Supplementary Figure 1.
|
|
|
- Sherilyn Burns
- 10 years ago
- Views:
Transcription
1 Supplementary Figure 1. (A) MicroRNA 212 enhances IS from pancreatic β-cells. INS-1 832/3 β-cells were transfected with precursors for mirnas 212, 375, or negative control oligonucleotides. 48 hrs after transfection, IS was measured in response to varying glucose concentrations or elevated KCl. IS into the medium is normalized to total insulin content. Data is representative of 5 independent experiments. Insulin transcript expression and protein content in INS-1 cells did not change after transfection with precursors of mirnas 132 and 212. Insulin transcript (B) and insulin protein content (C) were measured from the lysates of cells transfected with pre-mir- 132, pre-mir-212, pre-mir-375 or a Pre-miRTM negative control. Insulin content was normalized to total protein. *p < 0.05; **p < 0.01; ***p < as compared to the negative control.
2 Supplementary Figure 2. Adenovirus-GFP does not affect insulin secretion. INS-1 832/3 cells were either left untreated (NT) or transfected with Ad-GFP. 48 hrs after infection, IS was measured in response to 15 mm Glucose. IS is normalized to total insulin content, and depicted as % of fractional release. Graph is an average of n = 6 experiments.
3 Supplementary Figure 3. CACT is the most downregulated mrna in response to mirna 132 and 212 overexpression. Differential expression (DE) of mrna resulting from mirna-132 is plotted against DE resulting from mirna-212, 10hrs following introduction of mirna oligonucleotides into INS-1 832/3 β-cells (p<0.05). Larger symbols indicate greater statistical significance for DE. ~6.7 % of the depicted mrna has a seed region. Axes show the log10 of the fold-change (mirna over negative control). Negative values indicate downregulation of expression. CACT is highlighted as the most downregulated gene in response to both mirnas.
4 Supplementary Figure 4. CACT (A) mrna and (B) protein abundance is downregulated in response to sirna oligonucleotides against CACT. (A) RNA was isolated and CACT expression levels were measured using qpcr methods (described in the methods section) 48 hours post transfection with sicact oligonucleotides. *p < 0.05 as compared to the negative control. (n =4) (B) sirna-cact decreases CACT protein level. Western blot analysis was used to evaluate the effect of CACT sirna on CACT protein levels in INS-1 832/3 cells. INS-1 832/13 cells were transfected with CACT sirna or negative control (Scr-siRNA) 832/13 β-cells. Cells were harvested 48 hours after transfection and 25 μg of protein was loaded per lane; Vdac protein was used to normalize loading. Blot is representative of 4 independent experiments.
5 Supplementary Figure 5. Steroyl-L-carnitines enhances IS. 48hrs after plating INS-1 832/3 cells, IS was measured in response to 7 mm glucose alone or in the presence of stearoyl-carnitine (50 μm) or palmitic acid (600 μm). Insulin secreted is normalized to total cellular insulin content and data is expressed relative to 7 mm glucose alone (NT) (2 hrs, n>4). *p < 0.05; **p < 0.01; ***p <
6 Supplementary Figure 6. (A & B) Metabolic profile demonstrates a subtle increase in long-chain acylcarnitines in response to CACT down-regulation. INS-1 832/13 cells were transfected with CACT sirnas or control oligonucleotides (Scr-siRNA) and maintained for 48 hrs in RPMI supplemented without any exogenous L-carnitine. Two hours prior to harvesting the cells for metabolic profiling, the culture medium was refreshed without (A) or with (B) PC (50 μm) and 1.5 mm glucose. All metabolite measurements in response to CACT sirna is normalized to control measurements. All experiments were performed n = 3 times. *p < 0.05; **p < 0.01; ***p <
7 Supplementary Figure 7. Palmitoyl-L-carnitine cannot activate GPR40. GPR40/CHO nuclear factor of activated T-cells β-lactamase cells were seeded into black-wall clear-bottom 384-well plates (Costar) 1 day before the assay. The cells were incubated with Hanks buffered salt solution buffer with 0.1% BSA, 2.5 mmol/l probenecid, and 8 μmol/l Fluo-4-AM at room temperature for 100 min. Fluorescence output was measured using a fluorometric imaging plate reader (FLIPR) assay. Compund A, linoleic acid, acetyl-carnitine and palmitoyl-carnitine were added to observe their effect on GPR40 activity. Experiment was repeated twice.
