C A. How many high-energy phosphate bonds would be consumed during the replication of a 10-nucleotide DNA sequence (synthesis of a single-strand)?

Size: px
Start display at page:

Download "C A. How many high-energy phosphate bonds would be consumed during the replication of a 10-nucleotide DNA sequence (synthesis of a single-strand)?"

Transcription

1 1. (20 points) Provide a brief answer to the following questions. You may use diagrams or equations, as appropriate, but your answer should be largely a written response of two or three sentences. 4. The final stages of aerobic oxidation of glucose occur in the mitochondria. This involves two coupled processes: [1] the oxidation of NADH and QH 2 through an electron transport chain and [2] the synthesis of ATP. How are these two processes linked? (10 points) 5. ATP synthase increases the concentration of ATP in the matrix of the mitochondria. How is ATP made available to the cell if it is released just in the matrix? (10 points) a. The oxidation of NADH and QH 2 through the electron transport chain results in the ultimate reduction of oxygen to water and the development of a proton gradient. The proton gradient is the potential energy source that drives the phosphorylation of ADP to give ATP. b. Although ATP is synthesized and released on the matrix side of the inner mitochondrial membrane, transporters, called ATP translocase, are available to export ATP across the inner membrane to the cytosol. 2. (20 points) Provide a brief answer to the following questions. You may use diagrams or equations, as appropriate, but your answer should be largely a written response of two or three sentences. Photosynthesis involves a process of energy capture and storage. What features of the electron transport/oxidative phosphorylation process seen in our study of glycolysis are similar to the energy capture and storage process seen in photosynthesis? You should be able to name at least two similarities. What are some of the differences? You should be able to name at least two differences. There are several possible answers. Here are a few: Similarities: [1] Photosynthesis involves an electron transport chain, albeit different from the one seen in mitochondria, and [2] photosynthesis involves the development of a proton gradient in order to drive ATP synthesis. Differences: [1] photosynthesis involves light energy capture as an energy source; mitochondrial electron transport/oxidative phosphorylation involves glucose (or related carbohydrates) as an energy source; [2] mitochondrial electron transport/oxidative phosphorylation involves NADH; photosynthesis involves NADPH; [3] mitochondrial electron transport/oxidative phosphorylation involves the consumption of carbohydrates; photosynthesis involves the production of carbohydrates; [4] mitochondrial electron transport/oxidative phosphorylation involves the reduction of oxygen to water; photosynthesis involves the oxidation of water to oxygen

2 3. Select the letter that best answers the following questions and place the letter in the blank in front of the question (20 points; 4 points each). C A. How many high-energy phosphate bonds would be consumed during the replication of a 10-nucleotide DNA sequence (synthesis of a single-strand)? (A) 9 (B) 10 (C) nucleotides consumed and 2 high energy P-bonds used in each step. (D) 18 (E) 8 B B. A polynucleotide is a polymer in which: (A) the two ends are structurally equivalent. (B) the monomeric units are joined by phosphodiester bonds. (C) there are at least 20 different kinds of monomers that can be used. (D) purine and pyrimidine bases are the repeating units. (No-ribose sugars are repeating units). (E) the monomeric units are not subject to hydrolysis. B C. All of the following tend to favor a helical conformation of a single polynucleotide chain EXCEPT: (A) hydrophobic interactions of the rings of the purine and pyrimidine bases that exclude water. (B) hydrogen bonding between appropriate purine-pyrimidine pairs. (Single polynucleotide chain). (C) spacing of bases in the helical conformation that excludes water. (D) the absence of a 2 hydroxyl group. (E) all of the above. E D. How would the use of a DNA polymerase III mutant enzyme with a 10-fold greater rate of 3 to 5 exonuclease activity change the process of DNA replication? (A) the fidelity of DNA replication would be increased. (B) the rate of nick-translation would increase. (C) the rate of lagging strand synthesis would be increased. (D) the rate of DNA replication would be decreased. E E. Initiation of replication in bacteria:

3 (A) begins with dnag binding at the OriC site. (B) forms a primisome, which then uses a topoisomerase to open a replication fork. (C) begins with dnaa binding, which results in the formation of several bubbles each consisting of many nucleotide pairs. No- Only one bubble. (D) requires the action of helicase to allow SSB protein binding to begin lagging strand synthesis. (E) none of the above. 4. (10 points) Draw the structure of UTP. Circle the positions within the ring that could be used to form hydrogen bonds with its complementary base. See text book. 5. (30 points) Below are the sequences of several short DNA duplexes. Please redraw the molecules to indicate how they would be altered in the reaction catalyzed by the addition of the indicated enzyme in the presence of an excess of datp, dctp, and dgtp, but no dttp. The ^ indicates the presence of a nick in the DNA strand (be sure to use this symbol to indicate a nick in your structures). Briefly explain your answer for full credit. a). DNA polymerase III 5 GGGGGCCCCCTTAAAAA 3 CCGG GGAATTTTTCAGCC 5 GGGGGCCCCCTTAAAAAG No dttp so no more extension. 3 CCCCCGGGGGAATTTTTCAGCC ^Nick remains 3 to new G b). DNA polymerase I 5 GGGGGACCCCCT 3 CCCCCTGGGGGAAAAA Nick 5 GGGGGACCCCCT No dttp so no more extension. 3 CCCCC GGGGGAAAAA Nick translation removes and replaces G s and removes the T, but can not replace leaving a gap. c). Telomerase (with an internal RNA template strand of 5 CCAAGG)

