C A. How many high-energy phosphate bonds would be consumed during the replication of a 10-nucleotide DNA sequence (synthesis of a single-strand)?

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "C A. How many high-energy phosphate bonds would be consumed during the replication of a 10-nucleotide DNA sequence (synthesis of a single-strand)?"

Transcription

1 1. (20 points) Provide a brief answer to the following questions. You may use diagrams or equations, as appropriate, but your answer should be largely a written response of two or three sentences. 4. The final stages of aerobic oxidation of glucose occur in the mitochondria. This involves two coupled processes: [1] the oxidation of NADH and QH 2 through an electron transport chain and [2] the synthesis of ATP. How are these two processes linked? (10 points) 5. ATP synthase increases the concentration of ATP in the matrix of the mitochondria. How is ATP made available to the cell if it is released just in the matrix? (10 points) a. The oxidation of NADH and QH 2 through the electron transport chain results in the ultimate reduction of oxygen to water and the development of a proton gradient. The proton gradient is the potential energy source that drives the phosphorylation of ADP to give ATP. b. Although ATP is synthesized and released on the matrix side of the inner mitochondrial membrane, transporters, called ATP translocase, are available to export ATP across the inner membrane to the cytosol. 2. (20 points) Provide a brief answer to the following questions. You may use diagrams or equations, as appropriate, but your answer should be largely a written response of two or three sentences. Photosynthesis involves a process of energy capture and storage. What features of the electron transport/oxidative phosphorylation process seen in our study of glycolysis are similar to the energy capture and storage process seen in photosynthesis? You should be able to name at least two similarities. What are some of the differences? You should be able to name at least two differences. There are several possible answers. Here are a few: Similarities: [1] Photosynthesis involves an electron transport chain, albeit different from the one seen in mitochondria, and [2] photosynthesis involves the development of a proton gradient in order to drive ATP synthesis. Differences: [1] photosynthesis involves light energy capture as an energy source; mitochondrial electron transport/oxidative phosphorylation involves glucose (or related carbohydrates) as an energy source; [2] mitochondrial electron transport/oxidative phosphorylation involves NADH; photosynthesis involves NADPH; [3] mitochondrial electron transport/oxidative phosphorylation involves the consumption of carbohydrates; photosynthesis involves the production of carbohydrates; [4] mitochondrial electron transport/oxidative phosphorylation involves the reduction of oxygen to water; photosynthesis involves the oxidation of water to oxygen

2 3. Select the letter that best answers the following questions and place the letter in the blank in front of the question (20 points; 4 points each). C A. How many high-energy phosphate bonds would be consumed during the replication of a 10-nucleotide DNA sequence (synthesis of a single-strand)? (A) 9 (B) 10 (C) nucleotides consumed and 2 high energy P-bonds used in each step. (D) 18 (E) 8 B B. A polynucleotide is a polymer in which: (A) the two ends are structurally equivalent. (B) the monomeric units are joined by phosphodiester bonds. (C) there are at least 20 different kinds of monomers that can be used. (D) purine and pyrimidine bases are the repeating units. (No-ribose sugars are repeating units). (E) the monomeric units are not subject to hydrolysis. B C. All of the following tend to favor a helical conformation of a single polynucleotide chain EXCEPT: (A) hydrophobic interactions of the rings of the purine and pyrimidine bases that exclude water. (B) hydrogen bonding between appropriate purine-pyrimidine pairs. (Single polynucleotide chain). (C) spacing of bases in the helical conformation that excludes water. (D) the absence of a 2 hydroxyl group. (E) all of the above. E D. How would the use of a DNA polymerase III mutant enzyme with a 10-fold greater rate of 3 to 5 exonuclease activity change the process of DNA replication? (A) the fidelity of DNA replication would be increased. (B) the rate of nick-translation would increase. (C) the rate of lagging strand synthesis would be increased. (D) the rate of DNA replication would be decreased. E E. Initiation of replication in bacteria:

3 (A) begins with dnag binding at the OriC site. (B) forms a primisome, which then uses a topoisomerase to open a replication fork. (C) begins with dnaa binding, which results in the formation of several bubbles each consisting of many nucleotide pairs. No- Only one bubble. (D) requires the action of helicase to allow SSB protein binding to begin lagging strand synthesis. (E) none of the above. 4. (10 points) Draw the structure of UTP. Circle the positions within the ring that could be used to form hydrogen bonds with its complementary base. See text book. 5. (30 points) Below are the sequences of several short DNA duplexes. Please redraw the molecules to indicate how they would be altered in the reaction catalyzed by the addition of the indicated enzyme in the presence of an excess of datp, dctp, and dgtp, but no dttp. The ^ indicates the presence of a nick in the DNA strand (be sure to use this symbol to indicate a nick in your structures). Briefly explain your answer for full credit. a). DNA polymerase III 5 GGGGGCCCCCTTAAAAA 3 CCGG GGAATTTTTCAGCC 5 GGGGGCCCCCTTAAAAAG No dttp so no more extension. 3 CCCCCGGGGGAATTTTTCAGCC ^Nick remains 3 to new G b). DNA polymerase I 5 GGGGGACCCCCT 3 CCCCCTGGGGGAAAAA Nick 5 GGGGGACCCCCT No dttp so no more extension. 3 CCCCC GGGGGAAAAA Nick translation removes and replaces G s and removes the T, but can not replace leaving a gap. c). Telomerase (with an internal RNA template strand of 5 CCAAGG)