8 Supplementary Table 1. Acyl-carnitine molecules profiled by Mass spec and their correlation with IS. This table enlists all the acyl-carnitine moelcules that were surveyed by the Mass spec profilfing experiment. Column two of the table shows the coefficient of correlation of each metabolite with the IS effect depicted in Fig. 3B. Column three shows if the metabolite was significantly different between sicact and Scrambled treated cells in the absence or presence of exogenous PC (50μM). *p < 0.05; **p < 0.01; ***p < Acyl-carnitine Correl Coeff TTEST C ** C * C * C5: * C ** C4-OH C C5-OH C3-DC * C4-DC C8: C C5-DC C8:1-OH/C6:1-DC C8-OH/C6-DC C10: C10: * C10: C ** C7-DC * C8:1-DC ** C8-DC C12: C ** C12-OH/C10-DC C14: C14: * C *** C14:1-OH ** C14-OH/C12-DC ** C16: ** C16: ** C ** C16:1-OH/C14:1-DC ** C16-OH ** C18: ** C18: *** C *** C18:2-OH ***
9 C18:1-OH/C16:1-DC *** C18-OH/C16-DC ** C20: ** C ** C18:1-DC * C18-DC/C20-OH ** C ** Supplementary Table 2. Generation of adenovirus overexpressing mirna oligonucleotides. An expression cassette of human mirnas-132, 212 or 375 contained the hairpin stem composed of 22 nt sense and antisense sequence of each mirnas, fused to a loop (19 nt) and flanking sequence that derived from human mirna-30. Expression was controlled by the human H1 promoter. To construct the H1-miRNA expression cassette, the forward and reverse oligonucleotides containing the respective mirna sense and antisense sequence, mirna30 flanking sequence and loop, BamHI and HindIII overhang were first synthesized as a pair of complementary antiparallel oligonucleotides. The forward and reverse oligonucleotides mentioned above were then annealed and ligated into a Gateway entry plasmid pentr1a (Invitrogen), containing the human H1 promoter and a GFP expression cassette driven by CMV promoter. H1-miRNACMV- GFP cassette in pentr1a plasmid was recombined into Gateway-based pad-block-it DEST vector (Invitrogen). Ad-miRNAs were produced in HEK293 cells and purified by CsCl density gradient ultracentrifugation. The purified virus was desalted by dialysis and concentrated over CentriPrepYM-50 column before use. mirna-132 forward: mirna-132 reverse: mirna-212 forward: mirna-212 reverse: mirna-375 forward: mirna-375 reverse: Primer Sequences GATCCCCGGGTATATTGCTGTTGACAGTGAGCGAGACCATGGCTG TAGACTGTTATAGTGAAGCCACAGATGTATAACAGTCTACAGCCA TGGTCGTGCCTACTGCCTCGGACTTCAAGGGTTTTTGGA AGCTTCCAAAAACCCTTGAAGTCCGAGGCAGTAGGCACGACCATG GCTGTAGACTGTTATACATCTGTGGCTTCACTATAACAGTCTACAG CCATGGTCTCGCTCACTGTCAACAGCAATATACCCGGG GATCCCCGGGTATATTGCTGTTGACAGTGAGCGCGGCCGTGACTG GAGACTGTTATAGTGAAGCCACAGATGTATAACAGTCTCCAGTCA CGGCCATGCCTACTGCCTCGGACTTCAAGGGTTTTTGGA AGCTTCCAAAAACCCTTGAAGTCCGAGGCAGTAGGCATGGCCGTG ACTGGAGACTGTTATACATCTGTGGCTTCACTATAACAGTCTCCA GTCACGGCCGCGCTCACTGTCAACAGCAATATACCCGGG GATCCCCGGGTATATTGCTGTTGACAGTGAGCGCCACGCGAGCCG AACGAACAAATAGTGAAGCCACAGATGTATTTGTTCGTTCGGCTC GCGTGATGCCTACTGCCTCGGACTTCAAGGGTTTTTGGA AGCTTCCAAAAACCCTTGAAGTCCGAGGCAGTAGGCATCACGCGA GCCGAACGAACAAATACATCTGTGGCTTCACTATTTGTTCGTTCG GCTCGCGTGGCGCTCACTGTCAACAGCAATATACCCGGG
OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation
OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation -Optimal strategies to a successful mirna research project Optimal strategies to a successful mirna research
Instructions. Torpedo sirna. Material. Important Guidelines. Specifications. Quality Control
is a is a state of the art transfection reagent, specifically designed for the transfer of sirna and mirna into a variety of eukaryotic cell types. is a state of the art transfection reagent, specifically
RAPAd mirna Adenoviral Expression System Catalog #: VPK-253
