Mitotic Membrane Turnover Coordinates Differential Induction of the Heart Progenitor Lineage

Size: px
Start display at page:

Download "Mitotic Membrane Turnover Coordinates Differential Induction of the Heart Progenitor Lineage"

Transcription

1 Developmental Cell Supplemental Information Mitotic Membrane Turnover Coordinates Differential Induction of the Heart Progenitor Lineage Christina D. Cota and Brad Davidson

2 Supplemental Figures S1-S7 S1. FGF signaling is necessary for unequal cell division but is not required for polarized FGFR trafficking. Related to Figure 1. (A) Diagram of Fox>RFP induction assay as described in Materials & Methods. (B-C) Representative micrographs showing heart progenitor induction (FoxF>RFP, arrowheads) in control (B) and Mesp>FGFR:Venus transgenic embryos (C). Arrows indicate un-induced cardiac founder lineage cells (Mesp>GFP). Targeted expression of FGFR>Venus had no discernable impact on induction (5 trials, n>19/trial, P=0.805 (n.s.). (D-F) Representative micrographs of staged Mesp>FGFRDN:Venus founder cells, stained as indicated. Dashed lines in lateral sections (DE) indicate founder cell membranes (red) or epidermal border (white, Epi). Membrane associated FGFR:Venus foci (arrows) and intracellular vesicles (arrowheads) in mitotic founder cells. Solid lines in lateral projection (F) indicate dorsally (orange) and ventrally (white) positioned founder cell daughters. (G) Box-and-whisker plot of dorsal/ventral volume ratios derived from founder cell daughters (2 trials, n>12, GFP Control mean = 2.35±0.295 s.e.m, FGFRDN:Venus mean = 1.47±0.359 s.e.m, *P= ). HP= heart progenitor, ATM= anterior tail muscle cell. Error bars represent the s.e.m. Scale bars are indicated in µm. Embryos are oriented anterior to the left.

3 S2. Selective rescue of heart progenitor induction is mediated by Intβ2 distal NPxF motif. Related to Figure 3. (A-F ) Representative micrographs showing single channel and merged images representative of heart progenitor induction (FoxF>RFP, arrowheads) in embryos co-transfected as indicated. Arrows indicate un-induced cardiac founder lineage cells (Mesp>GFP). Scale bars are indicated in µm. Embryos are oriented anterior to the left.

4 S3. Adhesion-dependent retention of Caveolin:GFP and Caveolin-dependent retention of FGFR:Venus in mitotic founder cells. Related to Figure 4. (A-D ) Representative micrographs showing heart progenitor induction (FoxF>RFP, arrowheads) in embryos cotransfected as indicated. Arrows indicate un-induced cardiac founder lineage cells (Mesp>GFP). (E-G) Lateral sections and graph (C-G) depicting comparative analysis of Caveolin:GFP enrichment along founder cell membranes in control (LacZ, E) and RapS17N (F) transgenic founder cells. Ventral/Dorsal (V/D) Ratio for cell cortex is shown. (VInt/DInt=2.62±0.10 for Caveolin:GFP) For calculation of Ventral/Dorsal (V/D) Ratios see Supplemental Materials & Methods. Error bars represent the s.e.m in (G). *P=0.040 for LacZ versus RapS17N. Significance was determined using two-tailed unpaired t-test. (H-K ) Lateral sections of FGFR:Venus and Caveolin:RFP distribution in pre-mitotic (H, J ) and mitotic (I, K ) founder cells transfected with either Caveolin:RFP or CaveolinP189L:RFP as indicated to the left. FGFR:Venus and Caveolin:RFP foci along the epidermal boundary indicated by arrows in H-J. Dashed lines (red) outline transgenic founder cells. D=dorsal, V=ventral, Epi=ventral epidermis (dashed line, white). Scale bars are indicated in µm. Embryos are oriented anterior to the left.

5 S4. Caveolin is required for heart progenitor induction. Related to Figure 5. (A-B ) Lateral sections and corresponding diagrams of FGFR:Venus distribution in pre-mitotic transgenic founder cells co-transfected as indicated. Dashed lines (red) outline founder cell membranes. Epi=ventral epidermis (dashed line, white). (C-F' ) Single channel and merged images showing representative heart progenitor induction phenotypes (FoxF>RFP, arrowheads) in embryos co-transfected as indicated. Arrows indicate un-induced cardiac founder lineage cells (Mesp>GFP). Scale bars are indicated in µm. Embryos are oriented anterior to the left.

6 S5. Caveolin-mediated rescue of heart progenitor induction in RapS17N transgenic embryos. Related to Figure 6. (A-C ) Single channel and merged images showing representative heart progenitor induction phenotypes (FoxF>RFP, arrowheads) in embryos co-transfected as indicated. Arrows indicate un-induced cardiac founder lineage cells (Mesp>GFP). Scale bars are indicated in µm. Embryos are oriented anterior to the left.

7 S6. Proposed model for anchorage dependent asymmetric cell fate determination. Related to Figure 7. (A) Diagrams illustrating how anchored mitosis may bias the turnover and redistribution of adherent membrane compartments (in red) to promote asymmetric fate specification. (A ) Prior to cytokinesis, a decreased rate of endocytic recycling drives a reduction in cell surface area and volume associated with mitotic rounding (Boucrot and Kirchhausen, 2007). (A ) In cells that remain anchored during rounding, persistent adhesion may maintain premitotic recycling rates or suppress internalization leading to asymmetric enrichment of adherent membrane compartments. (A ) Upon entry into cytokinesis, internalized vesicles enriched with Caveolin and associated proteins are re-distributed (Boucrot et al., 2011). Recycling pathways re-distribute Integrin receptors to the cytokinetic ring (Pellinen et al., 2008) establishing a central domain of adherent membrane where Caveolin may also be retained (Boucrot and Kirchhausen, 2007). (A ) Persistent, asymmetric adhesion during anchored division may bias the re-distribution of Caveolin and associated integral membrane proteins, including receptors.

