Size: px
Start display at page:

Download "Biology [SBI 4U] FINAL EXAMINATION"


1 Biology [SBI 4U] FINAL EXAMINATION Date: November 28, 2012 (Wednesday) Time: 8:30 a.m. 10:30 a.m. Length: 2 hours Lecturer: Ms. Kimberley Gagnon Canadian International Matriculation Programme Student Name: Period: Please read the following instructions carefully before you begin the examination: 1. This exam paper has 15 printed pages, including this cover page. 2. The examination is worth 30 percent of your final mark. 3. The examination consists of four parts: PART A, B, C and D. PARTS CONTENT MARKS A Knowledge and Understanding 30, allow 25 minutes B Communication 24, allow 25 minutes C Thinking and Investigation 40, allow 50 minutes D Application 16, allow 20 minutes TOTAL Answer all sections on the exam paper. 5. Read all instructions carefully for each section. 6. Answers must be written in standard English format for an academic audience. Dictionaries (electronic or paper) are not permitted. 7. All answers must be written in black or blue pen only. For office use only: Part A Part B Part C Part D Total

2 Page 2 of 11 Part A: Knowledge and Understanding (25 marks, allow 25 minutes) Multiple Choice: Circle the letter of the choice that best completes the statement or answers the question and then write the letter you have circled on the line to the left of the question.

3 Page 3 of 11 Part B: Communication (24 marks, allow 25 minutes) Short Answer: Write the most appropriate answer in the space provided. All answers should be in POINT FORM ONLY. 1. a. Name the following isomers. (3 marks) b. One of the above isomers carbon chain is not labelled correctly. Renumber the incorrect carbons in the above diagram. (1 mark) c. Which two monosaccharides will form the disaccharide, maltose. (2 marks) 2. Aerobic cellular respiration consists of four steps. List these steps. (4 marks) Outline the role of these enzymes in DNA replication in eukaryotic cells: helicase, primase, polymerase. ligase. (4 marks)

4 Page 4 of Distinguish between mrna and trna. (2 marks) 5. Transcribe and then translate the following anti-sense strand of DNA to determine the amino acid sequence. Use the Genetic Code given on page 15. (3 marks) Anti-Sense DNA SEQUENCE - 3 TACCGGCGGTAGGCGCATTTTTCAGCAATT 5 6. What is a frameshift mutation? Give an example to show how it can affect the resulting polypeptide? (3 marks) 7. Suppose that a neuron was unable to use active transport to move sodium and potassium ions across the neuronal membrane. Describe the effect on the resting potential of the neuron. (2 marks)

5 Page 5 of 11 Part C: Thinking and Investigation (40 marks, allow 50 minutes) Graphics: For the following questions, use the graphics provided to review terms or skills. Add any missing labels, draw any missing parts, or use the graphics to help you answer a question. 1. Tropic hormones act on other endocrine glands. In these loops, the hormone secreted by the target gland will affect other tissues in the body, such as the bones and muscles. Fill in the blanks on the following diagram. (7 marks) 2. How is the depolarization of the plasma membrane of a neuron produced? Include a fully labeled diagram of the plasma membrane to show how depolarization occurs. (6 marks)

6 Page 6 of The following diagram shows the structural formula of ATP. Label the three phosphate groups, the highenergy bonds, adenine, ribose, and adenosine monophosphate. (4 marks) 4. Label this diagram of the translation complex. Hint: 1 mark per label. (8 marks) 5. Technology allows humans to increase the carrying capacity of their environment. Explain why. (2 marks)

7 Page 7 of The eukaryotic cell is different from the prokaryotic cell. Outline the structural difference between these two types of cell, suggest two reasons why eukaryotic mrna needs to be modified before translation, and state the three modifications. (7 marks) 7. Use the following information to answer the next question. (3 marks) A population of 500 fish faced a problem of biological magnification resulting in a large number of deaths that reduced the population to 350. But 200 births also took place and 27 fish immigrated into the population while 15 fish migrated out. Calculate the number of deaths which took place in the population. 8. Use the following information to answer the next question. (2 marks) The density of mosquitoes in a sample collected from a pond was found to be 172 mosquitoes/ml. The number of mosquitoes in the sample collected was 893. Calculate the volume of the water sample taken from the pond.