4 Telomer sequence to be added 5 -CCTTGG (complementary to template). However, no dttp is available, so only begin first telomer repeat. 5 GGGCCCGGGGCC 3 CCGGCCCGGGCCC BCH401G Exam 4 Fall 2000 Make-up Exam (differences) 3) B, but E accepted B. The best definition of an exonuclease is an enzyme that hydrolyzes: (A) a nucleotide from the 3 end of a RNA primer. (B) a nucleotide from either terminal of a polynucleotide. (C) a phosphodiester bond on the interior of a polynucleotide. (D) a bond only in a specific sequence of nucleotides. E D. How would the use of a DNA polymerase I mutant enzyme with a 10-fold greater rate of 3 to 5 exonuclease activity change the process of DNA replication? (A) the fidelity of DNA replication would be increased. (B) the rate of nick-translation would increase. (C) the rate of lagging strand synthesis would be increased. (D) the rate of DNA replication would be decreased. D E. In eukaryotic DNA replication: (A) only one replisome forms because there is a single origin of replication. (B) the leading and lagging strands are synthesized by the same enzyme. (C) helicases are not necessary. (D) at least one DNA polymerase has a 3 to 5 exonuclease activity. (E) the process occurs throughout the cell cycle. 4. (10 points) Draw the structure of a dgtp:ctp base pair. Be sure to indicate the positions within the ring that are used to form hydrogen bonds (and draw these bonds). See text: CTP is a ribonucleotide.

5 5. (30 points) Below are the sequences of several short DNA duplexes. Please redraw the molecules to indicate how they would be altered in the reaction catalyzed by the addition of the indicated enzyme in the presence of an excess of datp, dctp, dgtp, and TTP. The ^ indicates the presence of a nick in the DNA strand (be sure to use this symbol to indicate a nick in your structures). Briefly explain your answer for full credit. a). DNA polymerase I and ligase 5 GGGGGCCCCCTTAAAAA 3 CCGG GGAATTTTTCAGCC 5 GGGGGCCCCCTTAAAAAG No dttp so no more extension. 3 CCCCCGGGGGAATTTTTCAGCC PolI fills in gap to generate nick, then completes nick translation along bottom strand.

DNA. Form and Function

DNA. Form and Function DNA Form and Function DNA: Structure and replication Understanding DNA replication and the resulting transmission of genetic information from cell to cell, and generation to generation lays the groundwork

More information

DNA synthesis_pic Basic requirements for DNA synthesis Substrates. The four deoxynucleoside triphosphates (dntps) deoxyadenosine triphosphate (datp),

DNA synthesis_pic Basic requirements for DNA synthesis Substrates. The four deoxynucleoside triphosphates (dntps) deoxyadenosine triphosphate (datp), Basic requirements for DNA synthesis Substrates. The four deoxynucleoside triphosphates (dntps) deoxyadenosine triphosphate (datp), deoxyguanosine triphosphate (dgtp), deoxycytidine triphos-phate (dctp),

More information

Chapter 6: DNA: Hereditary Molecules of Life pg : DNA Replication and Repair pg

Chapter 6: DNA: Hereditary Molecules of Life pg : DNA Replication and Repair pg UNIT 3: Molecular Genetics Chapter 6: DNA: Hereditary Molecules of Life pg. 268-6.4: DNA Replication and Repair pg. 282-290 The DNA molecule is capable of replicating on its own. This is important for

More information

CHAPTER 3 Molecular Genetics DNA Replication

CHAPTER 3 Molecular Genetics DNA Replication CHAPTER 3 Molecular Genetics DNA Replication Watson and Crick DNA model implies a mechanism for replication: a. Unwind the DNA molecule. b. Separate the two strands. c. Make a complementary copy for each

More information

1. True or False? At the DNA level, recombination is initiated by a single stranded break in a DNA molecule. False

1. True or False? At the DNA level, recombination is initiated by a single stranded break in a DNA molecule. False 1. True or False? At the DNA level, recombination is initiated by a single stranded break in a DNA molecule. False 2. True or False? Dideoxy sequencing is a chain initiation method of DNA sequencing. False

More information

DNA Replication in Prokaryotes

DNA Replication in Prokaryotes OpenStax-CNX module: m44488 1 DNA Replication in Prokaryotes OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,

More information

TTGGHTGUTGG CCAAACACCAA AACCCACAACC HHUUTHUGHUU

TTGGHTGUTGG CCAAACACCAA AACCCACAACC HHUUTHUGHUU Conceptual Questions C1. Answer: It is a double-stranded structure that follows the AT/GC rule. C2. Answer: Bidirectional replication refers to DNA replication in both directions starting from one origin.