8 Supplemental Tables S1-S2 Table S1. Caveolin CRISPR primers Related to Figure 5. Name grna(20-mer) a PAM CavA.39gRNA ACAACACGAAGCTGCAACCC CGG CavA.39gRNAmm1 ACAACcCGAAGCTGCAACCC CGG CavA.39gRNAmm2 ACAACACGAAGCTGCcACCC CGG CavA.219gRNA GGACAATGTGGAACTTGATT CGG CavA.219gRNAmm1 GGACAcTGTGGAACTTGATT CGG CavA.219gRNAmm2 GGACAATGTGGcACTTGATT CGG a For inverse PCR cloning: forward primers: 5 -(grna)tttaagagctatgctggaaacagcatagc-3 ; Reverse primer: 5 - TGAGACCCTCTCTCGGTCTCTATCTATACCA-3 Table S2. Primers Related to Figures 3 & 5. Name Primer sequence (5-3 ) Intβ1 Y694F forward TCTACCTTTAAAAATCCAATGTTTTCTGGTGGGAAAACTGCTGGA Intβ1 Y694F reverse TCCAGCAGTTTTCCCACCAGAAAACATTGGATTTTTAAAGGTAG A Intβ2 F801Y forward ACGAGGTTCGAAAACCCAACCTACCACGGAACGTAGACATCACG C Intβ2 F801Y reverse GCGTGATGTCTACGTTCCGTGGTAGGTTGGGTTTTCGAACCTCGT Caveolin(CavA) forward ACTGCGGCCGCAATGGCAGAAAACGGAGAA Caveolin(CavA) reverse ACTGGATCCTGCGCGTCTCTCCTCAGTGACA Caveolin P189L forward CATTTGGTGGATCATGCTATGTATTAGATGCCTCG Caveolin P189L reverse CGAGGCATCTAATACATAGCATGATCCACCAAATG Caveolin exon1 forward TGGCAGAAAACGGAGAACAG Caveolin exon1 reverse GGCATGATCCACCAAATGC

9 Supplemental Methods Equatorial cell volume measurements. For measurements of equatorial cell volume, confocal stacks of postmitotic cardiac founder lineage cells were analyzed using ImageJ. Equatorial cell volumes were approximated as rectangular cell volumes. Consistent positioning for cell measurements was achieved by identifying the section within a stack where the nuclear diameter was the largest. To avoid concerns about changes in division orientation, equatorial cell volume ratios were calculated as the ratio of the larger two cardiac founder lineage cells in a cluster versus the smaller two cells. FGFR:Venus measurements. For measurements of ventral/dorsal staining ratios, 1uM confocal stacks were analyzed using ImageJ. Only ventral views were analyzed. For each founder cell analyzed a lateral optical section was obtained. Consistent positioning for measurements was defined by finding the center of the DRAQ5-stained chromatin with the founder cell being analyzed. For exterior cell volume measurements, a ROI was set at the perimeter of each founder cell. Interior cell volume measurements were determined by setting a second ROI within the exterior cell ROI. ROIs were positioned such that subtraction of measurements obtained for the interior ROI from the exterior ROI represents values for a 2.5µm region of the founder cell cortex. Ventral and dorsal regions for each founder cell were set in relation to the axis of cell division (red rectangle; Fig. 1C -C ). Generation and use of the ROI and background subtraction tools achieved consistent outlining and detection of GFP-stained regions. The corrected total fluorescence (CTCF) was calculated as integrated density (area of selected cell mean fluorescence of background reading) and determined for the dorsal and ventral, interior and exterior founder cell volumes. To approximate the plasma membrane-associated fluorescence from these measurements for both the dorsal and ventral regions of each founder cell; plasma membrane-associated fluorescence was defined by exclusion such that for each dorsal and ventral region, the interior CTCF was subtracted from the exterior CTCF. From these values ratios were calculated comparing the ventral plasma membrane-associated fluorescence to the dorsal plasma membrane-associated fluorescence (V/D for cell cortex) or comparing the ventral intracellular fluorescence to the dorsal intracellular fluorescence (V Int /D Int for cell cortex). For measurements of the percent of FGFR-associated membrane (Fig. 2H) a lateral optical section was obtained each founder cell analyzed. In each section the circumference of the cell as well as the distance along that circumference associated with FGFR staining was measured. Results are expressed as a percentage equal to the distance along that circumference associated with FGFR staining/ the circumference of the cell. We also attempted to directly examine FGF receptor distribution using an Ciona FGFR antibody. FGFR mabs were prepared via custom antibody services (Abmart). Specificity was determined by western blot analysis of protein lysates prepared from Stage 14 C.intestinalis embryos. Antibodies obtained from immunization with either NGSKYDPVSK or PLLNPQPDAN epitopes detected a single band consistent with Ci-FGFR (predicted molecular weight: 76kD). Specificity was confirmed by colocalization of anti- FGFR signal and Venus fluorescence in Mesp>FGFR:Venus embryos. However, our FGFR antibody was not sufficiently sensitive to monitor in vivo localization (data not shown).

10 Statistical analysis. In all graphs, error bars represent standard error of mean (SEM). Significance was determined using Student s t-tests with two-tailed distributions in Microsoft Excel. Data expressed as a percentage or ratio was transformed prior to statistical analysis.