8 Page 8 of 11 Part D: Application (16 marks, allow 20 minutes) Answer FOUR (4) of the following questions ONLY. If you attempt more than FOUR questions CIRCLE the questions you want marked otherwise the first FOUR will be marked. For the following questions, write the answer in the space provided. Use complete sentences in your answer. 1. During a physical examination, a doctor conducted a urinalysis on a patient. The doctor found a concentration of more than 2000 mg/dl of protein in the urine. What might the doctor suspect? Explain your reasoning. (4 marks) 2. During an investigation of a crime scene, detectives find a hair sample that has a follicle attached. The sample is taken to a forensic lab for analysis. State the technique, then list, in order, the steps the lab would follow to amplify the sample for further analysis. (4 marks)

9 Page 9 of a. Why are genetically engineered herbicide-resistant crops a concern, with respect to the environment? (2 marks) b. Why are genetically engineered food organisms a concern, with respect to public health? (2 marks) 4. The macrophage is a large white blood cell responsible for the phagocytosis of pathogens and dead cellular material. These cells help reduce inflammation by removing material that sustains bacteria. When unregulated, these cells can create damage to healthy cells. Explain how this could create a problem in a human body using two specific examples. (4 marks)

10 Page 10 of One of the few positive feedback systems in humans involves oxytocin. Oxytocin sustains the lactating breast. Continued nursing by the offspring sends a signal to the hypothalamus of the mother to continue releasing oxytocin. As well, oxytocin inhibits the release of LH and FSH from the posterior pituitary. What is the selective advantage of this homeostatic system for humans? (4 marks) 6. A group of male and female rabbits are introduced to an island in which there are no natural predators. The rabbits are able to find food and shelter on the island. Describe the growth of this rabbit population under these circumstances, and explain your reasoning. (4 marks)

11 Genetic code Page 11 of 11

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Molecular Genetics. RNA, Transcription, & Protein Synthesis Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and

More information

Given these characteristics of life, which of the following objects is considered a living organism? W. X. Y. Z.

Given these characteristics of life, which of the following objects is considered a living organism? W. X. Y. Z. Cell Structure and Organization 1. All living things must possess certain characteristics. They are all composed of one or more cells. They can grow, reproduce, and pass their genes on to their offspring.

More information

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination

More information

Control of Gene Expression

Control of Gene Expression Home Gene Regulation Is Necessary? Control of Gene Expression By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring

More information

Cellular Respiration Worksheet 1. 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain.

Cellular Respiration Worksheet 1. 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain. Cellular Respiration Worksheet 1 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain. 2. Where in the cell does the glycolysis part of cellular

More information

MCAS Biology. Review Packet

MCAS Biology. Review Packet MCAS Biology Review Packet 1 Name Class Date 1. Define organic. THE CHEMISTRY OF LIFE 2. All living things are made up of 6 essential elements: SPONCH. Name the six elements of life. S N P C O H 3. Elements

More information

Academic Nucleic Acids and Protein Synthesis Test

Academic Nucleic Acids and Protein Synthesis Test Academic Nucleic Acids and Protein Synthesis Test Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. Each organism has a unique combination

More information

Complex multicellular organisms are produced by cells that switch genes on and off during development.

Complex multicellular organisms are produced by cells that switch genes on and off during development. Home Control of Gene Expression Gene Regulation Is Necessary? By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring

More information


NO CALCULATORS OR CELL PHONES ALLOWED Biol 205 Exam 1 TEST FORM A Spring 2008 NAME Fill out both sides of the Scantron Sheet. On Side 2 be sure to indicate that you have TEST FORM A The answers to Part I should be placed on the SCANTRON SHEET.

More information


PRACTICE TEST QUESTIONS PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.

More information

Keystone Review Practice Test Module A Cells and Cell Processes. 1. Which characteristic is shared by all prokaryotes and eukaryotes?

