!!!!!!!!!!!!!!!!!!!!!!!!!!
|
|
|
- Jonas Palmer
- 10 years ago
- Views:
Transcription
1
2
3
4 Figure S7 cdl-1 3'UTR gld-1 binding site (4..10) let-7 binding site ( )
5 Figure Legends Figure S1. gld-1 genetically interacts with nhl-2 and vig-1 during germline development. (A) nhl-2(ok818) enhances sterility in gld-1(op236) animals. Synchronised animals were grown to adult stage and scored for the presence of stacked oocytes in at least one germ line in the indicated genetic backgrounds (error bars=95%c.i). (B) A representative picture of gld-1(op236); nhl-2(ok818) double mutant with stacked oocytes highlighted by the yellow line. The arrowhead indicates the spermatheca, which appears to be devoid of sperm. (C) Germline defects in gld-1(op236); vig-1(ok2536). DIC images of germlines reveal oocytes (indicated by yellow lines) in gld-1(op236) and vig-1(ok2536) mutants. gld-1(op236); vig-1(ok2536) double mutants are devoid of intact oocytes 36 h past L4 stage. (D) Egg laying rates in gld-1(op236); vig-1(ok2536). Adult animals 24 h past L4 stage were placed on agar patches and allowed to lay eggs for 12 h in three 4-h intervals indicated as 4 h, 8 h and 12 h. Experiments were done in duplicate and five worms were included in each replicate. (E) Survival rates of gld-1(op236); vig-1(ok2536) embryos. Percentage survival indicates the number of eggs that hatched over the total number of eggs laid in the intervals described in (D) (error bars=s.d.) Figure S2. gld-1 doesn t affect let-7 mirna processing. Northern blot for let-7 mirna in different genetic backgrounds show no effect of gld-1 on the mature mirna levels. U6 snrna is used as a control small RNA. Note the low let-7 mirna levels in let-7(mg279) as expected [1]. Figure S3. Somatic expression of a transcriptional gld-1 reporter. DIC images (left panels), fluorescent images (middle panels) and merged images (right panels) of worms
6 expressing pgld-1::mcherry-his::gld-1_3ʹutr (gtex2041). Cells expressing the transgene are indicated by white arrows in the middle panels. Figure S4. Somatic expression of a rescuing operon transgene. Fluorescent images (left) and DIC images (right) of animals expressing the single copy insertion of the transgene [gld-1p::gld-1::gld-1 3ʹ::operon linker::gfp::h2b::tbb-2 3ʹUTR] in gld-1(q485) null mutants. GFP expression is seen in cells around the head region (top panel and middle panel) similar to the transcriptional GLD-1 reporter used in Figure S3. GFP expression is evident in all cells during embryonic development (bottom panel). Figure S5. Changes in GFP levels in let-7 sponge strains. (A) Western blot of GFP levels in let-7 sponge and let-7(mg279); let-7 sponge worms. GFP levels are higher in let-7(mg279) worms. α-tubulin is used as a control. (B) Fold change in GFP levels detected by SILAC in let-7(mg279); let-7 sponge and gld-1(op236); let-7(mg279); let-7 sponge worms compared to the let-7 sponge. let-7(mg279) results in 1.44 fold increase in GFP that is under the control of let-7 target lin-41 3ʹUTR (error bars=s.d). Figure S6. Full list of protein interactors identified in GLD-1 immunoprecipitations. Highlighted in red are proteins that are linked to RNA regulation and / or mirna pathway. Highlighted in blue are ribosomal related proteins. Yellow rows indicate proteins detected in both anti-gld-1 Ab IP in wild type animals and in anti-gfp IP in GFP expressing animals. White rows are proteins detected either in anti-gld-1 Ab IP in wild type animals or in anti-gfp IP in GFP expressing animals but not in both. For every protein, number of peptides detected in each IP together with peptides detected in control IPs (bc for background) are indicated. Total number of peptides detected and total number of background peptides are indicated in a separate column.