4 Telomer sequence to be added 5 -CCTTGG (complementary to template). However, no dttp is available, so only begin first telomer repeat. 5 GGGCCCGGGGCC 3 CCGGCCCGGGCCC BCH401G Exam 4 Fall 2000 Make-up Exam (differences) 3) B, but E accepted B. The best definition of an exonuclease is an enzyme that hydrolyzes: (A) a nucleotide from the 3 end of a RNA primer. (B) a nucleotide from either terminal of a polynucleotide. (C) a phosphodiester bond on the interior of a polynucleotide. (D) a bond only in a specific sequence of nucleotides. E D. How would the use of a DNA polymerase I mutant enzyme with a 10-fold greater rate of 3 to 5 exonuclease activity change the process of DNA replication? (A) the fidelity of DNA replication would be increased. (B) the rate of nick-translation would increase. (C) the rate of lagging strand synthesis would be increased. (D) the rate of DNA replication would be decreased. D E. In eukaryotic DNA replication: (A) only one replisome forms because there is a single origin of replication. (B) the leading and lagging strands are synthesized by the same enzyme. (C) helicases are not necessary. (D) at least one DNA polymerase has a 3 to 5 exonuclease activity. (E) the process occurs throughout the cell cycle. 4. (10 points) Draw the structure of a dgtp:ctp base pair. Be sure to indicate the positions within the ring that are used to form hydrogen bonds (and draw these bonds). See text: CTP is a ribonucleotide.

5 5. (30 points) Below are the sequences of several short DNA duplexes. Please redraw the molecules to indicate how they would be altered in the reaction catalyzed by the addition of the indicated enzyme in the presence of an excess of datp, dctp, dgtp, and TTP. The ^ indicates the presence of a nick in the DNA strand (be sure to use this symbol to indicate a nick in your structures). Briefly explain your answer for full credit. a). DNA polymerase I and ligase 5 GGGGGCCCCCTTAAAAA 3 CCGG GGAATTTTTCAGCC 5 GGGGGCCCCCTTAAAAAG No dttp so no more extension. 3 CCCCCGGGGGAATTTTTCAGCC PolI fills in gap to generate nick, then completes nick translation along bottom strand.

DNA Replication in Prokaryotes

DNA Replication in Prokaryotes OpenStax-CNX module: m44488 1 DNA Replication in Prokaryotes OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,

More information

DNA. Discovery of the DNA double helix

DNA. Discovery of the DNA double helix DNA Replication DNA Discovery of the DNA double helix A. 1950 s B. Rosalind Franklin - X-ray photo of DNA. C. Watson and Crick - described the DNA molecule from Franklin s X-ray. What is DNA? Question:

More information

Bio 102 Practice Problems Chromosomes and DNA Replication

Bio 102 Practice Problems Chromosomes and DNA Replication Bio 102 Practice Problems Chromosomes and DNA Replication Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which one of the following enzymes is NT a key player in the process

More information

The correct answer is d C. Answer c is incorrect. Reliance on the energy produced by others is a characteristic of heterotrophs.

The correct answer is d C. Answer c is incorrect. Reliance on the energy produced by others is a characteristic of heterotrophs. 1. An autotroph is an organism that a. extracts energy from organic sources b. converts energy from sunlight into chemical energy c. relies on the energy produced by other organisms as an energy source

More information

Photosynthesis takes place in three stages:

Photosynthesis takes place in three stages: Photosynthesis takes place in three stages: Light-dependent reactions Light-independent reactions The Calvin cycle 1. Capturing energy from sunlight 2. Using energy to make ATP and NADPH 3. Using ATP and

More information

4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?

4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true? Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.