Keystone Review Practice Test Module A Cells and Cell Processes. 1. Which characteristic is shared by all prokaryotes and eukaryotes? Keystone Review Practice Test Module A Cells and Cell Processes 1. Which characteristic is shared by all prokaryotes and eukaryotes? a. Ability to store hereditary information b. Use of organelles to control

More information

How to Use this Practice Exam:

How to Use this Practice Exam: How to Use this Practice Exam: I post practice exams to allow you to get a real sense of the experience of taking a Biology 200 exam. The best way to use each exam is as follows. 1. Do NOT answer the questions

More information

Genetics Module B, Anchor 3

Genetics Module B, Anchor 3 Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for

More information

The Steps. 1. Transcription. 2. Transferal. 3. Translation

The Steps. 1. Transcription. 2. Transferal. 3. Translation Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order

More information

Activity 7.21 Transcription factors

Activity 7.21 Transcription factors Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

Biology Final Exam Study Guide: Semester 2

Biology Final Exam Study Guide: Semester 2 Biology Final Exam Study Guide: Semester 2 Questions 1. Scientific method: What does each of these entail? Investigation and Experimentation Problem Hypothesis Methods Results/Data Discussion/Conclusion

More information

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email:

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: What is Gene Expression & Gene Regulation? 1. Gene Expression

More information

Control of Gene Expression

Control of Gene Expression Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

1. The diagram below represents a biological process

1. The diagram below represents a biological process 1. The diagram below represents a biological process 5. The chart below indicates the elements contained in four different molecules and the number of atoms of each element in those molecules. Which set

More information

Replication Study Guide

Replication Study Guide Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have

More information

regulation of ECF composition and volume regulation of metabolism thyroid hormones, epinephrine, growth hormone, insulin and glucagon

regulation of ECF composition and volume regulation of metabolism thyroid hormones, epinephrine, growth hormone, insulin and glucagon Hormonal Effects regulation of ECF composition and volume ADH, aldosterone, ANF regulation of metabolism thyroid hormones, epinephrine, growth hormone, insulin and glucagon regulation of muscle contraction

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

Chapter 45: Hormones and the Endocrine System

Chapter 45: Hormones and the Endocrine System Name Period Overview 1. What is a hormone? 2. Why does a hormone elicit a response only with target cells? 3. The body has two long-distance regulating systems. Which involves chemical signals by hormones?

More information

Chetek-Weyerhaeuser High School

Chetek-Weyerhaeuser High School Chetek-Weyerhaeuser High School Anatomy and Physiology Units and Anatomy and Physiology A Unit 1 Introduction to Human Anatomy and Physiology (6 days) Essential Question: How do the systems of the human

More information

The Molecules of Cells

The Molecules of Cells The Molecules of Cells I. Introduction A. Most of the world s population cannot digest milk-based foods. 1. These people are lactose intolerant because they lack the enzyme lactase. 2. This illustrates

More information

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3 DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can

More information


BIOLOGY HIGHER LEVEL 2008. M44 Write your Examination Number here Coimisiún na Scrúduithe Stáit State Examinations Commission LEAVING CERTIFICATE EXAMINATION, 2008 BIOLOGY HIGHER LEVEL THURSDAY, 12 JUNE MORNING, 9.30 TO 12.30

More information

Endocrine System: Practice Questions #1

Endocrine System: Practice Questions #1 Endocrine System: Practice Questions #1 1. Removing part of gland D would most likely result in A. a decrease in the secretions of other glands B. a decrease in the blood calcium level C. an increase in

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

RNA & Protein Synthesis

RNA & Protein Synthesis RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis

More information

SBI4U: Respiration and Photosynthesis Test. [25 marks]

SBI4U: Respiration and Photosynthesis Test. [25 marks] Part 1: Multiple Choice SBI4U: Respiration and Photosynthesis Test Mr. Dykstra Name: [25 marks] 1. Which of the following molecules links glucose oxidation, fatty acid catabolism, and the catabolism of

More information

Ms. Campbell Protein Synthesis Practice Questions Regents L.E.