7 Figure S7. cdl-1 3ʹUTR with GLD-1 and let-7 binding sites. cdl-1 3ʹUTR contains a single GLD-1 binding site [2] and a let-7 binding site (mirwip score 5.9, [3]). Movie S1. Movie depicting a lethargic gld-1(op236); let-7(mg279) worm Table S1. Full list of proteins detected in SILAC experiments proteins that passed our significance criteria described in materials and methods. Wormbase gene IDs (column A), log2 B/A ratios (column B), standard error of log2 B/A ratios (column C), B/A total peptides (column D), log2 C/A ratios (column E), C/A standard error (column F), C/A total peptides (column G), C/B fold change (column H), predicted as let-7 target in mirwip database (column I), detected as GLD-1 target (column J). Where proteins are detected in two SILAC experiments standard errors are calculated. Standard errors of 0 indicate the proteins detected in one experiment only. * let-7 targets are obtained from the mirwip database [3], and GLD-1 targets are obtained from [2,4]. References 1. Reinhart BJ, Slack FJ, Basson M, Pasquinelli AE, Bettinger JC, et al. (2000) The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature 403: doi: / Wright JE, Gaidatzis D, Senften M, Farley BM, Westhof E, et al. (2011) A quantitative RNA code for mrna target selection by the germline fate determinant GLD-1. EMBO J 30: doi: /emboj Hammell M, Long D, Zhang L, Lee A, Carmack CS, et al. (2008) mirwip: microrna target prediction based on microrna-containing ribonucleoprotein-enriched transcripts. Nat Meth 5: doi: / nmeth Jungkamp A-C, Stoeckius M, Mecenas D, Grün D, Mastrobuoni G, et al. (2011) In Vivo and Transcriptome wide Identification of RNA Binding Protein Target Sites. Mol Cell 44: doi: /j.molcel
SUPPLEMENTARY DATA 1
SUPPLEMENTARY DATA 1 Supplementary Figure S1. Overexpression of untagged Ago2 inhibits the nuclear transport of the dotted foci of GFP-signal of myc-gfp-tnrc6a-nes-mut. (A C) HeLa cells expressing myc-gfp-tnrc6a-nes-mut
Trasposable elements: P elements
Trasposable elements: P elements In 1938 Marcus Rhodes provided the first genetic description of an unstable mutation, an allele of a gene required for the production of pigment in maize. This instability
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
The world of non-coding RNA. Espen Enerly
The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often
The Making of the Fittest: Evolving Switches, Evolving Bodies
OVERVIEW MODELING THE REGULATORY SWITCHES OF THE PITX1 GENE IN STICKLEBACK FISH This hands-on activity supports the short film, The Making of the Fittest:, and aims to help students understand eukaryotic
AP BIOLOGY 2010 SCORING GUIDELINES (Form B)
AP BIOLOGY 2010 SCORING GUIDELINES (Form B) Question 2 Certain human genetic conditions, such as sickle cell anemia, result from single base-pair mutations in DNA. (a) Explain how a single base-pair mutation
Micro RNAs: potentielle Biomarker für das. Blutspenderscreening
Micro RNAs: potentielle Biomarker für das Blutspenderscreening micrornas - Background Types of RNA -Coding: messenger RNA (mrna) -Non-coding (examples): Ribosomal RNA (rrna) Transfer RNA (trna) Small nuclear
DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
Analysis of gene expression data. Ulf Leser and Philippe Thomas
Analysis of gene expression data Ulf Leser and Philippe Thomas This Lecture Protein synthesis Microarray Idea Technologies Applications Problems Quality control Normalization Analysis next week! Ulf Leser:
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
germ layers in a vertebrate
germ layers and animal evolution ecdysozoa (e.g., nematodes, flies) lophotrochozoa deuterostomes diploblasts sponges choanoflagellates mesoderm ectoderm + endoderm multicellularity germ layers in a vertebrate
How To Understand How Gene Expression Is Regulated
What makes cells different from each other? How do cells respond to information from environment? Regulation of: - Transcription - prokaryotes - eukaryotes - mrna splicing - mrna localisation and translation
Plant Growth & Development. Growth Stages. Differences in the Developmental Mechanisms of Plants and Animals. Development
Plant Growth & Development Plant body is unable to move. To survive and grow, plants must be able to alter its growth, development and physiology. Plants are able to produce complex, yet variable forms
Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation
OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation -Optimal strategies to a successful mirna research project Optimal strategies to a successful mirna research
Mitotic Membrane Turnover Coordinates Differential Induction of the Heart Progenitor Lineage
Developmental Cell Supplemental Information Mitotic Membrane Turnover Coordinates Differential Induction of the Heart Progenitor Lineage Christina D. Cota and Brad Davidson Supplemental Figures S1-S7 S1.