More information

DNA: Structure and Replication

DNA: Structure and Replication 7 DNA: Structure and Replication WORKING WITH THE FIGURES 1. In Table 7-1, why are there no entries for the first four tissue sources? For the last three entries, what is the most likely explanation for

More information

Student name ID # 2. (4 pts) What is the terminal electron acceptor in respiration? In photosynthesis? O2, NADP+

Student name ID # 2. (4 pts) What is the terminal electron acceptor in respiration? In photosynthesis? O2, NADP+ 1. Membrane transport. A. (4 pts) What ion couples primary and secondary active transport in animal cells? What ion serves the same function in plant cells? Na+, H+ 2. (4 pts) What is the terminal electron

More information

Energy Production In A Cell (Chapter 25 Metabolism)

Energy Production In A Cell (Chapter 25 Metabolism) Energy Production In A Cell (Chapter 25 Metabolism) Large food molecules contain a lot of potential energy in the form of chemical bonds but it requires a lot of work to liberate the energy. Cells need

More information

STRUCTURES OF NUCLEIC ACIDS

STRUCTURES OF NUCLEIC ACIDS CHAPTER 2 STRUCTURES OF NUCLEIC ACIDS What is the chemical structure of a deoxyribonucleic acid (DNA) molecule? DNA is a polymer of deoxyribonucleotides. All nucleic acids consist of nucleotides as building

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

Chapter 7 Active Reading Guide Cellular Respiration and Fermentation

Chapter 7 Active Reading Guide Cellular Respiration and Fermentation Name: AP Biology Mr. Croft Chapter 7 Active Reading Guide Cellular Respiration and Fermentation Overview: Before getting involved with the details of cellular respiration and photosynthesis, take a second

More information

Q: How are proteins (amino acid chains) made from the information in mrna? A: Translation Ribosomes translate mrna into protein

Q: How are proteins (amino acid chains) made from the information in mrna? A: Translation Ribosomes translate mrna into protein ranslation (written lesson) Q: How are proteins (amino acid chains) made from the information in mrn? : ranslation Ribosomes translate mrn into protein ranslation has 3 steps also! 1. ranslation Initiation:

More information

Electron Transport Generates a Proton Gradient Across the Membrane

Electron Transport Generates a Proton Gradient Across the Membrane Electron Transport Generates a Proton Gradient Across the Membrane Each of respiratory enzyme complexes couples the energy released by electron transfer across it to an uptake of protons from water in

More information

Chapter 6 DNA Replication

Chapter 6 DNA Replication Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore

More information

Chapter 9 Cellular Respiration

Chapter 9 Cellular Respiration Chapter 9 Cellular Respiration Electrons carried in NADH Mitochondrion Glucose Glycolysis Pyruvic acid Krebs Cycle Electrons carried in NADH and FADH 2 Electron Transport Chain Cytoplasm Mitochondrion

More information

AP BIOLOGY 2015 SCORING GUIDELINES

AP BIOLOGY 2015 SCORING GUIDELINES AP BIOLOGY 2015 SCORING GUIDELINES Question 2 Figure 1. Glycolysis and pyruvate oxidation Figure 2. Krebs cycle Figure 3. Electron transport chain Cellular respiration includes the metabolic pathways of

More information

AP Bio Photosynthesis & Respiration

AP Bio Photosynthesis & Respiration AP Bio Photosynthesis & Respiration Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. What is the term used for the metabolic pathway in which

More information

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional

More information

2007 7.013 Problem Set 1 KEY

2007 7.013 Problem Set 1 KEY 2007 7.013 Problem Set 1 KEY Due before 5 PM on FRIDAY, February 16, 2007. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Where in a eukaryotic cell do you

More information

NO CALCULATORS OR CELL PHONES ALLOWED

NO CALCULATORS OR CELL PHONES ALLOWED Biol 205 Exam 1 TEST FORM A Spring 2008 NAME Fill out both sides of the Scantron Sheet. On Side 2 be sure to indicate that you have TEST FORM A The answers to Part I should be placed on the SCANTRON SHEET.

More information

Cellular Respiration Stage 4: Electron Transport Chain

Cellular Respiration Stage 4: Electron Transport Chain Cellular Respiration Stage 4: Electron Transport Chain 2006-2007 Cellular respiration What s the point? The point is to make ATP! ATP ATP accounting so far Glycolysis 2 ATP Kreb s cycle 2 ATP Life takes

More information

Semiconservative DNA replication. Meselson and Stahl

Semiconservative DNA replication. Meselson and Stahl DNA replication Semiconservative DNA replication Meselson and Stahl Hartl Replication of DNA New nucleotides are added to DNA only during replication in the 5-3 direction How double helix unwind DNA synthesis

More information

AP BIOLOGY CHAPTER 7 Cellular Respiration Outline

AP BIOLOGY CHAPTER 7 Cellular Respiration Outline AP BIOLOGY CHAPTER 7 Cellular Respiration Outline I. How cells get energy. A. Cellular Respiration 1. Cellular respiration includes the various metabolic pathways that break down carbohydrates and other