More information

DNA. Discovery of the DNA double helix

DNA. Discovery of the DNA double helix DNA Replication DNA Discovery of the DNA double helix A. 1950 s B. Rosalind Franklin - X-ray photo of DNA. C. Watson and Crick - described the DNA molecule from Franklin s X-ray. What is DNA? Question:

More information

Bio 102 Practice Problems Chromosomes and DNA Replication

Bio 102 Practice Problems Chromosomes and DNA Replication Bio 102 Practice Problems Chromosomes and DNA Replication Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which one of the following enzymes is NT a key player in the process

More information

Chapter 9 CELLULAR RESPIRATION

Chapter 9 CELLULAR RESPIRATION Chapter 9 CELLULAR RESPIRATION HARVESTING FREE ENERGY Photosynthesis takes free energy and puts it into carbohydrates/sugars Carbohydrates can be stored for later use; light can not and neither can ATP

More information

Lectures 19 and 20. Chapter 12: DNA Replication and Recombination. Problem set 3A: due at beginning of lecture on Monday, Oct.

Lectures 19 and 20. Chapter 12: DNA Replication and Recombination. Problem set 3A: due at beginning of lecture on Monday, Oct. Lectures 19 and 20 Chapter 12: DNA Replication and Recombination DNA Replication is semiconservative Meselson-Stahl experiment: 15 N-labeling and CsCl density gradient centrifugation. Problem set 3A: due

More information

The correct answer is d C. Answer c is incorrect. Reliance on the energy produced by others is a characteristic of heterotrophs.

The correct answer is d C. Answer c is incorrect. Reliance on the energy produced by others is a characteristic of heterotrophs. 1. An autotroph is an organism that a. extracts energy from organic sources b. converts energy from sunlight into chemical energy c. relies on the energy produced by other organisms as an energy source

More information

monosaccharides fatty acids amino acids

monosaccharides fatty acids amino acids Cellular Energy In order to sustain life (steady state), cells constantly expend energy in the form of ATP hydrolysis the hydrolysis of ATP yields a molecule of ADP (adenosine diphosphate) and a Phosphate

More information

3/23/2012. DNA Replication. DNA Replication. DNA Replication. Steps in DNA Replication. SBI4U1 Molecular Genetics

3/23/2012. DNA Replication. DNA Replication. DNA Replication. Steps in DNA Replication. SBI4U1 Molecular Genetics SBI4U1 Molecular Genetics Recall: mitosis requires that each daughter cell has an exact copy of parent DNA. Ms. Ponvia The Watson-Crick model suggests how this occurs: Parent DNA molecule unzips, creating

More information

DNA replication. DNA RNA Protein

DNA replication. DNA RNA Protein DNA replication The central dogma of molecular biology transcription translation DNA RNA Protein replication Revers transcriptase The information stored by DNA: - protein structure - the regulation of

More information

BCMB Chapters 34 & 35 DNA Replication and Repair

BCMB Chapters 34 & 35 DNA Replication and Repair BCMB 3100 - Chapters 34 & 35 DNA Replication and Repair Semi-conservative DNA replication DNA polymerase DNA replication Replication fork; Okazaki fragments Sanger method for DNA sequencing DNA repair

More information

BCMB Chapters 34 & 35 DNA Replication and Repair

BCMB Chapters 34 & 35 DNA Replication and Repair BCMB 3100 - Chapters 34 & 35 DNA Replication and Repair Semi-conservative DNA replication DNA polymerase DNA replication Replication fork; Okazaki fragments Sanger method for DNA sequencing DNA repair

More information

Photosynthesis takes place in three stages:

Photosynthesis takes place in three stages: Photosynthesis takes place in three stages: Light-dependent reactions Light-independent reactions The Calvin cycle 1. Capturing energy from sunlight 2. Using energy to make ATP and NADPH 3. Using ATP and

More information

4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?

4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true? Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.

More information

DNA Replication. (CHAPTER 11- Brooker Text) Sept 16 & 18, 2008 BIO 184 Dr. Tom Peavy. Sequence Complexity in the Genome

DNA Replication. (CHAPTER 11- Brooker Text) Sept 16 & 18, 2008 BIO 184 Dr. Tom Peavy. Sequence Complexity in the Genome DNA Replication (CHAPTER 11- Brooker Text) Sept 16 & 18, 2008 BIO 184 Dr. Tom Peavy Sequence Complexity in the Genome 60-70% of human DNA fragments are unique DNA sequences 1 What are the structural features

More information

The Citric Acid Cycle and Oxidative Phosphorylation

The Citric Acid Cycle and Oxidative Phosphorylation Honors Biology Chapter 6.8 6.12 Study Sheet The Citric Acid Cycle and Oxidative Phosphorylation PYRUVATE OXIDATION DRAW THE DETAILED REACTION BELOW: REACTION SUMMARY: SUBSTRATES: PRODUCTS: THE CITRIC ACID