Functional RNAs; RNA catalysts, mirna,
Functional RNAs; RNA catalysts, mirna, srna, RNAi... RNAs have many functions rrna (ribosomal RNA) trna (transfer RNA) mrna (Messenger RNA) snrna (including snorna) ) (Small nuclear RNA- splicing) Other
Von Mäusen und Menschen E - 1
Von Mäusen und Menschen E - 1 Mus musculus: Genetic Portrait of the House Mouse E - 3 Outline Mouse genome Mouse life cycle Transgenic protocols Addition of genes by nuclear injection Removal of genes
Name: Date: Period: DNA Unit: DNA Webquest
Name: Date: Period: DNA Unit: DNA Webquest Part 1 History, DNA Structure, DNA Replication DNA History http://www.dnaftb.org/dnaftb/1/concept/index.html Read the text and answer the following questions.
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
Supplementary Figure 1 Characterization of 5xFAD derived hippocampal cultures. A-B) Average total numbers of cells per hippocampus as well as average
Supplementary Figure 1 Characterization of 5xFAD derived hippocampal cultures. A-B) Average total numbers of cells per hippocampus as well as average total numbers of cells per field of view were similar
RNA & Protein Synthesis
RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis
Protein Expression. A Practical Approach J. HIGGIN S
Protein Expression A Practical Approach S. J. HIGGIN S B. D. HAMES List of contributors Abbreviations xv Xvi i 1. Protein expression in mammalian cell s Marlies Otter-Nilsson and Tommy Nilsso n 1. Introduction
1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
RNAi. Martin Latterich
RNAi Martin Latterich Contributors Abbreviations Preface i x ( xi xiii 1 Methods in RNA interference 1 Martin Latterich and Dalia Halawan i References 2 2 RNAi reagent design 3 Bernd Jagla and Nathalie
Translation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
Basic Concepts of DNA, Proteins, Genes and Genomes
Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate
Chapter 5: Organization and Expression of Immunoglobulin Genes
Chapter 5: Organization and Expression of Immunoglobulin Genes I. Genetic Model Compatible with Ig Structure A. Two models for Ab structure diversity 1. Germ-line theory: maintained that the genome contributed
Sickle cell anemia: Altered beta chain Single AA change (#6 Glu to Val) Consequence: Protein polymerizes Change in RBC shape ---> phenotypes
Protein Structure Polypeptide: Protein: Therefore: Example: Single chain of amino acids 1 or more polypeptide chains All polypeptides are proteins Some proteins contain >1 polypeptide Hemoglobin (O 2 binding
How to construct transgenic mice
How to construct transgenic mice Sandra Beer-Hammer Autumn School 2012 Bad Schandau Pharmakologie und Experimentelle Therapie (APET) Overview History Generation of embryonic stem (ES) cell lines Generation
Recombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
Control of Gene Expression
Home Gene Regulation Is Necessary? Control of Gene Expression By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring
Human Genome and Human Genome Project. Louxin Zhang
Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular
Online EFFECTIVE AS OF JANUARY 2013
2013 A and C Session Start Dates (A-B Quarter Sequence*) 2013 B and D Session Start Dates (B-A Quarter Sequence*) Quarter 5 2012 1205A&C Begins November 5, 2012 1205A Ends December 9, 2012 Session Break
The Steps. 1. Transcription. 2. Transferal. 3. Translation
Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order
RNAi Shooting the Messenger!
RNAi Shooting the Messenger! Bronya Keats, Ph.D. Department of Genetics Louisiana State University Health Sciences Center New Orleans Email: [email protected] RNA interference (RNAi) A mechanism by which
Transcription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
Molecular Genetics. RNA, Transcription, & Protein Synthesis
Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and
Chapter 16 Reproductive Technology, Gene Therapy, and Stem Cells (modified)
Chapter 16 Reproductive Technology, Gene Therapy, and Stem Cells (modified) Assisted Reproductive Technologies (ART) Artificial insemination (AI) In vitro fertilization (IVF) Gamete intrafallopian transfer
A role of microrna in the regulation of telomerase? Yuan Ming Yeh, Pei Rong Huang, and Tzu Chien V. Wang
A role of microrna in the regulation of telomerase? Yuan Ming Yeh, Pei Rong Huang, and Tzu Chien V. Wang Department of Molecular and Cellular Biology, Chang Gung University, Kwei San, Tao Yuan 333, Taiwan
Bacterial Transformation and Plasmid Purification. Chapter 5: Background
Bacterial Transformation and Plasmid Purification Chapter 5: Background History of Transformation and Plasmids Bacterial methods of DNA transfer Transformation: when bacteria take up DNA from their environment
RNA Structure and folding
RNA Structure and folding Overview: The main functional biomolecules in cells are polymers DNA, RNA and proteins For RNA and Proteins, the specific sequence of the polymer dictates its final structure
Pattern Co. Monkey Trouble Wall Quilt. Size: 48" x 58"
.............................................................................................................................................. Pattern Co..........................................................................................