11 Supplemental References Boucrot, E., and Kirchhausen, T. (2007). Endosomal recycling controls plasma membrane area during mitosis. Proceedings of the National Academy of Sciences of the United States of America 104, Boucrot, E., Howes, M.T., Kirchhausen, T., and Parton, R.G. (2011). Redistribution of caveolae during mitosis. Journal of Cell Science 124, Pellinen, T., Tuomi, S., Arjonen, A., Wolf, M., Edgren, H., Meyer, H., Grosse, R., Kitzing, T., Rantala, J.K., and Kallioniemi, O. (2008). Integrin Trafficking Regulated by Rab21 Is Necessary for Cytokinesis. Developmental Cell 15,

Supplemental Information. McBrayer et al. Supplemental Data

Supplemental Information. McBrayer et al. Supplemental Data 1 Supplemental Information McBrayer et al. Supplemental Data 2 Figure S1. Glucose consumption rates of MM cell lines exceed that of normal PBMC. (A) Normal PBMC isolated from three healthy donors were

More information

SUPPLEMENTARY DATA 1

SUPPLEMENTARY DATA 1 SUPPLEMENTARY DATA 1 Supplementary Figure S1. Overexpression of untagged Ago2 inhibits the nuclear transport of the dotted foci of GFP-signal of myc-gfp-tnrc6a-nes-mut. (A C) HeLa cells expressing myc-gfp-tnrc6a-nes-mut

More information

Interphase (A) and mitotic (B) D16 cells were plated on concanavalin A and processed for

Interphase (A) and mitotic (B) D16 cells were plated on concanavalin A and processed for E07-10-1069 Rogers SUPPLEMENTARY DATA Supplemental Figure 1. Interphase day-7 control and γ-tubulin23c RNAi-treated S2 cells stained for MTs (green), γ-tubulin (red), and DNA (blue). Scale, 5μm. Supplemental

More information

J. Cell Sci. 128: doi:10.1242/jcs.164566: Supplementary Material

J. Cell Sci. 128: doi:10.1242/jcs.164566: Supplementary Material Figure S1. Microtubule and microfilament drug treatments severely interfere with mitotic spindle morphology, length and positioning. (A) GFP-fused lamin-a/c, LAP2 or BAF1 localizes to the spindle and all

More information

Chapter 7. Physical interaction between Jamb and Jamc is necessary for myoblast fusion. Summary

Chapter 7. Physical interaction between Jamb and Jamc is necessary for myoblast fusion. Summary Chapter 7 Physical interaction between Jamb and Jamc is necessary for myoblast fusion Summary In this chapter I describe a series of transplant experiments designed to further elucidate the function and

More information

Supplementary Figure 1 Characterization of 5xFAD derived hippocampal cultures. A-B) Average total numbers of cells per hippocampus as well as average

Supplementary Figure 1 Characterization of 5xFAD derived hippocampal cultures. A-B) Average total numbers of cells per hippocampus as well as average Supplementary Figure 1 Characterization of 5xFAD derived hippocampal cultures. A-B) Average total numbers of cells per hippocampus as well as average total numbers of cells per field of view were similar

More information

!!!!!!!!!!!!!!!!!!!!!!!!!!

!!!!!!!!!!!!!!!!!!!!!!!!!! Figure S7 cdl-1 3'UTR gld-1 binding site (4..10) let-7 binding site (326..346) Figure Legends Figure S1. gld-1 genetically interacts with nhl-2 and vig-1 during germline development. (A) nhl-2(ok818) enhances

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/339/ra80/dc1 Supplementary Materials for Manipulation of receptor oligomerization as a strategy to inhibit signaling by TNF superfamily members Julia T. Warren,

More information

Cell Biology Questions and Learning Objectives

Cell Biology Questions and Learning Objectives Cell Biology Questions and Learning Objectives (with hypothetical learning materials that might populate the objective) The topics and central questions listed here are typical for an introductory undergraduate

More information

FGF-1 as Cosmetic Supplement

FGF-1 as Cosmetic Supplement FGF-1 as Cosmetic Supplement Ing-Ming Chiu, Ph.D. Professor, Internal Medicine and Molecular and Cellular Biochemistry The Ohio State University Columbus, Ohio, U.S.A. GENTEON USA Fibroblast Growth Factor

More information

How to construct transgenic mice

How to construct transgenic mice How to construct transgenic mice Sandra Beer-Hammer Autumn School 2010 Bad Schandau Methods additional genetic information transgenic mouse line gene inactivation gene-deficient knockout mouse line Jak2

More information

Synaptophysin Regulates the Kinetics of Synaptic Vesicle Endocytosis in Central Neurons

Synaptophysin Regulates the Kinetics of Synaptic Vesicle Endocytosis in Central Neurons Neuron, Volume 70 Supplemental Information Synaptophysin Regulates the Kinetics of Synaptic Vesicle Endocytosis in Central Neurons Sung E. Kwon and Edwin R. Chapman Supplemental Figure Legends Figure

More information

The Cell: Organelle Diagrams

The Cell: Organelle Diagrams The Cell: Organelle Diagrams Fig 7-4. A prokaryotic cell. Lacking a true nucleus and the other membrane-enclosed organelles of the eukaryotic cell, the prokaryotic cell is much simpler in structure. Only

More information

2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line

2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line i 1 INTRODUCTION 1.1 Human Hepatitis B virus (HBV) 1 1.1.1 Pathogenesis of Hepatitis B 1 1.1.2 Genome organization of HBV 3 1.1.3 Structure of HBV virion 5 1.1.4 HBV life cycle 5 1.1.5 Experimental models

More information

The immune response Antibodies Antigens Epitopes (antigenic determinants) the part of a protein antigen recognized by an antibody Haptens small