DATENBLATT RAPAd mirna Adenoviral Expression System Catalog #: VPK-253 FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction MicroRNAs (mirnas) are 18 24 nucleotide RNA molecules that
Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
pcas-guide System Validation in Genome Editing
pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible
mirnaselect pep-mir Cloning and Expression Vector
Product Data Sheet mirnaselect pep-mir Cloning and Expression Vector CATALOG NUMBER: MIR-EXP-C STORAGE: -80ºC QUANTITY: 2 vectors; each contains 100 µl of bacterial glycerol stock Components 1. mirnaselect
HiPerFect Transfection Reagent Handbook
Fifth Edition October 2010 HiPerFect Transfection Reagent Handbook For transfection of eukaryotic cells with sirna and mirna Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the
2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line
i 1 INTRODUCTION 1.1 Human Hepatitis B virus (HBV) 1 1.1.1 Pathogenesis of Hepatitis B 1 1.1.2 Genome organization of HBV 3 1.1.3 Structure of HBV virion 5 1.1.4 HBV life cycle 5 1.1.5 Experimental models
Micro RNAs: potentielle Biomarker für das. Blutspenderscreening
Micro RNAs: potentielle Biomarker für das Blutspenderscreening micrornas - Background Types of RNA -Coding: messenger RNA (mrna) -Non-coding (examples): Ribosomal RNA (rrna) Transfer RNA (trna) Small nuclear
Recombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
TOOLS sirna and mirna. User guide
TOOLS sirna and mirna User guide Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas)
INTERFERin in vitro sirna/mirna transfection reagent PROTOCOL. 1 Standard sirna transfection of adherent cells... 2
INTERFERin in vitro sirna/mirna transfection reagent PROTOCOL DESCRIPTION INTERFERin is a powerful sirna/mirna transfection reagent that ensures efficient gene silencing and reproducible transfection in
Integrated Protein Services
Integrated Protein Services Custom protein expression & purification Version DC04-0012 Expression strategy The first step in the recombinant protein generation process is to design an appropriate expression
A role of microrna in the regulation of telomerase? Yuan Ming Yeh, Pei Rong Huang, and Tzu Chien V. Wang
A role of microrna in the regulation of telomerase? Yuan Ming Yeh, Pei Rong Huang, and Tzu Chien V. Wang Department of Molecular and Cellular Biology, Chang Gung University, Kwei San, Tao Yuan 333, Taiwan
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Susan Carson Heather B. Miller D.Scott Witherow ELSEVIER AMSTERDAM BOSTON HEIDELBERG LONDON NEW YORK OXFORD PARIS SAN DIEGO SAN
Integrated Protein Services
Integrated Protein Services Custom protein expression & purification Last date of revision June 2015 Version DC04-0013 www.iba-lifesciences.com Expression strategy The first step in the recombinant protein
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
MicroRNA formation. 4th International Symposium on Non-Surgical Contraceptive Methods of Pet Population Control
MicroRNA formation mirna s are processed from several precursor stages Mammalian genomes seem to have 100 s of mirna s Nucleotides in positions 2-8 of an mirna are considered the mirna seed 5 Methyl-G
User Manual/Hand book. qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse)
User Manual/Hand book qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse) Kit Components Cat. No. MA003...Human Whole Genome mirna qpcr Profiling Kit (-20 C) The following components are sufficient
SUPPLEMENTARY DATA 1
SUPPLEMENTARY DATA 1 Supplementary Figure S1. Overexpression of untagged Ago2 inhibits the nuclear transport of the dotted foci of GFP-signal of myc-gfp-tnrc6a-nes-mut. (A C) HeLa cells expressing myc-gfp-tnrc6a-nes-mut
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...