More information

Microbiology - Problem Drill 05: Microbial Metabolism

Microbiology - Problem Drill 05: Microbial Metabolism Microbiology - Problem Drill 05: Microbial Metabolism No. 1 of 10 1. Anabolism is a metabolic process where are turned into molecules. (A) Complex, simple (B) Simple, ATP (C) Simple, ATP (D) Simple, complex

More information

Chromosome Mapping by Recombination

Chromosome Mapping by Recombination Chromosome Mapping by Recombination Genes on the same chromosome are said to be linked. Crossing over: the physical exchange of homologous chromosome segments A given crossover generates two reciprocal

More information

DNA: Structure and Replication

DNA: Structure and Replication 7 DNA: Structure and Replication WORKING WITH THE FIGURES 1. In Table 7-1, why are there no entries for the first four tissue sources? For the last three entries, what is the most likely explanation for

More information

Chem 465 Biochemistry II

Chem 465 Biochemistry II Chem 465 Biochemistry II Name: 2 points Multiple choice (4 points apiece): 1. Which of the following statements about energy conservation in the mitochondrion is false? A) Drug that inhibits the ATP synthase

More information

Student name ID # 2. (4 pts) What is the terminal electron acceptor in respiration? In photosynthesis? O2, NADP+

Student name ID # 2. (4 pts) What is the terminal electron acceptor in respiration? In photosynthesis? O2, NADP+ 1. Membrane transport. A. (4 pts) What ion couples primary and secondary active transport in animal cells? What ion serves the same function in plant cells? Na+, H+ 2. (4 pts) What is the terminal electron

More information

Energy Production In A Cell (Chapter 25 Metabolism)

Energy Production In A Cell (Chapter 25 Metabolism) Energy Production In A Cell (Chapter 25 Metabolism) Large food molecules contain a lot of potential energy in the form of chemical bonds but it requires a lot of work to liberate the energy. Cells need

More information

Study Guide A. Answer Key. Cells and Energy

Study Guide A. Answer Key. Cells and Energy Cells and Energy Answer Key SECTION 1. CHEMICAL ENERGY AND ATP 1. molecule; food molecules 2. high-energy; lower-energy 3. phosphate group 4. a; d; b; c 5. b; e 6. c; d 7. a; f 8. chemical energy; light

More information

Part III. Genetic information replication and flow

Part III. Genetic information replication and flow Part III Genetic information replication and flow Chapter 16 DNA Biosynthesis and Recombination The biological function of DNA Store genetic information Replicate genetic information Express genetic information

More information

STRUCTURES OF NUCLEIC ACIDS

STRUCTURES OF NUCLEIC ACIDS CHAPTER 2 STRUCTURES OF NUCLEIC ACIDS What is the chemical structure of a deoxyribonucleic acid (DNA) molecule? DNA is a polymer of deoxyribonucleotides. All nucleic acids consist of nucleotides as building

More information

I) DNA STRUCTURE AND REPLICATION B) DNA REPLICATION

I) DNA STRUCTURE AND REPLICATION B) DNA REPLICATION I) DN SRUURE ND REPLIION B) DN REPLIION I) DN Structure and Replication DN Replication for mitosis and meiosis to occur the DN must make an exact copy itself first (S Phase) this is called DN replication

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

Chapter 7 Active Reading Guide Cellular Respiration and Fermentation

Chapter 7 Active Reading Guide Cellular Respiration and Fermentation Name: AP Biology Mr. Croft Chapter 7 Active Reading Guide Cellular Respiration and Fermentation Overview: Before getting involved with the details of cellular respiration and photosynthesis, take a second

More information

Briefly explain biosynthesis of cell constituents (requires energy)

Briefly explain biosynthesis of cell constituents (requires energy) 3 Cell Metabolism Chapter 3 Cell Metabolism - review Student Learning Outcomes: Describe central role of enzymes as catalysts Vast array of chemical reactions Many enzymes are proteins Role of NAD + /NADH

More information

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Name Advanced Biology Enzyme and Cellular Respiration Test Part I Multiple Choice (75 points) MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) The

More information

2. Why did biologists used to think that proteins are the genetic material?

2. Why did biologists used to think that proteins are the genetic material? Chapter 16: DNA: The Genetic Material 1. What must genetic material do? 2. Why did biologists used to think that proteins are the genetic material? 3. Describe Griffith s experiments with genetic transformation

More information

DNA REPLICATION. Genetica per Scienze Naturali a.a prof S. Presciuttini

DNA REPLICATION. Genetica per Scienze Naturali a.a prof S. Presciuttini DNA REPLICATION This document is licensed under the Attribution-NonCommercial-ShareAlike 2.5 Italy license, available at http://creativecommons.org/licenses/by-nc-sa/2.5/it/ 1. DNA Replication In both

More information

An outline of glycolysis.