More information

Nucleotides and Nucleic Acids

Nucleotides and Nucleic Acids Nucleotides and Nucleic Acids Brief History 1 1869 - Miescher Isolated nuclein from soiled bandages 1902 - Garrod Studied rare genetic disorder: Alkaptonuria; concluded that specific gene is associated

More information

Visualizing Cell Processes

Visualizing Cell Processes Visualizing Cell Processes A Series of Five Programs produced by BioMEDIA ASSOCIATES Content Guide for Program 3 Photosynthesis and Cellular Respiration Copyright 2001, BioMEDIA ASSOCIATES www.ebiomedia.com

More information

Harvesting Energy: Glycolysis and Cellular Respiration. Chapter 8

Harvesting Energy: Glycolysis and Cellular Respiration. Chapter 8 Harvesting Energy: Glycolysis and Cellular Respiration Chapter 8 Overview of Glucose Breakdown The overall equation for the complete breakdown of glucose is: C 6 H 12 O 6 + 6O 2 6CO 2 + 6H 2 O + ATP The

More information

Anabolic and Catabolic Reactions are Linked by ATP in Living Organisms

Anabolic and Catabolic Reactions are Linked by ATP in Living Organisms Chapter 5: Microbial Metabolism Microbial Metabolism Metabolism refers to all chemical reactions that occur within a living a living organism. These chemical reactions are generally of two types: Catabolic:

More information

* Is chemical energy potential or kinetic energy? The position of what is storing energy?

* Is chemical energy potential or kinetic energy? The position of what is storing energy? Biology 1406 Exam 2 - Metabolism Chs. 5, 6 and 7 energy - capacity to do work 5.10 kinetic energy - energy of motion : light, electrical, thermal, mechanical potential energy - energy of position or stored

More information

Chapter 9 Review Worksheet Cellular Respiration

Chapter 9 Review Worksheet Cellular Respiration 1 of 5 11/9/2011 8:11 PM Name: Hour: Chapter 9 Review Worksheet Cellular Respiration Energy in General 1. Differentiate an autotroph from a hetertroph as it relates to obtaining energy and the processes

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

1. Explain the difference between fermentation and cellular respiration.

1. Explain the difference between fermentation and cellular respiration. : Harvesting Chemical Energy Name Period Overview: Before getting involved with the details of cellular respiration and photosynthesis, take a second to look at the big picture. Photosynthesis and cellular

More information

008 Chapter 8. Student:

008 Chapter 8. Student: 008 Chapter 8 Student: 1. Some bacteria are strict aerobes and others are strict anaerobes. Some bacteria, however, are facultative anaerobes and can live with or without oxygen. If given the choice of

More information

Summary of Metabolism. Mechanism of Enzyme Action

Summary of Metabolism. Mechanism of Enzyme Action Summary of Metabolism Mechanism of Enzyme Action 1. The substrate contacts the active site 2. The enzyme-substrate complex is formed. 3. The substrate molecule is altered (atoms are rearranged, or the

More information

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Molecular Genetics. RNA, Transcription, & Protein Synthesis Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and

More information

Chem 306 Chapter 21 Bioenergetics Lecture Outline III

Chem 306 Chapter 21 Bioenergetics Lecture Outline III Chem 306 Chapter 21 Bioenergetics Lecture Outline III I. HOW IS ATP GENERATED IN THE FINAL STAGE CATABOLISM? A. OVERVIEW 1. At the end of the citric acid cycle, all six carbons of glucose have been oxidized

More information

Cellular Respiration and Fermentation

Cellular Respiration and Fermentation LECTURE PRESENTATIONS For CAMPBELL BIOLOGY, NINTH EDITION Jane B. Reece, Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Robert B. Jackson Chapter 9 Cellular Respiration and Fermentation

More information

Carbon Hydrogen Oxygen Nitrogen

Carbon Hydrogen Oxygen Nitrogen Concept 1 - Thinking Practice 1. If the following molecules were to undergo a dehydration synthesis reaction, what molecules would result? Circle the parts of each amino acid that will interact and draw

More information

Chapter 4. Photosynthesis and Cellular Respiration Worksheets. 63 www.ck12.org

Chapter 4. Photosynthesis and Cellular Respiration Worksheets. 63 www.ck12.org Chapter 4 Photosynthesis and Cellular Respiration Worksheets (Opening image copyright by Derek Ramsey, http://en.wikipedia.org/wiki/file:monarch_butterfly_ Danaus_plexippus_Feeding_Down_3008px.jpg, and

More information

SOME Important Points About Cellular Energetics by Dr. Ty C.M. Hoffman

SOME Important Points About Cellular Energetics by Dr. Ty C.M. Hoffman SOME Important Points About Cellular Energetics by Dr. Ty C.M. Hoffman An Introduction to Metabolism Most biochemical processes occur as biochemical pathways, each individual reaction of which is catalyzed

More information

-Loss of energy -Loss of hydrogen from carbons. -Gain of energy -Gain of hydrogen to carbons

-Loss of energy -Loss of hydrogen from carbons. -Gain of energy -Gain of hydrogen to carbons Cellular Respiration- Equation C6H12O6 + 6O2 6CO2 +6H20 and energy -The energy is released from the chemical bonds in the complex organic molecules -The catabolic process of releasing energy from food

More information

What affects an enzyme s activity? General environmental factors, such as temperature and ph. Chemicals that specifically influence the enzyme.