Ms. Campbell Protein Synthesis Practice Questions Regents L.E. Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide

More information

2. Cellular respiration uses oxygen to convert the chemical energy stored in organic molecules into -?-

2. Cellular respiration uses oxygen to convert the chemical energy stored in organic molecules into -?- HB Cell Respiration Questions (1/2 point each question or blank to fill in 37 points) 1. Organisms, such as plants that make their own food are called -?- 2. Cellular respiration uses oxygen to convert

More information

Name: Hour: Elements & Macromolecules in Organisms

Name: Hour: Elements & Macromolecules in Organisms Name: Hour: Elements & Macromolecules in Organisms Most common elements in living things are carbon, hydrogen, nitrogen, and oxygen. These four elements constitute about 95% of your body weight. All compounds

More information

Unit I: Introduction To Scientific Processes

Unit I: Introduction To Scientific Processes Unit I: Introduction To Scientific Processes This unit is an introduction to the scientific process. This unit consists of a laboratory exercise where students go through the QPOE2 process step by step

More information

Chapter 5: The Structure and Function of Large Biological Molecules

Chapter 5: The Structure and Function of Large Biological Molecules Name Period Concept 5.1 Macromolecules are polymers, built from monomers 1. The large molecules of all living things fall into just four main classes. Name them. 2. Circle the three classes that are called

More information

Keystone Biology Exam Information: Module A: Cell and Cell Processes

Keystone Biology Exam Information: Module A: Cell and Cell Processes Keystone Biology Exam Information: Module A: Cell and Cell Processes Basic Biological Principles- Day 1 Describe the characteristics of life shared by prokaryotic and eukaryotic organisms. Compare cellular

More information

BioBoot Camp Genetics

BioBoot Camp Genetics BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before

More information

Chapter 4 Cellular Metabolism

Chapter 4 Cellular Metabolism Chapter 4 Cellular Metabolism Metabolic processes all chemical reactions that occur in the body Two types of metabolic reactions Anabolism larger molecules are made requires energy Catabolism larger molecules

More information

Essentials of Human Anatomy & Physiology 11 th Edition, 2015 Marieb

Essentials of Human Anatomy & Physiology 11 th Edition, 2015 Marieb A Correlation of Essentials of Human Anatomy Marieb To the Next Generation Science Standards Life A Correlation of, HS-LS1 From Molecules to Organisms: Structures and Processes HS-LS1-1. Construct an explanation

More information

Modeling DNA Replication and Protein Synthesis

Modeling DNA Replication and Protein Synthesis Skills Practice Lab Modeling DNA Replication and Protein Synthesis OBJECTIVES Construct and analyze a model of DNA. Use a model to simulate the process of replication. Use a model to simulate the process

More information

3120-1 - Page 1. Name:

3120-1 - Page 1. Name: Name: 1) Which series is arranged in correct order according to decreasing size of structures? A) DNA, nucleus, chromosome, nucleotide, nitrogenous base B) chromosome, nucleus, nitrogenous base, nucleotide,

More information

Photosynthesis & Cellular Respiration. Hot Seat

Photosynthesis & Cellular Respiration. Hot Seat Photosynthesis & Cellular Respiration Hot Seat Hot Seat Instructions You are competing against classmates in your row (across the classroom). The hot seat is the seat in each row closest to the outside

More information

Cells & Cell Organelles

Cells & Cell Organelles Cells & Cell Organelles The Building Blocks of Life H Biology Types of cells bacteria cells Prokaryote - no organelles Eukaryotes - organelles animal cells plant cells Cell size comparison Animal cell

More information

Control of Gene Expression

Control of Gene Expression Control of Gene Expression (Learning Objectives) Explain the role of gene expression is differentiation of function of cells which leads to the emergence of different tissues, organs, and organ systems

More information

1 Mutation and Genetic Change

1 Mutation and Genetic Change CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds

More information

Biological cell membranes

Biological cell membranes Unit 14: Cell biology. 14 2 Biological cell membranes The cell surface membrane surrounds the cell and acts as a barrier between the cell s contents and the environment. The cell membrane has multiple

More information


AP BIOLOGY 2009 SCORING GUIDELINES AP BIOLOGY 2009 SCORING GUIDELINES Question 4 The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following

More information

13.2 Ribosomes & Protein Synthesis

13.2 Ribosomes & Protein Synthesis 13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).

More information

Lecture 8. Protein Trafficking/Targeting. Protein targeting is necessary for proteins that are destined to work outside the cytoplasm.