An outline of glycolysis. An outline of glycolysis. Each of the 10 steps shown is catalyzed by a different enzyme. Note that step 4 cleaves a six-carbon sugar into two three-carbon sugars, so that the number of molecules at every

More information

Cellular Respiration Page 9

Cellular Respiration Page 9 Cellular Respiration Page 9 I. The Importance of Food A. Food provides living things with the chemical building blocks they need to grow and reproduce. B. Food serves as a source of for the cells of the

More information

DNA AND IT S ROLE IN HEREDITY

DNA AND IT S ROLE IN HEREDITY DNA AND IT S ROLE IN HEREDITY Lesson overview and objectives - DNA/RNA structural properties What are DNA and RNA made of What are the structural differences between DNA and RNA What is the structure of

More information

Complementary Base Pairs: A and T. DNA contains complementary base pairs in which adenine is always linked by two hydrogen bonds to thymine (A T).

Complementary Base Pairs: A and T. DNA contains complementary base pairs in which adenine is always linked by two hydrogen bonds to thymine (A T). Complementary Base Pairs: A and T DNA contains complementary base pairs in which adenine is always linked by two hydrogen bonds to thymine (A T). Complementary Base Pairs: G and C DNA contains complementary

More information

Lecture Notes Respiration

Lecture Notes Respiration Lecture Notes Respiration We will consider two processes by which organisms harvest energy from food molecules: Aerobic Respiration more efficient, occurs in presence of O 2 Anaerobic Respiration less

More information

DNA replication (Lecture 28,29)

DNA replication (Lecture 28,29) DNA replication (Lecture 28,29) 1. DNA replication and the cell cycle 2. DNA is Reproduced by Semiconservative Replication 2.1 Conservation of the Original Helix 2.2 The Meselson-Stahl Experiment 2.3 Semiconservative

More information

Q: How are proteins (amino acid chains) made from the information in mrna? A: Translation Ribosomes translate mrna into protein

Q: How are proteins (amino acid chains) made from the information in mrna? A: Translation Ribosomes translate mrna into protein ranslation (written lesson) Q: How are proteins (amino acid chains) made from the information in mrn? : ranslation Ribosomes translate mrn into protein ranslation has 3 steps also! 1. ranslation Initiation:

More information

INTRODUCTION TO DNA Replication

INTRODUCTION TO DNA Replication INTRODUCTION TO DNA Replication - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - Chapter 13 covers a descriptive explanation of Deoxyribose nucleic Acid

More information

9-2 The Krebs Cycle and Electron Transport Slide 1 of 37

9-2 The Krebs Cycle and Electron Transport Slide 1 of 37 1 of 37 9-2 The Krebs Cycle and Oxygen is required for the final steps of cellular respiration. Because the pathways of cellular respiration require oxygen, they are aerobic. 2 of 37 The Krebs Cycle The

More information

An Overview of Metabolism

An Overview of Metabolism An Overview of Metabolism metabolism total of all chemical reactions occurring in cell catabolism breakdown of larger, more complex molecules into smaller, simpler ones energy is released and some is trapped

More information

Chapter 6 DNA Replication

Chapter 6 DNA Replication Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore

More information

MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS

MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS Richard L. Hodinka, Ph.D. University of South Carolina School of Medicine Greenville Greenville Health System, Greenville, SC hodinka@greenvillemed.sc.edu

More information

Electron Transport Generates a Proton Gradient Across the Membrane

Electron Transport Generates a Proton Gradient Across the Membrane Electron Transport Generates a Proton Gradient Across the Membrane Each of respiratory enzyme complexes couples the energy released by electron transfer across it to an uptake of protons from water in

More information

1. Which of the following correctly organizes genetic material from the broadest category to the most specific category?

1. Which of the following correctly organizes genetic material from the broadest category to the most specific category? DNA and Genetics 1. Which of the following correctly organizes genetic material from the broadest category to the most specific category? A. genome chromosome gene DNA molecule B. genome chromosome DNA

More information

Ch. 6 Cellular Respiration Period

Ch. 6 Cellular Respiration Period Ch. 6 Cellular Respiration Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions

More information

AP Bio Photosynthesis & Respiration

AP Bio Photosynthesis & Respiration AP Bio Photosynthesis & Respiration Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. What is the term used for the metabolic pathway in which

More information

Cellular Respiration. Cellular Respiration. The Mighty Mitochondria. Cellular Respiration. Cellular Respiration

Cellular Respiration. Cellular Respiration. The Mighty Mitochondria. Cellular Respiration. Cellular Respiration Have you ever wondered why you need oxygen? The Process that releases energy by breaking down food molecules in the presence of oxygen That energy goes to make ATP. What does it all mean? C 6 H 12 O 6