What affects an enzyme s activity? General environmental factors, such as temperature and ph. Chemicals that specifically influence the enzyme. CH s 8-9 Respiration & Metabolism Metabolism A catalyst is a chemical agent that speeds up a reaction without being consumed by the reaction. An enzyme is a catalytic protein. Hydrolysis of sucrose by

More information

Multiple Choice Identify the choice that best completes the statement or answers the question.

Multiple Choice Identify the choice that best completes the statement or answers the question. AP bio fall 2014 final exam prep Multiple Choice Identify the choice that best completes the statement or answers the question. 1. According to the first law of thermodynamics, a. the energy of a system

More information

PHOTOSYNTHESIS AND CELLULAR RESPIRATION

PHOTOSYNTHESIS AND CELLULAR RESPIRATION reflect Wind turbines shown in the photo on the right are large structures with blades that move in response to air movement. When the wind blows, the blades rotate. This motion generates energy that is

More information

The amount of cellular adenine is constant. -It exists as either ATP, ADP, or AMP (the concentration of these vary)

The amount of cellular adenine is constant. -It exists as either ATP, ADP, or AMP (the concentration of these vary) Electron transport chain Final stage of aerobic oxidation! Also known as: -oxidative phosphorylation(when coupled to ATP synthase) -respiration (when coupled to ATP synthase) Purpose: -Recycle reduced

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

Proteins and Nucleic Acids

Proteins and Nucleic Acids Proteins and Nucleic Acids Chapter 5 Macromolecules: Proteins Proteins Most structurally & functionally diverse group of biomolecules. : o Involved in almost everything o Enzymes o Structure (keratin,

More information

BCOR 011 Exam 2, 2004

BCOR 011 Exam 2, 2004 BCOR 011 Exam 2, 2004 Name: Section: MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1. According to the first law of thermodynamics, A. the universe

More information

Bioenergetics Module A Anchor 3

Bioenergetics Module A Anchor 3 Bioenergetics Module A Anchor 3 Key Concepts: - ATP can easily release and store energy by breaking and re-forming the bonds between its phosphate groups. This characteristic of ATP makes it exceptionally

More information

Cellular Respiration Worksheet 1. 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain.

Cellular Respiration Worksheet 1. 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain. Cellular Respiration Worksheet 1 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain. 2. Where in the cell does the glycolysis part of cellular

More information

Chapter 9 Mitochondrial Structure and Function

Chapter 9 Mitochondrial Structure and Function Chapter 9 Mitochondrial Structure and Function 1 2 3 Structure and function Oxidative phosphorylation and ATP Synthesis Peroxisome Overview 2 Mitochondria have characteristic morphologies despite variable

More information

CELL/ PHOTOSYNTHESIS/ CELLULAR RESPIRATION Test 2011 ANSWER 250 POINTS ANY WAY IN WHICH YOU WANT

CELL/ PHOTOSYNTHESIS/ CELLULAR RESPIRATION Test 2011 ANSWER 250 POINTS ANY WAY IN WHICH YOU WANT CELL/ PHOTOSYNTHESIS/ CELLULAR RESPIRATION Test 2011 ANSWER 250 POINTS ANY WAY IN WHICH YOU WANT Completion: complete each statement. (1 point each) 1. All cells arise from. 2. The basic unit of structure

More information

3120-1 - Page 1. Name:

3120-1 - Page 1. Name: Name: 1) Which series is arranged in correct order according to decreasing size of structures? A) DNA, nucleus, chromosome, nucleotide, nitrogenous base B) chromosome, nucleus, nitrogenous base, nucleotide,

More information

How To Understand The Chemistry Of Organic Molecules

How To Understand The Chemistry Of Organic Molecules CHAPTER 3 THE CHEMISTRY OF ORGANIC MOLECULES 3.1 Organic Molecules The chemistry of carbon accounts for the diversity of organic molecules found in living things. Carbon has six electrons, four of which

More information

Chapter 19a Oxidative Phosphorylation and Photophosphorylation. Multiple Choice Questions

Chapter 19a Oxidative Phosphorylation and Photophosphorylation. Multiple Choice Questions Chapter 19a Oxidative Phosphorylation and Photophosphorylation Multiple Choice Questions 1. Electron-transfer reactions in mitochondria Page: 707 Difficulty: 1 Ans: E Almost all of the oxygen (O 2 ) one

More information

Sample Questions for Exam 3

Sample Questions for Exam 3 Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.

