questions Regents L.E.
Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide
1865 Discovery: Heredity Transmitted in Units
1859 Discovery: Natural Selection Genetic Timeline Charles Darwin wrote On the Origin of Species by Means of Natural Selection, or the Preservation of Favored Races in the Struggle for Life. 1865 Discovery:
The Central Dogma of Molecular Biology
Vierstraete Andy (version 1.01) 1/02/2000 -Page 1 - The Central Dogma of Molecular Biology Figure 1 : The Central Dogma of molecular biology. DNA contains the complete genetic information that defines
Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University
Genotyping by sequencing and data analysis Ross Whetten North Carolina State University Stein (2010) Genome Biology 11:207 More New Technology on the Horizon Genotyping By Sequencing Timeline 2007 Complexity
restriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
Troubleshooting Sequencing Data
Troubleshooting Sequencing Data Troubleshooting Sequencing Data No recognizable sequence (see page 7-10) Insufficient Quantitate the DNA. Increase the amount of DNA in the sequencing reactions. See page
DNA PROFILING IN FORENSIC SCIENCE
DA PROFILIG I FORESIC SCIECE DA is the chemical code that is found in every cell of an individual's body, and is unique to each individual. Because it is unique, the ability to examine DA found at a crime
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the
Bio 102 Practice Problems Chromosomes and DNA Replication
Bio 102 Practice Problems Chromosomes and DNA Replication Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which one of the following enzymes is NT a key player in the process
Artisan Scientific is You~ Source for: Quality New and Certified-Used/Pre:-awned ECJuiflment
Looking for more information? Visit us on the web at http://www.artisan-scientific.com for more information: Price Quotations Drivers Technical Specifications. Manuals and Documentation Artisan Scientific
Beginner s Guide to Real-Time PCR
Beginner s Guide to Real-Time PCR 02 Real-time PCR basic principles PCR or the Polymerase Chain Reaction has become the cornerstone of modern molecular biology the world over. Real-time PCR is an advanced
Transcription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
INDUSTRY OVERVIEW LIFE SCIENCES RESEARCH PRODUCTS AND SERVICES. Overview
The information and statistics set out in this section and other sections of this document were extracted from different official government publications, available sources from public market research
Molecular Genetics. RNA, Transcription, & Protein Synthesis
Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and
Introduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
Essentials of Real Time PCR. About Sequence Detection Chemistries
Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected
The Steps. 1. Transcription. 2. Transferal. 3. Translation
Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order
Recombinant DNA Unit Exam
Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the
Objectives: Vocabulary:
Introduction to Agarose Gel Electrophoresis: A Precursor to Cornell Institute for Biology Teacher s lab Author: Jennifer Weiser and Laura Austen Date Created: 2010 Subject: Molecular Biology and Genetics
DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH)
DNA, RNA, replication, translation, and transcription Overview Recall the central dogma of biology: DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) DNA structure
DNA Sequencing. Contents. Introduction. Maxam-Gilbert
DNA Sequencing Contents Introduction... 1 Maxam-Gilbert... 1 Sanger... 3 Automated Fluorescence Sequencing... 5 References... 8 Introduction Prior to the mid-1970 s no method existed by which DNA could
Proteins and Nucleic Acids
Proteins and Nucleic Acids Chapter 5 Macromolecules: Proteins Proteins Most structurally & functionally diverse group of biomolecules. : o Involved in almost everything o Enzymes o Structure (keratin,