The immune response Antibodies Antigens Epitopes (antigenic determinants) the part of a protein antigen recognized by an antibody Haptens small The immune response Antibodies Antigens Epitopes (antigenic determinants) the part of a protein antigen recognized by an antibody Haptens small molecules that can elicit an immune response when linked

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. (A) MicroRNA 212 enhances IS from pancreatic β-cells. INS-1 832/3 β-cells were transfected with precursors for mirnas 212, 375, or negative control oligonucleotides. 48 hrs after

More information

CD3/TCR stimulation and surface detection Determination of specificity of intracellular detection of IL-7Rα by flow cytometry

CD3/TCR stimulation and surface detection Determination of specificity of intracellular detection of IL-7Rα by flow cytometry CD3/TCR stimulation and surface detection Stimulation of HPB-ALL cells with the anti-cd3 monoclonal antibody OKT3 was performed as described 3. In brief, antibody-coated plates were prepared by incubating

More information

Investigating the role of a Cryptosporidium parum apyrase in infection

Investigating the role of a Cryptosporidium parum apyrase in infection Investigating the role of a Cryptosporidium parum apyrase in infection David Riccardi and Patricio Manque Abstract This project attempted to characterize the function of a Cryptosporidium parvum apyrase

More information

Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes

Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes Outlines Brief introduction of OriGene s mission on gene-centric product solution. TrueMAB monoclonal antibody

More information

Innate Immunity. Insects rely solely on an innate immune system for defense against infection

Innate Immunity. Insects rely solely on an innate immune system for defense against infection Innate Immunity Insects rely solely on an innate immune system for defense against infection The importance of mammalian innate immunity has only recently become appreciated The innate immune response

More information

GeneCopoeia Genome Editing Tools for Safe Harbor Integration in. Mice and Humans. Ed Davis, Liuqing Qian, Ruiqing li, Junsheng Zhou, and Jinkuo Zhang

GeneCopoeia Genome Editing Tools for Safe Harbor Integration in. Mice and Humans. Ed Davis, Liuqing Qian, Ruiqing li, Junsheng Zhou, and Jinkuo Zhang G e n e C o p o eia TM Expressway to Discovery APPLICATION NOTE Introduction GeneCopoeia Genome Editing Tools for Safe Harbor Integration in Mice and Humans Ed Davis, Liuqing Qian, Ruiqing li, Junsheng

More information

Understanding the immune response to bacterial infections

Understanding the immune response to bacterial infections Understanding the immune response to bacterial infections A Ph.D. (SCIENCE) DISSERTATION SUBMITTED TO JADAVPUR UNIVERSITY SUSHIL KUMAR PATHAK DEPARTMENT OF CHEMISTRY BOSE INSTITUTE 2008 CONTENTS Page SUMMARY

More information

BIOLOGICAL MEMBRANES: FUNCTIONS, STRUCTURES & TRANSPORT

BIOLOGICAL MEMBRANES: FUNCTIONS, STRUCTURES & TRANSPORT BIOLOGICAL MEMBRANES: FUNCTIONS, STRUCTURES & TRANSPORT UNIVERSITY OF PNG SCHOOL OF MEDICINE AND HEALTH SCIENCES DISCIPLINE OF BIOCHEMISTRY AND MOLECULAR BIOLOGY BMLS II / B Pharm II / BDS II VJ Temple

More information

The Lipid Bilayer Is a Two-Dimensional Fluid

The Lipid Bilayer Is a Two-Dimensional Fluid The Lipid Bilayer Is a Two-Dimensional Fluid The aqueous environment inside and outside a cell prevents membrane lipids from escaping from bilayer, but nothing stops these molecules from moving about and

More information

Antigenic variation in Plasmodium falciparum : Erythrocyte invasion and immune escape mechanisms

Antigenic variation in Plasmodium falciparum : Erythrocyte invasion and immune escape mechanisms Antigenic variation in Plasmodium falciparum : Erythrocyte invasion and immune escape mechanisms Introduction Why does immunity to malaria take so long to develop? The parasite s survival depends on its

More information

(From the Department of Anatomy, Harvard Medical School, Boston)

(From the Department of Anatomy, Harvard Medical School, Boston) THE FINE STRUCTURE OF THE ELECTRIC ORGAN OF THE ELECTRIC EEL AND TORPEDO RAY* PRELIMINARY COMMUNICATION BY JOHN H. LUFT, M.D. (From the Department of Anatomy, Harvard Medical School, Boston) PLATE 76 Electric

More information

Unit 2: Cells, Membranes and Signaling CELL MEMBRANE. Chapter 5 Hillis Textbook

Unit 2: Cells, Membranes and Signaling CELL MEMBRANE. Chapter 5 Hillis Textbook Unit 2: Cells, Membranes and Signaling CELL MEMBRANE Chapter 5 Hillis Textbook HOW DOES THE LAB RELATE TO THE NEXT CHAPTER? SURFACE AREA: the entire outer covering of a cell that enables materials pass.