Genetics Test Biology I
Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.
Biotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
13.4 Gene Regulation and Expression
13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.
MDM. Metabolic Drift Mutations - Attenuation Technology
MDM Metabolic Drift Mutations - Attenuation Technology Seite 2 Origin of MDM attenuation technology Prof. Dr. Klaus Linde Pioneer in R&D of human and animal vaccines University of Leipzig Germany Origin
岑 祥 股 份 有 限 公 司 技 術 專 員 費 軫 尹 20100803
技 術 專 員 費 軫 尹 20100803 Overview of presentation Basic Biology of RNA interference Application of sirna for gene function? How to study mirna? How to deliver sirna and mirna? New prospects on RNAi research
Outline. interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work?
Outline Outline interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work? What is RNA interference? Recently discovered regulatory level. Genome immune system.
Profiling of non-coding RNA classes Gunter Meister
Profiling of non-coding RNA classes Gunter Meister RNA Biology Regensburg University Universitätsstrasse 31 93053 Regensburg Overview Classes of non-coding RNAs Profiling strategies Validation Protein-RNA
Chapter 18 Regulation of Gene Expression
Chapter 18 Regulation of Gene Expression 18.1. Gene Regulation Is Necessary By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection
Control of Gene Expression
Control of Gene Expression (Learning Objectives) Explain the role of gene expression is differentiation of function of cells which leads to the emergence of different tissues, organs, and organ systems
J. Cell Sci. 128: doi:10.1242/jcs.164566: Supplementary Material
Figure S1. Microtubule and microfilament drug treatments severely interfere with mitotic spindle morphology, length and positioning. (A) GFP-fused lamin-a/c, LAP2 or BAF1 localizes to the spindle and all
AP BIOLOGY 2009 SCORING GUIDELINES
AP BIOLOGY 2009 SCORING GUIDELINES Question 4 The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following
Complex multicellular organisms are produced by cells that switch genes on and off during development.
Home Control of Gene Expression Gene Regulation Is Necessary? By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring
Genetics 301 Sample Final Examination Spring 2003
Genetics 301 Sample Final Examination Spring 2003 50 Multiple Choice Questions-(Choose the best answer) 1. A cross between two true breeding lines one with dark blue flowers and one with bright white flowers
RNA Viruses. A Practical Approac h. Alan J. Cann
RNA Viruses A Practical Approac h Alan J. Cann List of protocols page xiii Abbreviations xvii Investigation of RNA virus genome structure 1 A j. Easton, A.C. Marriott and C.R. Pringl e 1 Introduction-the
(1-p) 2. p(1-p) From the table, frequency of DpyUnc = ¼ (p^2) = #DpyUnc = p^2 = 0.0004 ¼(1-p)^2 + ½(1-p)p + ¼(p^2) #Dpy + #DpyUnc
Advanced genetics Kornfeld problem set_key 1A (5 points) Brenner employed 2-factor and 3-factor crosses with the mutants isolated from his screen, and visually assayed for recombination events between
Biosafety considerations of new dsrna molecules
Biosafety considerations of new dsrna molecules GM-free Europe Conference 2015 May 6-8 Berlin, Germany Dr. Sarah Agapito Current GMOs Plant transformed to produce new protein A G C U G G C A A U G U C
Dicer Substrate RNAi Design
INTEGRATED DNA TECHNOLOGIES, INC. Dicer Substrate RNAi Design How to design and order 27-mer Dicer-substrate Duplex RNAs for use as RNA interference reagents The following document provides a summary of
NO CALCULATORS OR CELL PHONES ALLOWED
Biol 205 Exam 1 TEST FORM A Spring 2008 NAME Fill out both sides of the Scantron Sheet. On Side 2 be sure to indicate that you have TEST FORM A The answers to Part I should be placed on the SCANTRON SHEET.