More information

Chapter 9 Cellular Respiration

Chapter 9 Cellular Respiration Chapter 9 Cellular Respiration Electrons carried in NADH Mitochondrion Glucose Glycolysis Pyruvic acid Krebs Cycle Electrons carried in NADH and FADH 2 Electron Transport Chain Cytoplasm Mitochondrion

More information

AP BIOLOGY 2015 SCORING GUIDELINES

AP BIOLOGY 2015 SCORING GUIDELINES AP BIOLOGY 2015 SCORING GUIDELINES Question 2 Figure 1. Glycolysis and pyruvate oxidation Figure 2. Krebs cycle Figure 3. Electron transport chain Cellular respiration includes the metabolic pathways of

More information

BINF6201/8201. Basics of Molecular Biology

BINF6201/8201. Basics of Molecular Biology BINF6201/8201 Basics of Molecular Biology 08-26-2016 Linear structure of nucleic acids Ø Nucleic acids are polymers of nucleotides Ø Nucleic acids Deoxyribonucleic acids (DNA) Ribonucleic acids (RNA) Phosphate

More information

Pathways that Harvest and Store Chemical Energy

Pathways that Harvest and Store Chemical Energy Pathways that Harvest and Store Chemical Energy Chapter 6 Pathways that Harvest and Store Chemical Energy Key Concepts 6.1 ATP, Reduced Coenzymes, and Chemiosmosis Play Important Roles in Biological Energy

More information

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional

More information

5.3 Cellular Respiration Releases Energy from Organic Compounds

5.3 Cellular Respiration Releases Energy from Organic Compounds 5.3 Cellular Respiration Releases Energy from Organic Compounds In this section, you will distinguish among aerobic respiration, anaerobic respiration, and fermentation explain how carbohydrates are oxidized

More information

Chapter 9: Cellular Respiration: Harvesting Chemical Energy

Chapter 9: Cellular Respiration: Harvesting Chemical Energy Name Period Chapter 9: Cellular Respiration: Harvesting Chemical Energy Overview: Before getting involved with the details of cellular respiration and photosynthesis, take a second to look at the big picture.

More information

2007 7.013 Problem Set 1 KEY

2007 7.013 Problem Set 1 KEY 2007 7.013 Problem Set 1 KEY Due before 5 PM on FRIDAY, February 16, 2007. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Where in a eukaryotic cell do you

More information

CHAPTER 4: CELLULAR METABOLISM. 2. Distinguish between kinetic and potential energy, and give examples of each.

CHAPTER 4: CELLULAR METABOLISM. 2. Distinguish between kinetic and potential energy, and give examples of each. OBJECTIVES: 1. Compare and contrast the major divisions of metabolism, in terms of a general descriptive sentence, additional descriptive terms, how energy is involved, whether bonds or formed or broken,

More information

Cellular Respiration Stage 4: Electron Transport Chain

Cellular Respiration Stage 4: Electron Transport Chain Cellular Respiration Stage 4: Electron Transport Chain 2006-2007 Cellular respiration What s the point? The point is to make ATP! ATP ATP accounting so far Glycolysis 2 ATP Kreb s cycle 2 ATP Life takes

More information

NO CALCULATORS OR CELL PHONES ALLOWED

NO CALCULATORS OR CELL PHONES ALLOWED Biol 205 Exam 1 TEST FORM A Spring 2008 NAME Fill out both sides of the Scantron Sheet. On Side 2 be sure to indicate that you have TEST FORM A The answers to Part I should be placed on the SCANTRON SHEET.

More information

Photosynthesis and Respiration

Photosynthesis and Respiration Chemical Reactions and Enzymes Do Now Photosynthesis and Respiration 4 Minutes Share Out What is SUCCESS? Success is not gained by defeat Success does not occur over night Success can emerge at anytime

More information

Name: Date: Hour: OK OK OK.. I m sure you all thought that I wouldn t possibly ask you to know more for this chapter SORRY!

Name: Date: Hour: OK OK OK.. I m sure you all thought that I wouldn t possibly ask you to know more for this chapter SORRY! Biology I Cellular Respiration Name: Date: Hour: OK OK OK.. I m sure you all thought that I wouldn t possibly ask you to know more for this chapter SORRY! Now, we need a place to disassemble the molecule

More information

2. What structure absorbs this energy in the plants cell? In other words, where is photosynthesis occurring in the plant?