More information

Recognition of T cell epitopes (Abbas Chapter 6)

Recognition of T cell epitopes (Abbas Chapter 6) Recognition of T cell epitopes (Abbas Chapter 6) Functions of different APCs (Abbas Chapter 6)!!! Directon Routes of antigen entry (Abbas Chapter 6) Flow of Information Barrier APCs LNs Sequence of Events

More information

pcas-guide System Validation in Genome Editing

pcas-guide System Validation in Genome Editing pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible

More information

Overview. Transcriptional cascades. Amazing aspects of lineage plasticity. Conventional (B2) B cell development

Overview. Transcriptional cascades. Amazing aspects of lineage plasticity. Conventional (B2) B cell development Overview B cell development Transcriptional cascades Amazing aspects of lineage plasticity Conventional (B2) B cell development What happens to an autoreactive B cell? B1 vs B2 cells Key anatomical sites

More information

Identification of rheumatoid arthritis and osteoarthritis patients by transcriptome-based rule set generation

Identification of rheumatoid arthritis and osteoarthritis patients by transcriptome-based rule set generation Identification of rheumatoid arthritis and osterthritis patients by transcriptome-based rule set generation Bering Limited Report generated on September 19, 2014 Contents 1 Dataset summary 2 1.1 Project

More information

1.1.2. thebiotutor. AS Biology OCR. Unit F211: Cells, Exchange & Transport. Module 1.2 Cell Membranes. Notes & Questions.

1.1.2. thebiotutor. AS Biology OCR. Unit F211: Cells, Exchange & Transport. Module 1.2 Cell Membranes. Notes & Questions. thebiotutor AS Biology OCR Unit F211: Cells, Exchange & Transport Module 1.2 Cell Membranes Notes & Questions Andy Todd 1 Outline the roles of membranes within cells and at the surface of cells. The main

More information

Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides

Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides Polyacrylamide gel electrophoresis (PAGE) and subsequent analyses are common tools in biochemistry and molecular biology. This Application

More information

Using Digital Photography to Supplement Learning of Biotechnology. Methods

Using Digital Photography to Supplement Learning of Biotechnology. Methods RESEARCH ON LEARNING Using Digital Photography to Supplement Learning of Biotechnology Fran n orf l u s AbstrAct The author used digital photography to supplement learning of biotechnology by students

More information

Cell Division Mitosis and the Cell Cycle

Cell Division Mitosis and the Cell Cycle Cell Division Mitosis and the Cell Cycle A Chromosome and Sister Chromatids Key Points About Chromosome Structure A chromosome consists of DNA that is wrapped around proteins (histones) and condensed Each

More information

Prism 6 Step-by-Step Example Linear Standard Curves Interpolating from a standard curve is a common way of quantifying the concentration of a sample.

Prism 6 Step-by-Step Example Linear Standard Curves Interpolating from a standard curve is a common way of quantifying the concentration of a sample. Prism 6 Step-by-Step Example Linear Standard Curves Interpolating from a standard curve is a common way of quantifying the concentration of a sample. Step 1 is to construct a standard curve that defines

More information

REGENERATIVE BIOLOGY AND MEDICINE: RESEARCH OPPORTUNITIES FOR PHYSICISTS, ENGINEERS, MATHEMATICIANS

REGENERATIVE BIOLOGY AND MEDICINE: RESEARCH OPPORTUNITIES FOR PHYSICISTS, ENGINEERS, MATHEMATICIANS REGENERATIVE BIOLOGY AND MEDICINE: RESEARCH OPPORTUNITIES FOR PHYSICISTS, ENGINEERS, MATHEMATICIANS David L. Stocum Department of Biology And Center for Regenerative Biology and Medicine Indiana University-Purdue

More information

An Overview of Cells and Cell Research

An Overview of Cells and Cell Research An Overview of Cells and Cell Research 1 An Overview of Cells and Cell Research Chapter Outline Model Species and Cell types Cell components Tools of Cell Biology Model Species E. Coli: simplest organism

More information

Principles of Flowcytometry

Principles of Flowcytometry Objectives Introduction to Cell Markers: Principles of Flowcytometry Michelle Petrasich NZIMLS Scientific Meeting August 24, 2010, Paihia What are cell markers How do we detect them Production of Monoclonal

More information

Cell Growth and Reproduction Module B, Anchor 1

Cell Growth and Reproduction Module B, Anchor 1 Cell Growth and Reproduction Module B, Anchor 1 Key Concepts: - The larger a cell becomes, the more demands the cell places on its DNA. In addition, a larger cell is less efficient in moving nutrients

More information

Key Topics What will ALL students learn? What will the most able students learn?

Key Topics What will ALL students learn? What will the most able students learn? 2013 2014 Scheme of Work Subject MATHS Year 9 Course/ Year Term 1 Key Topics What will ALL students learn? What will the most able students learn? Number Written methods of calculations Decimals Rounding

More information

The Nucleus: DNA, Chromatin And Chromosomes

The Nucleus: DNA, Chromatin And Chromosomes The Nucleus: DNA, Chromatin And Chromosomes Professor Alfred Cuschieri Department of Anatomy, University of Malta. Objectives By the end of this unit the student should be able to: 1. List the major structural

More information

Making the switch to a safer CAR-T cell therapy

Making the switch to a safer CAR-T cell therapy Making the switch to a safer CAR-T cell therapy HaemaLogiX 2015 Technical Journal Club May 24 th 2016 Christina Müller - chimeric antigen receptor = CAR - CAR T cells are generated by lentiviral transduction

More information

Prostaglandin E2 Enhances Human Cord Blood Stem. Cell Xenotransplants and Shows Long-Term Safety. in Preclinical Nonhuman Primate Transplant Models

Prostaglandin E2 Enhances Human Cord Blood Stem. Cell Xenotransplants and Shows Long-Term Safety. in Preclinical Nonhuman Primate Transplant Models Cell Stem Cell, Volume 8 Supplemental Information Prostaglandin E2 Enhances Human Cord Blood Stem Cell Xenotransplants and Shows Long-Term Safety in Preclinical Nonhuman Primate Transplant Models Wolfram

More information

Chapter 12: The Cell Cycle

Chapter 12: The Cell Cycle Name Period Chapter 12: The Cell Cycle Overview: 1. What are the three key roles of cell division? State each role, and give an example. Key Role Reproduction Growth and development Tissue removal Example