More information

Chloroplasts and Mitochondria

Chloroplasts and Mitochondria Name: KEY Period: Chloroplasts and Mitochondria Plant cells and some Algae contain an organelle called the chloroplast. The chloroplast allows plants to harvest energy from sunlight to carry on a process

More information

Todays Outline. Metabolism. Why do cells need energy? How do cells acquire energy? Metabolism. Concepts & Processes. The cells capacity to:

Todays Outline. Metabolism. Why do cells need energy? How do cells acquire energy? Metabolism. Concepts & Processes. The cells capacity to: and Work Metabolic Pathways Enzymes Features Factors Affecting Enzyme Activity Membrane Transport Diffusion Osmosis Passive Transport Active Transport Bulk Transport Todays Outline -Releasing Pathways

More information

1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.

1. Molecular computation uses molecules to represent information and molecular processes to implement information processing. Chapter IV Molecular Computation These lecture notes are exclusively for the use of students in Prof. MacLennan s Unconventional Computation course. c 2013, B. J. MacLennan, EECS, University of Tennessee,

More information

A disaccharide is formed when a dehydration reaction joins two monosaccharides. This covalent bond is called a glycosidic linkage.

A disaccharide is formed when a dehydration reaction joins two monosaccharides. This covalent bond is called a glycosidic linkage. CH 5 Structure & Function of Large Molecules: Macromolecules Molecules of Life All living things are made up of four classes of large biological molecules: carbohydrates, lipids, proteins, and nucleic

More information

Photosynthesis and Cellular Respiration. Stored Energy

Photosynthesis and Cellular Respiration. Stored Energy Photosynthesis and Cellular Respiration Stored Energy What is Photosynthesis? plants convert the energy of sunlight into the energy in the chemical bonds of carbohydrates sugars and starches. SUMMARY EQUATION:

More information

How Cells Release Chemical Energy Cellular Respiration

How Cells Release Chemical Energy Cellular Respiration How Cells Release Chemical Energy Cellular Respiration Overview of Carbohydrate Breakdown Pathways Photoautotrophs make ATP during photosynthesis and use it to synthesize glucose and other carbohydrates

More information

21.8 The Citric Acid Cycle

21.8 The Citric Acid Cycle 21.8 The Citric Acid Cycle The carbon atoms from the first two stages of catabolism are carried into the third stage as acetyl groups bonded to coenzyme A. Like the phosphoryl groups in ATP molecules,

More information

1.5 page 3 DNA Replication S. Preston 1

1.5 page 3 DNA Replication S. Preston 1 AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 3 l. DNA Replication 1. Go through PowerPoint 2. Read notes p2 and then watch the animation

More information

Photosynthesis (CO 2 + H 2 O C 6 H 12 O 6 + O 2 )

Photosynthesis (CO 2 + H 2 O C 6 H 12 O 6 + O 2 ) The vital role of A This is the energy-rich compound that is the source of energy for all living things. It is a nucleotide, comprising a 5C sugar (ribose); an organic base (adenosine); and 3 phosphate

More information

DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH)

DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH) DNA, RNA, replication, translation, and transcription Overview Recall the central dogma of biology: DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) DNA structure

More information

Cellular Respiration & Metabolism. Metabolism. Coupled Reactions: Bioenergetics. Cellular Respiration: ATP is the cell s rechargable battery

Cellular Respiration & Metabolism. Metabolism. Coupled Reactions: Bioenergetics. Cellular Respiration: ATP is the cell s rechargable battery Cellular Respiration & Metabolism Metabolic Pathways: a summary Metabolism Bioenergetics Flow of energy in living systems obeys: 1 st law of thermodynamics: Energy can be transformed, but it cannot be

More information

The Molecules of Life - Overview. The Molecules of Life. The Molecules of Life. The Molecules of Life

The Molecules of Life - Overview. The Molecules of Life. The Molecules of Life. The Molecules of Life The Molecules of Life - Overview The Molecules of Life The Importance of Carbon Organic Polymers / Monomers Functions of Organic Molecules Origin of Organic Molecules The Molecules of Life Water is the

More information

Disaccharides consist of two monosaccharide monomers covalently linked by a glycosidic bond. They function in sugar transport.

Disaccharides consist of two monosaccharide monomers covalently linked by a glycosidic bond. They function in sugar transport. 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions that occur in specialized areas of the organism s cells. As a basis for understanding this concept: 1.