岑 祥 股 份 有 限 公 司 技 術 專 員 費 軫 尹 20100803
技 術 專 員 費 軫 尹 20100803 Overview of presentation Basic Biology of RNA interference Application of sirna for gene function? How to study mirna? How to deliver sirna and mirna? New prospects on RNAi research
Understanding the immune response to bacterial infections
Understanding the immune response to bacterial infections A Ph.D. (SCIENCE) DISSERTATION SUBMITTED TO JADAVPUR UNIVERSITY SUSHIL KUMAR PATHAK DEPARTMENT OF CHEMISTRY BOSE INSTITUTE 2008 CONTENTS Page SUMMARY
One Step mirna Cloning Vector G0760 pfbaavmu6mcs CMVeGFP SV40pA
One Step mirna Cloning Vector G0760 pfbaavmu6mcs CMVeGFP SV40pA Plasmid Features: Coordinates Feature 194-348 Tn7L 385-511 SV40pA (complementary-outside ITRs) 689-818 AAV2 ITR (130bp) 877-1188 EcoRI mu6
Biotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
Notch 1 -dependent regulation of cell fate in colorectal cancer
Notch 1 -dependent regulation of cell fate in colorectal cancer Referees: PD Dr. Tobias Dick Prof. Dr. Wilfried Roth http://d-nb.info/1057851272 CONTENTS Summary 1 Zusammenfassung 2 1 INTRODUCTION 3 1.1
Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes
Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes Outlines Brief introduction of OriGene s mission on gene-centric product solution. TrueMAB monoclonal antibody
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Fig. S1: Effect of ISO- and TAC-treatments on the biosynthesis of FAS-II elongation products in M. tb H37Ra. LC/MS chromatograms showing a decrease in products with elemental compositions
Introduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
Mouse ES Cell Nucleofector Kit
page 1 of 7 Mouse ES Cell Nucleofector Kit for Mouse Embryonic Stem Cells Cell type Origin Cells derived from mouse blastocysts. Morphology Round cells growing in clumps. Important remarks! 1. This protocol
Reprogramming, Screening and Validation of ipscs and Terminally Differentiated Cells using the qbiomarker PCR Array System
Reprogramming, Screening and Validation of ipscs and Terminally Differentiated Cells using the qbiomarker PCR Array System Outline of Webinar What are induced pluripotent Stem Cells (ips Cells or ipscs)?
DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA
DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence
Supplemental Information. McBrayer et al. Supplemental Data
1 Supplemental Information McBrayer et al. Supplemental Data 2 Figure S1. Glucose consumption rates of MM cell lines exceed that of normal PBMC. (A) Normal PBMC isolated from three healthy donors were
bitter is de pil Linos Vandekerckhove, MD, PhD
4//24 Current HIV care HIV copies/ ml plasma Viral load Welcome to the Digital droplet PCR age! bitter is de pil Linos Vandekerckhove, MD, PhD Latent HIV reservoir Time at Ghent University Hospital 2 HIV
Lezioni Dipartimento di Oncologia Farmacologia Molecolare. RNA interference. Giovanna Damia 29 maggio 2006
Lezioni Dipartimento di Oncologia Farmacologia Molecolare RNA interference Giovanna Damia 29 maggio 2006 RNA INTERFERENCE Sequence-specific gene suppression by dsrnas Gene silencing by dsrna: C. elegans
Taq98 Hot Start 2X Master Mix
Taq98 Hot Start 2X Master Mix Optimized for 98C Denaturation Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608) 831-9012 [email protected]
Mir-X mirna First-Strand Synthesis Kit User Manual
User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.
Essentials of Real Time PCR. About Sequence Detection Chemistries
Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected
hydrocortisone (5 mg/ml), EGF (10 µg/ml) and Heparin (5000 U/ml). Antibodies against the N-terminal peptide of MEK1 (MEK1-N) and against Flotillin 1
SUPPLEMENTARY METHODS Cells HUVEC (Human Umbilical Vein Endothelial Cells) were grown in complete Medium 199 (Gibco) supplemented with glutamax, 10% foetal calf serum, BBE (9 mg/ml), hydrocortisone (5
MEF Starter Nucleofector Kit
page 1 of 7 MEF Starter Nucleofector Kit for Mouse Embryonic Fibroblasts (MEF) MEF display significant phenotypic variations which depend on the strain, the genetic background of the mice they are isolated
Investigating the role of a Cryptosporidium parum apyrase in infection
Investigating the role of a Cryptosporidium parum apyrase in infection David Riccardi and Patricio Manque Abstract This project attempted to characterize the function of a Cryptosporidium parvum apyrase
MEF Nucleofector Kit 1 and 2
page 1 of 7 MEF Nucleofector Kit 1 and 2 for Mouse Embryonic Fibroblasts (MEF) MEF display significant phenotypic variations which depend on the strain, the genetic background of the they are isolated
Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products
Genolution Pharmaceuticals, Inc. Revolution through genes, And Solution through genes. Life Science and Molecular Diagnostic Products www.genolution1.com TEL; 02-3010-8670, 8672 Geno-Serum Hepatitis B
RT-PCR: Two-Step Protocol
RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed
Validation & Assay Performance Summary
Validation & Assay Performance Summary GeneBLAzer RAR alpha DA Assay Kit GeneBLAzer RAR alpha-uas-bla GripTite Cells Cat. no. K1387, K1685 Target Description The retinoic acid receptor alpha (RAR alpha)
QIAGEN Transfection Technologies
QIAGEN Transfection Technologies Efficient and robust transfection for all your applications Sample & Assay Technologies Table of contents QIAGEN solutions for efficient transfection Transfection is a
Optimized Protocol sirna Test Kit for Cell Lines and Adherent Primary Cells
page 1 of 8 sirna Test Kit for Cell Lines and Adherent Primary Cells Kit principle Co-transfection of pmaxgfp, encoding the green fluorescent protein (GFP) from Pontellina p. with an sirna directed against
RNA Structure and folding
RNA Structure and folding Overview: The main functional biomolecules in cells are polymers DNA, RNA and proteins For RNA and Proteins, the specific sequence of the polymer dictates its final structure
Protein Expression. A Practical Approach J. HIGGIN S
Protein Expression A Practical Approach S. J. HIGGIN S B. D. HAMES List of contributors Abbreviations xv Xvi i 1. Protein expression in mammalian cell s Marlies Otter-Nilsson and Tommy Nilsso n 1. Introduction
RNA & Protein Synthesis
RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis
Inhibition of MicroRNA Sensitizes 3D Breast Cancer Microtissues to Radiation Therapy
CASE STUDY High Content Image Analysis Inhibition of MicroRNA Sensitizes 3D Breast Cancer Microtissues to Radiation Therapy Dr. Nataša Anastasov leads the Personalized Radiation Therapy Group within the
Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix
CLONING & MAPPING DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix LIBRARY PREP FOR NET GEN SEQUENCING PROTEIN
Recombinant DNA Unit Exam
Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the
restriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
Molecular Genetics. RNA, Transcription, & Protein Synthesis
Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and
PreciseTM Whitepaper
Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis
THE His Tag Antibody, mab, Mouse
THE His Tag Antibody, mab, Mouse Cat. No. A00186 Technical Manual No. TM0243 Update date 01052011 I Description.... 1 II Key Features. 2 III Storage 2 IV Applications.... 2 V Examples - ELISA..... 2 VI
qstar mirna qpcr Detection System
qstar mirna qpcr Detection System Table of Contents Table of Contents...1 Package Contents and Storage Conditions...2 For mirna cdna synthesis kit...2 For qstar mirna primer pairs...2 For qstar mirna qpcr
PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)
PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608)
Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription
Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional
Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr
User Manual Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,
ALLEN Mouse Brain Atlas
TECHNICAL WHITE PAPER: QUALITY CONTROL STANDARDS FOR HIGH-THROUGHPUT RNA IN SITU HYBRIDIZATION DATA GENERATION Consistent data quality and internal reproducibility are critical concerns for high-throughput
The world of non-coding RNA. Espen Enerly
The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often
CD3/TCR stimulation and surface detection Determination of specificity of intracellular detection of IL-7Rα by flow cytometry
CD3/TCR stimulation and surface detection Stimulation of HPB-ALL cells with the anti-cd3 monoclonal antibody OKT3 was performed as described 3. In brief, antibody-coated plates were prepared by incubating
Bacterial Transformation and Plasmid Purification. Chapter 5: Background
Bacterial Transformation and Plasmid Purification Chapter 5: Background History of Transformation and Plasmids Bacterial methods of DNA transfer Transformation: when bacteria take up DNA from their environment
Synaptophysin Regulates the Kinetics of Synaptic Vesicle Endocytosis in Central Neurons
Neuron, Volume 70 Supplemental Information Synaptophysin Regulates the Kinetics of Synaptic Vesicle Endocytosis in Central Neurons Sung E. Kwon and Edwin R. Chapman Supplemental Figure Legends Figure
PRODUCT INFORMATION...
VIROMER RED In vitro plasmid DNA and mrna Standard Transfection PRODUCT INFORMATION... 2 GENERAL... 2 RED OR YELLOW?... 3 PROTOCOL GUIDELINES... 4 GENERAL REMARKS... 4 CELL CULTURE AND PLATING... 4 FORWARD/REVERSE
Global MicroRNA Amplification Kit
Global MicroRNA Amplification Kit Store kit at -20 C on receipt (ver. 3-060901) A limited-use label license covers this product. By use of this product, you accept the terms and conditions outlined in
Manual for: sirna-trans Maximo Reagent
Manual for: sirna-trans Maximo Reagent Contact: [email protected]; www.geneon.net GeneON GmbH Germany GeneON GmbH / Protocol sirna-trans reagent vs. 1.3 / www.geneon.net / - 0 - sirna-trans reagent Instruction
Relative Quantification of mirna Target mrnas by Real-Time qpcr. 1 Introduction. Gene Expression Application Note No. 4
Gene Expression Application Note No. 4 Relative Quantification of mirna Target mrnas by Real-Time qpcr Ute Ernst, Jitao David Zhang, Anja Irsigler, Stefan Wiemann, Ulrich Tschulena Division: Molecular
STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS
STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS THESIS SUBMITTED FOR THE DEGREB OF DOCTOR OF PHILOSOPHY (SCIENCE) OF THE UNIVERSITY OF CALCUTTA 1996 NRISINHA DE, M.Sc DEPARTMENT OF BIOCHEMISTRY