More information

Protein Expression. A Practical Approach J. HIGGIN S

Protein Expression. A Practical Approach J. HIGGIN S Protein Expression A Practical Approach S. J. HIGGIN S B. D. HAMES List of contributors Abbreviations xv Xvi i 1. Protein expression in mammalian cell s Marlies Otter-Nilsson and Tommy Nilsso n 1. Introduction

More information

Anatomy PHL 212. By Dr Tajdar Husain Khan

Anatomy PHL 212. By Dr Tajdar Husain Khan Anatomy PHL 212 By Dr Tajdar Husain Khan Overview of Anatomy Anatomy(from the Greek word anatome,"dissection") is a branch of natural science dealing with the structural organization of living things The

More information

Cellular Reproduction

Cellular Reproduction 9 Cellular Reproduction section 1 Cellular Growth Before You Read Think about the life cycle of a human. On the lines below, write some of the stages that occur in the life cycle of a human. In this section,

More information

How To Understand How Gene Expression Is Regulated

How To Understand How Gene Expression Is Regulated What makes cells different from each other? How do cells respond to information from environment? Regulation of: - Transcription - prokaryotes - eukaryotes - mrna splicing - mrna localisation and translation

More information

CAMI Education linked to CAPS: Mathematics

CAMI Education linked to CAPS: Mathematics - 1 - TOPIC 1.1 Whole numbers _CAPS curriculum TERM 1 CONTENT Mental calculations Revise: Multiplication of whole numbers to at least 12 12 Ordering and comparing whole numbers Revise prime numbers to

More information

Notch 1 -dependent regulation of cell fate in colorectal cancer

Notch 1 -dependent regulation of cell fate in colorectal cancer Notch 1 -dependent regulation of cell fate in colorectal cancer Referees: PD Dr. Tobias Dick Prof. Dr. Wilfried Roth http://d-nb.info/1057851272 CONTENTS Summary 1 Zusammenfassung 2 1 INTRODUCTION 3 1.1

More information

1. When new cells are formed through the process of mitosis, the number of chromosomes in the new cells

1. When new cells are formed through the process of mitosis, the number of chromosomes in the new cells Cell Growth and Reproduction 1. When new cells are formed through the process of mitosis, the number of chromosomes in the new cells A. is half of that of the parent cell. B. remains the same as in the

More information

If and when cancer cells stop dividing, they do so at random points, not at the normal checkpoints in the cell cycle.

If and when cancer cells stop dividing, they do so at random points, not at the normal checkpoints in the cell cycle. Cancer cells have escaped from cell cycle controls Cancer cells divide excessively and invade other tissues because they are free of the body s control mechanisms. Cancer cells do not stop dividing when

More information

Chapter 47: Animal Development

Chapter 47: Animal Development Name Period Overview 1. An organism s development is controlled by the genome of the zygote as well as by molecules from the mother that are in the cytoplasm of the egg. What are these proteins and RNAs

More information

HER2 Testing in Breast Cancer

HER2 Testing in Breast Cancer HER2 Testing in Breast Cancer GAIL H. VANCE, M.D. AGT MEETING JUNE 13, 2014 LOUISVILLE, KENTUCKY No Conflict of Interest to Report Human Epidermal Growth Factor Receptor 2-HER2 Human epidermal growth factor

More information

Modelling cell motion: From microscopic to macroscopic scale. Luigi Preziosi [email protected] calvino.polito.it/~preziosi

Modelling cell motion: From microscopic to macroscopic scale. Luigi Preziosi Luigi.preziosi@polito.it calvino.polito.it/~preziosi Modelling cell motion: From microscopic to macroscopic scale Luigi Preziosi [email protected] calvino.polito.it/~preziosi Modelling cell-ecm interaction: An opportunity to present different modelling

More information

The Somatic Cell Cycle

The Somatic Cell Cycle The Somatic Cell Cycle Maternal chromosome Diploid Zygote Diploid Zygote Paternal chromosome MITOSIS MITOSIS Maternal chromosome Diploid organism Diploid organism Paternal chromosome Int terpha ase The

More information

1 Cornea 6 Macula 2 Lens 7 Vitreous humor 3 Iris 8 Optic disc 4 Conjunctiva 9 Ciliary muscles 5 Sclera 10 Choroid

1 Cornea 6 Macula 2 Lens 7 Vitreous humor 3 Iris 8 Optic disc 4 Conjunctiva 9 Ciliary muscles 5 Sclera 10 Choroid Anatomy and Physiology Quiz 1 Sample Question Answers Use the following table to answer Questions 1 2. 1 Cornea 6 Macula 2 Lens 7 Vitreous humor 3 Iris 8 Optic disc 4 Conjunctiva 9 Ciliary muscles 5 Sclera

More information

Dendritic Cells: A Basic Review *last updated May 2003

Dendritic Cells: A Basic Review *last updated May 2003 *last updated May 2003 Prepared by: Eric Wieder, PhD MD Anderson Cancer Center Houston, TX USA What is a dendritic cell? Dendritic cells are antigen-presenting cells (APCs) which play a critical role in

More information

Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics

Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics Christopher Benner, PhD Director, Integrative Genomics and Bioinformatics Core (IGC) idash Webinar,

More information

Math 0306 Final Exam Review

Math 0306 Final Exam Review Math 006 Final Exam Review Problem Section Answers Whole Numbers 1. According to the 1990 census, the population of Nebraska is 1,8,8, the population of Nevada is 1,01,8, the population of New Hampshire

More information

TABLE OF CONTENT. Page ACKNOWLEDGEMENTS. iii ENGLISH ABSTRACT THAI ABSTRACT. vii LIST OF TABLES LIST OF FIGURES. xvi ABBREVIATIONS.