Lecture 8. Protein Trafficking/Targeting. Protein targeting is necessary for proteins that are destined to work outside the cytoplasm. Protein Trafficking/Targeting (8.1) Lecture 8 Protein Trafficking/Targeting Protein targeting is necessary for proteins that are destined to work outside the cytoplasm. Protein targeting is more complex

More information

Chapter 18 Regulation of Gene Expression

Chapter 18 Regulation of Gene Expression Chapter 18 Regulation of Gene Expression 18.1. Gene Regulation Is Necessary By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection

More information

The Practice of Peptide Synthesis

The Practice of Peptide Synthesis The Practice of Peptide Synthesis Download: The Practice of Peptide Synthesis PDF ebook The Practice of Peptide Synthesis PDF - Are you searching for The Practice of Peptide Synthesis Books? Now, you will

More information

Elements & Macromolecules in Organisms

Elements & Macromolecules in Organisms Name: Date: Per: Table # Elements & Macromolecules in rganisms Most common elements in living things are carbon, hydrogen, nitrogen, and oxygen. These four elements constitute about 95% of your body weight.

More information

Reproductive System & Development: Practice Questions #1

Reproductive System & Development: Practice Questions #1 Reproductive System & Development: Practice Questions #1 1. Which two glands in the diagram produce gametes? A. glands A and B B. glands B and E C. glands C and F D. glands E and F 2. Base your answer

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

Mitochondrial DNA Analysis

Mitochondrial DNA Analysis Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

Cell Division. Use Target Reading Skills. This section explains how cells grow and divide.

Cell Division. Use Target Reading Skills. This section explains how cells grow and divide. Cell Processes and Energy Name Date Class Cell Processes and Energy Guided Reading and Study Cell Division This section explains how cells grow and divide. Use Target Reading Skills As you read, make a

More information

Lab #5: DNA, RNA & Protein Synthesis. Heredity & Human Affairs (Biology 1605) Spring 2012

Lab #5: DNA, RNA & Protein Synthesis. Heredity & Human Affairs (Biology 1605) Spring 2012 Lab #5: DNA, RNA & Protein Synthesis Heredity & Human Affairs (Biology 1605) Spring 2012 DNA Stands for : Deoxyribonucleic Acid Double-stranded helix Made up of nucleotides Each nucleotide= 1. 5-carbon

More information

Chapter 3 Molecules of Cells

Chapter 3 Molecules of Cells Bio 100 Molecules of cells 1 Chapter 3 Molecules of Cells Compounds containing carbon are called organic compounds Molecules such as methane that are only composed of carbon and hydrogen are called hydrocarbons

More information

Biochemistry of Cells

Biochemistry of Cells Biochemistry of Cells 1 Carbon-based Molecules Although a cell is mostly water, the rest of the cell consists mostly of carbon-based molecules Organic chemistry is the study of carbon compounds Carbon

More information

Genetics Test Biology I

Genetics Test Biology I Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.

More information

Homework. Due in Lab Week 2. Homework #4 (pages 9, 10 & 11) Biomolecules PreLab #2 (handout up front and on Instructor Website)

Homework. Due in Lab Week 2. Homework #4 (pages 9, 10 & 11) Biomolecules PreLab #2 (handout up front and on Instructor Website) Homework Due in Lab Week 2 Homework #4 (pages 9, 10 & 11) Biomolecules PreLab #2 (handout up front and on Instructor Website) Biological Molecules Enzymes Enzymes One of the most important groups of proteins

More information

Name: Date: Period: DNA Unit: DNA Webquest

Name: Date: Period: DNA Unit: DNA Webquest Name: Date: Period: DNA Unit: DNA Webquest Part 1 History, DNA Structure, DNA Replication DNA History Read the text and answer the following questions.