2. What structure absorbs this energy in the plants cell? In other words, where is photosynthesis occurring in the plant? Section: 3.4 Name: Opening Activity: What is the equation for photosynthesis? Latin Root Word: Review of Old Information: Review of Old Information: 1. All energy begins as what type of energy and from

More information

Proteomics: Principles and Techniques Prof: Sanjeeva Srivastava Department of Biosciences and Bioengineering Indian Institute of Technology, Bombay

Proteomics: Principles and Techniques Prof: Sanjeeva Srivastava Department of Biosciences and Bioengineering Indian Institute of Technology, Bombay (Refer Slide Time: 00:29) Proteomics: Principles and Techniques Prof: Sanjeeva Srivastava Department of Biosciences and Bioengineering Indian Institute of Technology, Bombay Lecture No. # 02 Central Dogma:

More information

Semiconservative DNA replication. Meselson and Stahl

Semiconservative DNA replication. Meselson and Stahl DNA replication Semiconservative DNA replication Meselson and Stahl Hartl Replication of DNA New nucleotides are added to DNA only during replication in the 5-3 direction How double helix unwind DNA synthesis

More information

Transfers of electrons during chemical reactions (oxidation-reduction reactions)

Transfers of electrons during chemical reactions (oxidation-reduction reactions) Transfers of electrons during chemical reactions (oxidation-reduction reactions) Relocation of electrons in food molecules releases energy which can be used to synthesize ATP ATP is used to do ALL types

More information

4Unit One. Metabolic Processes How chemistry becomes Biology! URLs.

4Unit One. Metabolic Processes How chemistry becomes Biology! URLs. 4Unit One URLs http://biology.clc.uc.edu/courses/bio104/cellresp.htm http://users.rcn.com/jkimball.ma.ultranet/biologypages/c/ CellularRespiration.html Chapter 4 http://tidepool.st.usm.edu/crswr/110respiration.html

More information

Lecture Chapter 6. Cellular Respiration

Lecture Chapter 6. Cellular Respiration Lecture 12-13 Chapter 6 Cellular Respiration How do marathon runners and sprinters differ? Long-distance runners have many SLOW FIBERS in their muscles Slow fibers break down glucose for ATP production

More information

DNA, RNA AND PROTEIN SYNTHESIS

DNA, RNA AND PROTEIN SYNTHESIS DNA, RNA AND PROTEIN SYNTHESIS Evolution of Eukaryotic Cells Eukaryotes are larger, more complex cells that contain a nucleus and membrane bound organelles. Oldest eukarytotic fossil is 1800 million years

More information

AP BIOLOGY CHAPTER 7 Cellular Respiration Outline

AP BIOLOGY CHAPTER 7 Cellular Respiration Outline AP BIOLOGY CHAPTER 7 Cellular Respiration Outline I. How cells get energy. A. Cellular Respiration 1. Cellular respiration includes the various metabolic pathways that break down carbohydrates and other

More information

2. Give the formula (with names) for the catabolic degradation of glucose by cellular respiration.

2. Give the formula (with names) for the catabolic degradation of glucose by cellular respiration. Chapter 9: Cellular Respiration: Harvesting Chemical Energy Name Period Overview: Before getting involved with the details of cellular respiration and photosynthesis, take a second to look at the big picture.

More information

SBI4U: Respiration and Photosynthesis Test. [25 marks]

SBI4U: Respiration and Photosynthesis Test. [25 marks] Part 1: Multiple Choice SBI4U: Respiration and Photosynthesis Test Mr. Dykstra Name: [25 marks] 1. Which of the following molecules links glucose oxidation, fatty acid catabolism, and the catabolism of

More information

Using the Energy from Photosynthesis. Harvesting Energy: Glycolysis and Cellular Respiration. Energy Produced through the Breakdown of Glucose

Using the Energy from Photosynthesis. Harvesting Energy: Glycolysis and Cellular Respiration. Energy Produced through the Breakdown of Glucose Harvesting Energy: and Cellular Chapter 8 Using the Energy from Photosynthesis 6CO 2 + 6H 2 O + light C 6 H 12 O 6 + 6O 2 + heat Some ATP is produced in photosynthesis, but most energy is stored in sugars.

More information

Answers Chapters 8 & 9 Review Photosynthesis & Cellular Respiration

Answers Chapters 8 & 9 Review Photosynthesis & Cellular Respiration Answers Chapters 8 & 9 Review Photosynthesis & Cellular Respiration Photosynthesis: 1. What is the term for the ability to perform work? Energy 2. Organisms that make their own food are called producers

More information

Introduction to Biology Respiration Chapter 5

Introduction to Biology Respiration Chapter 5 Introduction to Biology Respiration Chapter 5 Introduction Being alive is work. Cells organize small organic molecules into polymers such as the proteins, carbohydrates, and so forth you studied last week.

More information

AP BIOLOGY 2009 SCORING GUIDELINES

AP BIOLOGY 2009 SCORING GUIDELINES AP BIOLOGY 2009 SCORING GUIDELINES Question 2 ATP and GTP are primary sources of energy for biochemical reactions. (a) Describe the structure of the ATP or the GTP molecule. (1 point each; 2 points maximum)

More information

ENERGY AND METABOLISM 1

ENERGY AND METABOLISM 1 ENERGY AND METABOLISM 1 Respiration and Fermentation 1. Some bacteria can use carbon dioxide rather than oxygen as the prime oxidizing molecule and therefore produce methane (CH4) rather than water as

More information

How to Use this Practice Exam:

How to Use this Practice Exam: How to Use this Practice Exam: I post practice exams to allow you to get a real sense of the experience of taking a Biology 200 exam. The best way to use each exam is as follows. 1. Do NOT answer the questions