TABLE OF CONTENT. Page ACKNOWLEDGEMENTS. iii ENGLISH ABSTRACT THAI ABSTRACT. vii LIST OF TABLES LIST OF FIGURES. xvi ABBREVIATIONS. x TABLE OF CONTENT ACKNOWLEDGEMENTS ENGLISH ABSTRACT THAI ABSTRACT LIST OF TABLES LIST OF FIGURES ABBREVIATIONS iii iv vii xv xvi xviii CHAPTER I: INTRODUCTION 1.1 Statement of problems 1 1.2 Literature

More information

THE His Tag Antibody, mab, Mouse

THE His Tag Antibody, mab, Mouse THE His Tag Antibody, mab, Mouse Cat. No. A00186 Technical Manual No. TM0243 Update date 01052011 I Description.... 1 II Key Features. 2 III Storage 2 IV Applications.... 2 V Examples - ELISA..... 2 VI

More information

Activation and effector functions of HMI

Activation and effector functions of HMI Activation and effector functions of HMI Hathairat Thananchai, DPhil Department of Microbiology Faculty of Medicine Chiang Mai University 25 August 2015 ว ตถ ประสงค หล งจากช วโมงบรรยายน แล วน กศ กษาสามารถ

More information

BaculoDirect Baculovirus Expression System Free your hands with the BaculoDirect Baculovirus Expression System

BaculoDirect Baculovirus Expression System Free your hands with the BaculoDirect Baculovirus Expression System BaculoDirect Baculovirus Expression System Free your hands with the BaculoDirect Baculovirus Expression System The BaculoDirect Baculovirus Expression System gives you: Unique speed and simplicity High-throughput

More information

Selection of Cell Lines for Manufacturing Therapeutic Antibodies by Flow Cytometric Cell Sorting. Andrew Racher Lonza Biologics

Selection of Cell Lines for Manufacturing Therapeutic Antibodies by Flow Cytometric Cell Sorting. Andrew Racher Lonza Biologics Selection of Cell Lines for Manufacturing Therapeutic Antibodies by Flow Cytometric Cell Sorting Andrew Racher Lonza Biologics Structure of Talk 1. The Problem 2. Possible Solutions 3. Solution Chosen

More information

Germ cell formation / gametogenesis And Fertilisation

Germ cell formation / gametogenesis And Fertilisation Developmental Biology BY1101 P. Murphy Lecture 3 The first steps to forming a new organism Descriptive embryology I Germ cell formation / gametogenesis And Fertilisation Why bother with sex? In terms of

More information

Lecture 4 Cell Membranes & Organelles

Lecture 4 Cell Membranes & Organelles Lecture 4 Cell Membranes & Organelles Structure of Animal Cells The Phospholipid Structure Phospholipid structure Encases all living cells Its basic structure is represented by the fluidmosaic model Phospholipid

More information

CONTENT. Chapter 1 Review of Literature. List of figures. List of tables

CONTENT. Chapter 1 Review of Literature. List of figures. List of tables Abstract Abbreviations List of figures CONTENT I-VI VII-VIII IX-XII List of tables XIII Chapter 1 Review of Literature 1. Vaccination against intracellular pathogens 1-34 1.1 Role of different immune responses

More information

From DNA to Protein

From DNA to Protein Nucleus Control center of the cell contains the genetic library encoded in the sequences of nucleotides in molecules of DNA code for the amino acid sequences of all proteins determines which specific proteins

More information

High throughput screening, high content screening, primary and stem cells. new techniques now converging

High throughput screening, high content screening, primary and stem cells. new techniques now converging High throughput screening:layout 1 26/3/09 13:32 Page 25 High throughput screening, high content screening, primary and stem cells new techniques now converging Over the past decade, the use of cell-based

More information

IN Cell Investigator high-content analysis software v1.3

IN Cell Investigator high-content analysis software v1.3 GE Healthcare Data file 28-9253-79 AA IN Cell Investigator IN Cell Investigator high-content analysis software v1.3 Flexible software for automated analysis of high-content cellular images IN Cell Investigator

More information

CD22 Antigen Is Broadly Expressed on Lung Cancer Cells and Is a Target for Antibody-Based Therapy

CD22 Antigen Is Broadly Expressed on Lung Cancer Cells and Is a Target for Antibody-Based Therapy CD22 Antigen Is Broadly Expressed on Lung Cancer Cells and Is a Target for Antibody-Based Therapy Joseph M. Tuscano, Jason Kato, David Pearson, Chengyi Xiong, Laura Newell, Yunpeng Ma, David R. Gandara,

More information

hydrocortisone (5 mg/ml), EGF (10 µg/ml) and Heparin (5000 U/ml). Antibodies against the N-terminal peptide of MEK1 (MEK1-N) and against Flotillin 1

hydrocortisone (5 mg/ml), EGF (10 µg/ml) and Heparin (5000 U/ml). Antibodies against the N-terminal peptide of MEK1 (MEK1-N) and against Flotillin 1 SUPPLEMENTARY METHODS Cells HUVEC (Human Umbilical Vein Endothelial Cells) were grown in complete Medium 199 (Gibco) supplemented with glutamax, 10% foetal calf serum, BBE (9 mg/ml), hydrocortisone (5

More information

The Leading Gene Through Screen CRO

The Leading Gene Through Screen CRO The Leading Gene Through Screen CRO Molecular Biology Services Molecular Biology drives modern drug discovery. Drug screening, target validation and structural biology processes frequently require recombinant