More information

8-3 The Reactions of Photosynthesis Slide 1 of 51

8-3 The Reactions of Photosynthesis Slide 1 of 51 8-3 The of Photosynthesis 1 of 51 Inside a Chloroplast Inside a Chloroplast In plants, photosynthesis takes place inside chloroplasts. Plant Chloroplast Plant cells 2 of 51 Inside a Chloroplast Chloroplasts

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

Chapter 7 Cellular Respiration

Chapter 7 Cellular Respiration Phases of aerobic cellular respiration 1. Glycolysis 2. Transition or Acetyl-CoA reaction 3. Krebs cycle 4. Electron transport system Chapter 7 Cellular Respiration These phases are nothing more than metabolic

More information

Photosynthesis Practice. 2. Chlorophyll a and b absorb _B -_V and _R wavelengths of light best.

Photosynthesis Practice. 2. Chlorophyll a and b absorb _B -_V and _R wavelengths of light best. Photosynthesis Practice Fill in the blanks. Name Date Period 1. Molecules that collect light energy are called _P. 2. Chlorophyll a and b absorb _B -_V and _R wavelengths of light best. 3. _C is the main

More information

RESPIRATION AND FERMENTATION: AEROBIC AND ANAEROBIC OXIDATION OF ORGANIC MOLECULES. Bio 171 Week 6

RESPIRATION AND FERMENTATION: AEROBIC AND ANAEROBIC OXIDATION OF ORGANIC MOLECULES. Bio 171 Week 6 RESPIRATION AND FERMENTATION: AEROBIC AND ANAEROBIC OXIDATION OF ORGANIC MOLECULES Bio 171 Week 6 Procedure Label test tubes well, including group name 1) Add solutions listed to small test tubes 2) For

More information

4. Which carbohydrate would you find as part of a molecule of RNA? a. Galactose b. Deoxyribose c. Ribose d. Glucose

4. Which carbohydrate would you find as part of a molecule of RNA? a. Galactose b. Deoxyribose c. Ribose d. Glucose 1. How is a polymer formed from multiple monomers? a. From the growth of the chain of carbon atoms b. By the removal of an OH group and a hydrogen atom c. By the addition of an OH group and a hydrogen

More information

1. Enzymes. Biochemical Reactions. Chapter 5: Microbial Metabolism. 1. Enzymes. 2. ATP Production. 3. Autotrophic Processes

1. Enzymes. Biochemical Reactions. Chapter 5: Microbial Metabolism. 1. Enzymes. 2. ATP Production. 3. Autotrophic Processes Chapter 5: Microbial Metabolism 1. Enzymes 2. ATP Production 3. Autotrophic Processes 1. Enzymes Biochemical Reactions All living cells depend on biochemical reactions to maintain homeostasis. All of the

More information

Biology 20 Cellular Respiration Review NG Know the process of Cellular Respiration (use this picture if it helps):

Biology 20 Cellular Respiration Review NG Know the process of Cellular Respiration (use this picture if it helps): Biology 20 Cellular Respiration Review NG Know the process of Cellular Respiration (use this picture if it helps): 1) How many ATP molecules are produced for each glucose molecule used in fermentation?

More information

Appendix C DNA Replication & Mitosis

Appendix C DNA Replication & Mitosis K.Muma Bio 6 Appendix C DNA Replication & Mitosis Study Objectives: Appendix C: DNA replication and Mitosis 1. Describe the structure of DNA and where it is found. 2. Explain complimentary base pairing:

More information

1. f. Students know usable energy is captured from sunlight by chloroplasts and is stored through the synthesis of sugar from carbon dioxide.

1. f. Students know usable energy is captured from sunlight by chloroplasts and is stored through the synthesis of sugar from carbon dioxide. 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions that occur in specialized areas of the organism s cells. As a basis for understanding this concept: 1.

More information

2006 7.012 Problem Set 3 KEY

2006 7.012 Problem Set 3 KEY 2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each

More information

Green pigment that absorbs solar energy and is important in photosynthesis

Green pigment that absorbs solar energy and is important in photosynthesis PHOTOSYNTHESIS REVIEW SHEET FOR TEST Part A: Match the terms below with the correct description Chlorophyll Chloroplast Electromagnetic spectrum Electron transport chain Grana Light-dependant reactions

More information

Cellular Respiration An Overview

Cellular Respiration An Overview Why? Cellular Respiration An Overview What are the phases of cellular respiration? All cells need energy all the time, and their primary source of energy is ATP. The methods cells use to make ATP vary

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

RNA & Protein Synthesis

RNA & Protein Synthesis RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis

More information

Ms. Campbell Protein Synthesis Practice Questions Regents L.E.