More information

Cell Energy (Photosynthesis and Respiration) Notes

Cell Energy (Photosynthesis and Respiration) Notes Cell Energy (Photosynthesis and Respiration) Notes I. Energy ability to do work; forms of energy: heat, light, chemical, electrical, mechanical, kinetic, potential A. Energy for living things comes from

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

Lecture 6. Regulation of Protein Synthesis at the Translational Level

Lecture 6. Regulation of Protein Synthesis at the Translational Level Regulation of Protein Synthesis (6.1) Lecture 6 Regulation of Protein Synthesis at the Translational Level Comparison of EF-Tu-GDP and EF-Tu-GTP conformations EF-Tu-GDP EF-Tu-GTP Next: Comparison of GDP

More information

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams. Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.

More information

Bio 102 Practice Problems Chromosomes and DNA Replication

Bio 102 Practice Problems Chromosomes and DNA Replication Bio 102 Practice Problems Chromosomes and DNA Replication Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which one of the following enzymes is NT a key player in the process

More information


CHAPTER 3 THE CHEMISTRY OF ORGANIC MOLECULES CHAPTER 3 THE CHEMISTRY OF ORGANIC MOLECULES 3.1 Organic Molecules The chemistry of carbon accounts for the diversity of organic molecules found in living things. Carbon has six electrons, four of which

More information

Gene Switches Teacher Information

Gene Switches Teacher Information STO-143 Gene Switches Teacher Information Summary Kit contains How do bacteria turn on and turn off genes? Students model the action of the lac operon that regulates the expression of genes essential for

More information

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown 1 DNA Coloring - Transcription & Translation Transcription RNA, Ribonucleic Acid is very similar to DNA. RNA normally exists as a single strand (and not the double stranded double helix of DNA). It contains

More information

Metabolism Practice Test KEY

Metabolism Practice Test KEY Biology 12 Metabolism Practice Test KEY Name: Section 1: What is an enzyme? 1. Which of the following statements is true about enzymes? a) 3D shape can vary and still be active b) they may catalyze only

More information

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme. Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.

More information

Anatomy and Physiology (ANPY) CTY Course Syllabus

Anatomy and Physiology (ANPY) CTY Course Syllabus Anatomy and Physiology (ANPY) CTY Course Syllabus When Key Points / Objectives Content Day 1 INTRODUCTION HOMEOSTASIS LEVELS OF ORGANIZATION Day 2 CELLULAR AND MOLECULAR BIOLOGY GENETICS Day 3 INTEGUMENTARY

More information


GENE REGULATION. Teacher Packet AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures

More information

Student name ID # 2. (4 pts) What is the terminal electron acceptor in respiration? In photosynthesis? O2, NADP+

Student name ID # 2. (4 pts) What is the terminal electron acceptor in respiration? In photosynthesis? O2, NADP+ 1. Membrane transport. A. (4 pts) What ion couples primary and secondary active transport in animal cells? What ion serves the same function in plant cells? Na+, H+ 2. (4 pts) What is the terminal electron

More information

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional

More information

Carbohydrates: Sugars and starches they serve as energy and food source compounds Made of carbon and hydrogen and oxygen

Carbohydrates: Sugars and starches they serve as energy and food source compounds Made of carbon and hydrogen and oxygen Cell Processes (chemistry and respiration) Organic compounds they always contain carbon 4 types that you need to know: Lipids (fats, oils and waxes), Carbohydrates, Proteins and nucleic acids Inorganic

More information

macromolecule: monomer: polymer: a. The elements found in carbohydrates occur in a specific ratio. Describe that ratio.

macromolecule: monomer: polymer: a. The elements found in carbohydrates occur in a specific ratio. Describe that ratio. NAME: DATE: Biological Macromolecule Poster Project HOUR: BIOLOGY You and your table mates will be researching and creating an informational poster on one of four biological macromolecules: carbohydrates,

More information

1.1.1 Cell Structure. Relevant Past Paper Questions. Condensed Notes By Specification Point. 2013 January 5 e f i j. 2012 June 2 e f g i