Materials and Methods. Blocking of Globin Reverse Transcription to Enhance Human Whole Blood Gene Expression Profiling
Application Note Blocking of Globin Reverse Transcription to Enhance Human Whole Blood Gene Expression Profi ling Yasmin Beazer-Barclay, Doug Sinon, Christopher Morehouse, Mark Porter, and Mike Kuziora
mirnaselect pegp-mir Cloning and Expression Vector
Product Data Sheet mirnaselect pegp-mir Cloning and Expression Vector CATALOG NUMBER: MIR-EXP-GP-C STORAGE: -80ºC QUANTITY: 100 µl of bacterial glycerol stock Components 1. mirnaselect pegp-mir Cloning
GRS Plasmid Purification Kit Transfection Grade GK73.0002 (2 MaxiPreps)
1 GRS Plasmid Purification Kit Transfection Grade GK73.0002 (2 MaxiPreps) (FOR RESEARCH ONLY) Sample : Expected Yield : Endotoxin: Format : Operation Time : Elution Volume : 50-400 ml of cultured bacterial
micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved
microrna 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions of target mrnas Act as negative
PRESTWICK ACADEMY NATIONAL 5 BIOLOGY CELL BIOLOGY SUMMARY
Name PRESTWICK ACADEMY NATIONAL 5 BIOLOGY CELL BIOLOGY SUMMARY Cell Structure Identify animal, plant, fungal and bacterial cell ultrastructure and know the structures functions. Plant cell Animal cell
Expression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu
Expression and Purification of Recombinant Protein in bacteria and Yeast Presented By: Puspa pandey, Mohit sachdeva & Ming yu DNA Vectors Molecular carriers which carry fragments of DNA into host cell.
Updated: July 2005. 5' End label RNA markers 18.113 (18mer) and 44.12 (24mer) with Kinase and 32P-gamma-ATP. Gel purify labeled markers.
RNA Cloning Method Flowchart Extract total RNA containing small RNAs. Check quality on denaturing gel with EtBr staining 5' End label RNA markers 18.113 (18mer) and 44.12 (24mer) with Kinase and 32P-gamma-ATP.
EXPRESSION ARREST shrna mir GENOME- WIDE LIBRARIES
C GUGAAG EXPRESSION ARREST shrna mir GENOME- WIDE LIBRARIES MicroRNA-adapted shrna (shrna mir ) for increased, specific and consistent knockdown. MicroRNA PROCESSING PATHWAY UTILIZED FOR shrna mir Developed
HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:
HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone
Northern blot analysis for microrna. (Narry Kim s lab)
Northern blot analysis for microrna (Narry Kim s lab) Materials 1. 10~50 μg of total RNA extracted from HeLa cells treated with sirna 2. RNA loading buffer 3. Probe: DNA oligonucleotide complementary to
Anti-ATF6 α antibody, mouse monoclonal (1-7)
Anti-ATF6 α antibody, mouse monoclonal (1-7) 73-500 50 ug ATF6 (activating transcription factor 6) is an endoplasmic reticulum (ER) membrane-bound transcription factor activated in response to ER stress.
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID papillary renal cell carcinoma (translocation-associated) PRCC Human This gene
RNAi Shooting the Messenger!
RNAi Shooting the Messenger! Bronya Keats, Ph.D. Department of Genetics Louisiana State University Health Sciences Center New Orleans Email: [email protected] RNA interference (RNAi) A mechanism by which
Head of College Scholars List Scheme. Summer Studentship. Report Form
Head of College Scholars List Scheme Summer Studentship Report Form This report should be completed by the student with his/her project supervisor. It should summarise the work undertaken during the project
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
RevertAid Premium First Strand cdna Synthesis Kit
RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/339/ra80/dc1 Supplementary Materials for Manipulation of receptor oligomerization as a strategy to inhibit signaling by TNF superfamily members Julia T. Warren,
First Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
ELISA BIO 110 Lab 1. Immunity and Disease
ELISA BIO 110 Lab 1 Immunity and Disease Introduction The principal role of the mammalian immune response is to contain infectious disease agents. This response is mediated by several cellular and molecular