Ms. Campbell Protein Synthesis Practice Questions Regents L.E. Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide

More information

ATP Synthesis. Lecture 13. Dr. Neil Docherty

ATP Synthesis. Lecture 13. Dr. Neil Docherty PG1005 The Electron Transport Chain and ATP Synthesis Lecture 13 Dr. Neil Docherty My Teaching Objectives Define and describe the electron transport chain Explain how electron transfer couples to proton

More information

DNA is found in all organisms from the smallest bacteria to humans. DNA has the same composition and structure in all organisms!

DNA is found in all organisms from the smallest bacteria to humans. DNA has the same composition and structure in all organisms! Biological Sciences Initiative HHMI DNA omponents and Structure Introduction Nucleic acids are molecules that are essential to, and characteristic of, life on Earth. There are two basic types of nucleic

More information

Electron transport chain, oxidative phosphorylation & mitochondrial transport systems. Joško Ivica

Electron transport chain, oxidative phosphorylation & mitochondrial transport systems. Joško Ivica Electron transport chain, oxidative phosphorylation & mitochondrial transport systems Joško Ivica Electron transport chain & oxidative phosphorylation collects e - & -H Oxidation of foodstuffs oxidizes

More information

3. In what part of the chloroplast do the light-dependent reactions of photosynthesis take place? Chloroplast. Name Class Date

3. In what part of the chloroplast do the light-dependent reactions of photosynthesis take place? Chloroplast. Name Class Date The Chloroplast In plants, photosynthesis takes place in chloroplasts. Inside chloroplasts are saclike membranes called thylakoids. These thylakoids are arranged in stacks. A stack of thylakoids is called

More information

APh/BE161: Physical Biology of the Cell Winter 2009 Recap on Photosynthesis Rob Phillips

APh/BE161: Physical Biology of the Cell Winter 2009 Recap on Photosynthesis Rob Phillips APh/BE161: Physical Biology of the Cell Winter 2009 Recap on Photosynthesis Rob Phillips Big picture: why are we doing this? A) photosynthesis will explain shortly, b) more generally, interaction of light

More information

Name Class Date. Figure 8-1

Name Class Date. Figure 8-1 Chapter 8 Photosynthesis Chapter Test A Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following is an autotroph? a. mushroom

More information

Name Date Period PHOTOSYNTHESIS HW REVIEW ENERGY AND LIFE

Name Date Period PHOTOSYNTHESIS HW REVIEW ENERGY AND LIFE 1 Name Date Period PHOTOSYNTHESIS HW REVIEW ENERGY AND LIFE MULTIPLE CHOICE: CIRCLE ALL THE ANSWERS THAT ARE TRUE. THERE MAY BE MORE THAN ONE CORRECT ANSWER! 1. Which molecule stores more than 90 times

More information

Replication Study Guide

Replication Study Guide Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have

More information

Chapter 5: The Structure and Function of Large Biological Molecules

Chapter 5: The Structure and Function of Large Biological Molecules Name Period Concept 5.1 Macromolecules are polymers, built from monomers 1. The large molecules of all living things fall into just four main classes. Name them. 2. Circle the three classes that are called

More information

Name Date Class. energy phosphate adenine charged ATP chemical bonds work ribose

Name Date Class. energy phosphate adenine charged ATP chemical bonds work ribose Energy in a Cell Reinforcement and Study Guide Section.1 The Need for Energy In your textbook, read about cell energy. Use each of the terms below just once to complete the passage. energy phosphate adenine

More information

NAME. EXAM IV I. / 60 December 7, 1998 Biochemistry I II. / 15 BI/CH421, BI601, BI/CH621 III. / 13 IV. / 12. V. / 10(grads) TOTAL /100 or 110

NAME. EXAM IV I. / 60 December 7, 1998 Biochemistry I II. / 15 BI/CH421, BI601, BI/CH621 III. / 13 IV. / 12. V. / 10(grads) TOTAL /100 or 110 EXAM IV I. / 60 December 7, 1998 Biochemistry I II. / 15 BI/CH421, BI601, BI/CH621 III. / 13 IV. / 12 V. / 10(grads) TOTAL /100 or 110 I. MULTIPLE CHOICE. (60 points; first 14 are 3 pts the last 9 are

More information

Chapter 5. The Structure and Function of Macromolecule s

Chapter 5. The Structure and Function of Macromolecule s Chapter 5 The Structure and Function of Macromolecule s Most Macromolecules are polymers: Polymer: (poly: many; mer: part) Large molecules consisting of many identical or similar subunits connected together.

More information

The Molecules of Cells

The Molecules of Cells The Molecules of Cells I. Introduction A. Most of the world s population cannot digest milk-based foods. 1. These people are lactose intolerant because they lack the enzyme lactase. 2. This illustrates

More information

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed

More information

A B C D. Name Class Date

A B C D. Name Class Date Chapter 8 Photosynthesis Chapter Test A Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following is an autotroph? a. mushroom

More information