Antibody Function & Structure
Antibody Function & Structure Specifically bind to antigens in both the recognition phase (cellular receptors) and during the effector phase (synthesis and secretion) of humoral immunity Serology: the
Genetics Lecture Notes 7.03 2005. Lectures 1 2
Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several
Gene Switches Teacher Information
STO-143 Gene Switches Teacher Information Summary Kit contains How do bacteria turn on and turn off genes? Students model the action of the lac operon that regulates the expression of genes essential for
Ms. Campbell Protein Synthesis Practice Questions Regents L.E.
Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide
PART 3.3: MicroRNA and Cancer
BIBM 2010 Tutorial: Epigenomics and Cancer PART 3.3: MicroRNA and Cancer Dec 18, 2010 Sun Kim at Indiana University Outline of Part 3.3 Background on microrna Role of microrna in cancer MicroRNA pathway
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3
DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can
Activity 7.21 Transcription factors
Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation
Introduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
Creating a Gradebook in Excel
Creating a Spreadsheet Gradebook 1 Creating a Gradebook in Excel Spreadsheets are a great tool for creating gradebooks. With a little bit of work, you can create a customized gradebook that will provide
BioBoot Camp Genetics
BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before
Gene Regulation -- The Lac Operon
Gene Regulation -- The Lac Operon Specific proteins are present in different tissues and some appear only at certain times during development. All cells of a higher organism have the full set of genes:
mirnaselect pep-mir Cloning and Expression Vector
Product Data Sheet mirnaselect pep-mir Cloning and Expression Vector CATALOG NUMBER: MIR-EXP-C STORAGE: -80ºC QUANTITY: 2 vectors; each contains 100 µl of bacterial glycerol stock Components 1. mirnaselect
How many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
From DNA to Protein
Nucleus Control center of the cell contains the genetic library encoded in the sequences of nucleotides in molecules of DNA code for the amino acid sequences of all proteins determines which specific proteins
User Manual/Hand book. qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse)
User Manual/Hand book qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse) Kit Components Cat. No. MA003...Human Whole Genome mirna qpcr Profiling Kit (-20 C) The following components are sufficient
Concluding lesson. Student manual. What kind of protein are you? (Basic)
Concluding lesson Student manual What kind of protein are you? (Basic) Part 1 The hereditary material of an organism is stored in a coded way on the DNA. This code consists of four different nucleotides:
Embryonic & and induced pluripotent Stem Cells. May 2010 Dipl. Biol. Dr. Kurt Pfannkuche
Embryonic & and induced pluripotent Stem Cells May 2010 Dipl. Biol. Dr. Kurt Pfannkuche Seite 2 What makes a stem cell? open chromatin structure plasticity! Seite 3 self-renewal Plasticity Seite 4 Culture
DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA
DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence
Modeling and Simulation of Gene Regulatory Networks
Modeling and Simulation of Gene Regulatory Networks Hidde de Jong INRIA Grenoble - Rhône-Alpes [email protected] http://ibis.inrialpes.fr INRIA Grenoble - Rhône-Alpes and IBIS IBIS: systems biology
Section 16.1 Producing DNA fragments
Section 16.1 Producing DNA fragments Recombinant DNA combined DNA of two different organisms The process of using DNA technology to make certain proteins is as follows: 1.) Isolation of the DNA fragments
Should Stem Cells Be Used To Treat Human Diseases?
SAMPLE ESSAY C Should Stem Cells Be Used To Treat Human Diseases? Stem cells can be defined as undifferentiated cells that are generated during the development of the embryo. There are two functions ascribed
Outline. MicroRNA Bioinformatics. microrna biogenesis. short non-coding RNAs not considered in this lecture. ! Introduction
Outline MicroRNA Bioinformatics Rickard Sandberg Dept. of Cell and Molecular Biology (CMB) Karolinska Institutet! Introduction! microrna target site prediction! Useful resources 2 short non-coding RNAs
Supplementary Figure 1.
Supplementary Figure 1. (A) MicroRNA 212 enhances IS from pancreatic β-cells. INS-1 832/3 β-cells were transfected with precursors for mirnas 212, 375, or negative control oligonucleotides. 48 hrs after
EXPRESSION ARREST shrna mir GENOME- WIDE LIBRARIES
C GUGAAG EXPRESSION ARREST shrna mir GENOME- WIDE LIBRARIES MicroRNA-adapted shrna (shrna mir ) for increased, specific and consistent knockdown. MicroRNA PROCESSING PATHWAY UTILIZED FOR shrna mir Developed