More information

Protein Analysis. -Detection and quantification. Toby M Holmes

Protein Analysis. -Detection and quantification. Toby M Holmes Protein Analysis -Detection and quantification Toby M Holmes Clinical Research Unit UCD school of Medicine and Medical Sciences Mater Misericordiae University Hospital Dublin Protein structure General

More information

Calculation of Valu-Trac Statuses

Calculation of Valu-Trac Statuses Calculation of Intrinsic Value Yield Latest Cash Earnings (Net Income + Depreciation and Amortization) (put aside) Dividend (subtract) Provision for Depreciation (Net Assets x Inflation Rate) (subtract)

More information

Bell Baxter High School 0

Bell Baxter High School 0 Bell Bater High School Mathematics Department Fourth Level Homework Booklet Remember: Complete each homework in your jotter showing ALL working clearly Bell Bater High School 0 Evaluating Epressions and

More information

Compass Software for Peggy User Guide

Compass Software for Peggy User Guide page 1 Compass Software for Peggy User Guide Copyright 2013 ProteinSimple. All rights reserved. ProteinSimple 3040 Oakmead Village Drive Santa Clara, CA 95051 Toll-free: (888) 607-9692 Tel: (408) 510-5500

More information

Visualization methods for patent data

Visualization methods for patent data Visualization methods for patent data Treparel 2013 Dr. Anton Heijs (CTO & Founder) Delft, The Netherlands Introduction Treparel can provide advanced visualizations for patent data. This document describes

More information

Automation of Cell Staining Technical Information Bulletin

Automation of Cell Staining Technical Information Bulletin Automation of Cell Staining Technical Information Bulletin Automation of Cell Staining Using the Biomek 4000 Laboratory Automation Workstation Amy N. Yoder, Sr. Development Scientist and Li Liu, Sr. Development

More information

Show all work for credit. Attach paper as needed to keep work neat & organized.

Show all work for credit. Attach paper as needed to keep work neat & organized. Geometry Semester 1 Review Part 2 Name Show all work for credit. Attach paper as needed to keep work neat & organized. Determine the reflectional (# of lines and draw them in) and rotational symmetry (order

More information

ME 111: Engineering Drawing

ME 111: Engineering Drawing ME 111: Engineering Drawing Lecture # 14 (10/10/2011) Development of Surfaces http://www.iitg.ernet.in/arindam.dey/me111.htm http://www.iitg.ernet.in/rkbc/me111.htm http://shilloi.iitg.ernet.in/~psr/ Indian

More information

Ubiquitin-conjugated degradation of Golden 2-Like transcription factor is mediated by CUL4-DDB1-based E3 ligase complex in tomato

Ubiquitin-conjugated degradation of Golden 2-Like transcription factor is mediated by CUL4-DDB1-based E3 ligase complex in tomato New Phytologist Supporting Information Ubiquitin-conjugated degradation of Golden 2-Like transcription factor is mediated by CUL4-DDB1-based E3 ligase complex in tomato Xiaofeng Tang, Min Miao, Xiangli

More information

Introduction to flow cytometry

Introduction to flow cytometry Introduction to flow cytometry Flow cytometry is a popular laser-based technology. Discover more with our introduction to flow cytometry. Flow cytometry is now a widely used method for analyzing the expression

More information

RNAi. Martin Latterich

RNAi. Martin Latterich RNAi Martin Latterich Contributors Abbreviations Preface i x ( xi xiii 1 Methods in RNA interference 1 Martin Latterich and Dalia Halawan i References 2 2 RNAi reagent design 3 Bernd Jagla and Nathalie

More information

Fig. S1. Visualizing and manipulating peripheral MEs and SAs in zebrafish. (A) Lateral wholemount view of peripheral MEs (magenta: TgNBT:dsRed) and

Fig. S1. Visualizing and manipulating peripheral MEs and SAs in zebrafish. (A) Lateral wholemount view of peripheral MEs (magenta: TgNBT:dsRed) and Fig. S1. Visualizing and manipulating peripheral MEs and SAs in zebrafish. (A) Lateral wholemount view of peripheral MEs (magenta: TgNBT:dsRed) and SAs (yellow: Tg- 8.4neurog1:GFP) in 72 hpf zebrafish

More information

specific B cells Humoral immunity lymphocytes antibodies B cells bone marrow Cell-mediated immunity: T cells antibodies proteins

specific B cells Humoral immunity lymphocytes antibodies B cells bone marrow Cell-mediated immunity: T cells antibodies proteins Adaptive Immunity Chapter 17: Adaptive (specific) Immunity Bio 139 Dr. Amy Rogers Host defenses that are specific to a particular infectious agent Can be innate or genetic for humans as a group: most microbes

More information

BIOLOGY 205/SECTION 7 DEVELOPMENT- LILJEGREN. Third Examination April 2, 2009

BIOLOGY 205/SECTION 7 DEVELOPMENT- LILJEGREN. Third Examination April 2, 2009 BIOLOGY 205/SECTION 7 DEVELOPMENT- LILJEGREN Third Examination April 2, 2009 Please put your name at the top of each page. Read each question carefully before answering- i.e. read the instructions. Be

More information

Chapter 8. Summary and Perspectives

Chapter 8. Summary and Perspectives Chapter 8 Summary and Perspectives 131 Chapter 8 Summary Overexpression of the multidrug resistance protein MRP1 confer multidrug resistance (MDR) to cancer cells. The contents of this thesis describe

More information

IncuCyte ZOOM Whole Well Imaging Overview

IncuCyte ZOOM Whole Well Imaging Overview IncuCyte ZOOM Whole Well Imaging Overview With the release of the 2013B software, IncuCyte ZOOM users will have the added ability to image the complete surface of select multi-well plates and 35 mm dishes

More information