More information

Solutions for Biochemistry Unit Exam

Solutions for Biochemistry Unit Exam Solutions for Biochemistry Unit Exam Question 1 a) An example of a structural representation is shown in the adjacent box. Draw a structural representation of the amino acid, Aspartic acid, which has the

More information

Nucleotides and Nucleic Acids

Nucleotides and Nucleic Acids Nucleotides and Nucleic Acids Brief History 1 1869 - Miescher Isolated nuclein from soiled bandages 1902 - Garrod Studied rare genetic disorder: Alkaptonuria; concluded that specific gene is associated

More information

Visualizing Cell Processes

Visualizing Cell Processes Visualizing Cell Processes A Series of Five Programs produced by BioMEDIA ASSOCIATES Content Guide for Program 3 Photosynthesis and Cellular Respiration Copyright 2001, BioMEDIA ASSOCIATES www.ebiomedia.com

More information

Anabolic and Catabolic Reactions are Linked by ATP in Living Organisms

Anabolic and Catabolic Reactions are Linked by ATP in Living Organisms Chapter 5: Microbial Metabolism Microbial Metabolism Metabolism refers to all chemical reactions that occur within a living a living organism. These chemical reactions are generally of two types: Catabolic:

More information

Metabolism and Bioenergetics Part 1: Intro and Acetyl CoA

Metabolism and Bioenergetics Part 1: Intro and Acetyl CoA Take notes while watching the following video tutorials to prepare for the Metabolism Part 2 Activity. Metabolism and Bioenergetics Part 1: Intro and Acetyl CoA Metabolism ALL biochemical reactions involving

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

Aerobic Respiration: steps

Aerobic Respiration: steps Chapter 5 Metabolism: Aerobic Respiration Dr. Amy Rogers Bio 139 Fall 2006 Office Hours: Mondays & Wednesdays, 8:30-10:00 AM Some figures taken from Krogh Biology: A Guide to the Natural World Bacterial

More information

Chapter 9 Cellular Respiration

Chapter 9 Cellular Respiration Chapter 9 Cellular Respiration Cells require outside energy to do cellular work. Energy flows ( (تتدفق into most ecosystems ( بيئية (أنظمة as sunlight Photosynthetic organisms trap a portion of the sunlight

More information

ATP and Cellular Respiration NOTES

ATP and Cellular Respiration NOTES ATP AND ENERGY: ATP and Cellular Respiration NOTES Living things need continuous input of ENERGY to sustain life ENERGY is defined as the capacity of a system to perform work or an action. Living organisms

More information

Aerobic organisms obtain energy from oxidation of food molecules

Aerobic organisms obtain energy from oxidation of food molecules Experiment: Time-course of water and oxygen uptake, and seed germination Aerobic organisms obtain energy from oxidation of food molecules Pradet et al 1968; 1981) Interpret results Becker et al. Third

More information

Harvesting Energy: Glycolysis and Cellular Respiration. Chapter 8

Harvesting Energy: Glycolysis and Cellular Respiration. Chapter 8 Harvesting Energy: Glycolysis and Cellular Respiration Chapter 8 Overview of Glucose Breakdown The overall equation for the complete breakdown of glucose is: C 6 H 12 O 6 + 6O 2 6CO 2 + 6H 2 O + ATP The

More information

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Molecular Genetics. RNA, Transcription, & Protein Synthesis Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and

More information

* Is chemical energy potential or kinetic energy? The position of what is storing energy?

* Is chemical energy potential or kinetic energy? The position of what is storing energy? Biology 1406 Exam 2 - Metabolism Chs. 5, 6 and 7 energy - capacity to do work 5.10 kinetic energy - energy of motion : light, electrical, thermal, mechanical potential energy - energy of position or stored

More information

Summary of Metabolism. Mechanism of Enzyme Action

Summary of Metabolism. Mechanism of Enzyme Action Summary of Metabolism Mechanism of Enzyme Action 1. The substrate contacts the active site 2. The enzyme-substrate complex is formed. 3. The substrate molecule is altered (atoms are rearranged, or the

More information

1. Explain the difference between fermentation and cellular respiration.

1. Explain the difference between fermentation and cellular respiration. : Harvesting Chemical Energy Name Period Overview: Before getting involved with the details of cellular respiration and photosynthesis, take a second to look at the big picture. Photosynthesis and cellular

More information

008 Chapter 8. Student:

008 Chapter 8. Student: 008 Chapter 8 Student: 1. Some bacteria are strict aerobes and others are strict anaerobes. Some bacteria, however, are facultative anaerobes and can live with or without oxygen. If given the choice of

More information

Study Guide Chapter 12

Study Guide Chapter 12 Study Guide Chapter 12 1. Know ALL of your vocabulary words! 2. Name the following scientists with their contributions to Discovering DNA: a. Strains can be transformed (or changed) into other forms while

More information