1.1.1 Cell Structure. Relevant Past Paper Questions. Condensed Notes By Specification Point. 2013 January 5 e f i j. 2012 June 2 e f g i 1.1.1 Cell Structure Relevant Past Paper Questions Paper Question Specification point(s) tested 2013 January 5 e f i j 2012 June 2 e f g i 2012 January 4 a b d f 2011 June 1 part a only f 2011 January

More information

B2 1 Cells, Tissues and Organs

B2 1 Cells, Tissues and Organs B2 Cells, Tissues and Organs 5 minutes 5 marks Page of 7 Q. The diagram shows a bacterium. On the drawing, name the structures labelled A, B, C and D. (Total 4 marks) Q2. (a) The diagrams show cells containing

More information

2007 7.013 Problem Set 1 KEY

2007 7.013 Problem Set 1 KEY 2007 7.013 Problem Set 1 KEY Due before 5 PM on FRIDAY, February 16, 2007. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Where in a eukaryotic cell do you

More information

Actions of Hormones on Target Cells Page 1. Actions of Hormones on Target Cells Page 2. Goals/ What You Need to Know Goals What You Need to Know

Actions of Hormones on Target Cells Page 1. Actions of Hormones on Target Cells Page 2. Goals/ What You Need to Know Goals What You Need to Know Actions of Hormones on Target Cells Graphics are used with permission of: Pearson Education Inc., publishing as Benjamin Cummings ( Page 1. Actions of Hormones on Target Cells Hormones

More information

Bob Jesberg. Boston, MA April 3, 2014

Bob Jesberg. Boston, MA April 3, 2014 DNA, Replication and Transcription Bob Jesberg NSTA Conference Boston, MA April 3, 2014 1 Workshop Agenda Looking at DNA and Forensics The DNA, Replication i and Transcription i Set DNA Ladder The Double

More information

AS Biology Unit 2 Key Terms and Definitions. Make sure you use these terms when answering exam questions!

AS Biology Unit 2 Key Terms and Definitions. Make sure you use these terms when answering exam questions! AS Biology Unit 2 Key Terms and Definitions Make sure you use these terms when answering exam questions! Chapter 7 Variation 7.1 Random Sampling Sampling a population to eliminate bias e.g. grid square

More information

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed

More information

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office

More information

RNA and Protein Synthesis

RNA and Protein Synthesis Name lass Date RN and Protein Synthesis Information and Heredity Q: How does information fl ow from DN to RN to direct the synthesis of proteins? 13.1 What is RN? WHT I KNOW SMPLE NSWER: RN is a nucleic

More information



More information

Anatomy and Physiology Placement Exam 2 Practice with Answers at End!

Anatomy and Physiology Placement Exam 2 Practice with Answers at End! Anatomy and Physiology Placement Exam 2 Practice with Answers at End! General Chemical Principles 1. bonds are characterized by the sharing of electrons between the participating atoms. a. hydrogen b.

More information

Common Course Topics Biology 1406: Cell and Molecular Biology

Common Course Topics Biology 1406: Cell and Molecular Biology Common Course Topics Biology 1406: Cell and Molecular Biology 1. Introduction to biology --the scientific study of organisms --properties of life --assumptions, methods and limitations of science --underlying

More information

10.1 The function of Digestion pg. 402

10.1 The function of Digestion pg. 402 10.1 The function of Digestion pg. 402 Macromolecules and Living Systems The body is made up of more than 60 % water. The water is found in the cells cytoplasm, the interstitial fluid and the blood (5

More information

4Unit One. Metabolic Processes How chemistry becomes Biology! URLs.

4Unit One. Metabolic Processes How chemistry becomes Biology! URLs. 4Unit One URLs CellularRespiration.html Chapter 4

More information

Get It Right. Answers. Chapter 1: The Science of Life. A biologist studies all living things.

Get It Right. Answers. Chapter 1: The Science of Life. A biologist studies all living things. Discover Biology 'N' Level Science Chapter 1 Chapter 1: The Science of Life A biologist studies all living things. In order to carry out the scientific method, we need to ask questions. Discover Biology

More information