Unraveling protein networks with Power Graph Analysis
|
|
|
- Dominic Fletcher
- 10 years ago
- Views:
Transcription
1 Unraveling protein networks with Power Graph Analysis PLoS Computational Biology, 2008 Loic Royer Matthias Reimann Bill Andreopoulos Michael Schroeder Schroeder Group Bioinformatics 1
2 Complex Networks in Biology Direct visualization too much detail Clustering / Coarse graining loss of detail Is there a middle ground? 2
3 SH3 Interaction Profiles Landgraf et al. (2004) Discovery of peptides that bind 8 SH3 domains in Yeast. What is interesting about the interaction profiles of these SH3 domains? 3
4 Bipartite Regulatory Network Beyer et al. (2006) A bipartite network between transcription factors and target genes in Yeast. What insights can be gathered about the poorly characterized factor YAP7? 4
5 Phosphatase Similarity Network (Own data) An network connecting Tyrosine Phosphatases if their sequences are similar enough (BLAST e < 10-46). Is it at all possible to find something interesting in there? 5
6 Solution: 'To comprehend is to compress' Gregory Chaitin 6
7 Solution: 'To comprehend is to compress' Gregory Chaitin Outline: Power Graph Analysis 3 Examples Statistics of Compressibility 2 step Algorithm 7
8 The Language of Power Graphs Solution: Transform networks into Power Graphs by clustering both nodes and edges Biclique Clique Star This is a reversible transformation that preserves all connectivity information 8
9 Protein Interactions Hubs in networks hub Protein Complexes Domain and motif induced interactions 9
10 Beyond Protein Interactions Regulatory networks Transcription factors Homology / Paralogy Networks 10
11 SH3 Interaction Profiles The power graph improves the readability of the network. Is there biology explaining the way the peptides are grouped? 11
12 SH3 Interaction Profiles Green: SH3 domains, Red: PxxPxR motif, Blue: RxxPxxP motif Now, what about the SH3 domains? 12
13 SH3 Interaction Profiles The neighborhood similarity implied by the power graph reflects the sequence similarity of the SH3 domains. Example: LSB3 and YSC84 have similar sequences but also similar binding profiles 13
14 Bipartite Regulatory Network Transcription factors are clustered according to their target genes Target genes are clustered according to their transcription factors 14
15 Bipartite Regulatory Network YAP7 All 6 factors involved in Yeast stress response YAP1/2 regulate metal detoxification genes Hypothesis: poorly characterized YAP7 too 15
16 Phosphatase Similarity Network 16
17 Phosphatase Similarity Network 6 type B receptor PTPs are linked by a power edge to two type 2 non-receptor PTPs 17
18 Phosphatase Similarity Network The second tyrosine phosphatase domain of the two type G PTPs align to an unannotated region of about 370 amino acids with a sequence identity of 14% and a similarity of 39% This is evidence of domain erosion 18
19 Power Graph Analysis T o com prehend is to compress Power Graph Analysis reduces redundant information 18 edges 2 power nodes 2 power edges Edges become power nodes and power edges Conversion rate is one power node for 8 edges Edge reduction is 88% Overall less symbols needed: 4 instead of 18 19
20 Empirical Statistical Analysis Higher compression levels are achieved for biological networks than for rewired networks of same degree distribution Thus the scale-free degree distribution is not the explanation Original Rewired 20
21 Power Graph Spectrum Cliques and bicliques almost disappear after rewiring Same holds for manually curated networks (SIN, HPRD) 21
22 Domains and GO Terms Cliques and bicliques have a biological explanation Power nodes are enriched in InterPro domains And enriched in GO terms: Domains are a better explanation for cliques and bicliques than GO terms. 22
23 The Power Graph Algorithm Problem: Minimal decomposition into cliques and bicliques Similar problems: Minimal partition into cliques is NP-hard (Kratzke 88) Minimal biclique partition is NP-complete (Duh 97) Our solution: a greedy search, two steps: 23
24 Summary Compress Power Graphs compress networks without loss of information Compression levels up to 95% are possible High compressibility is lost after degree invariant rewiring Fast, greedy algorithm, applicable for many types of networks. Comprehend Half of power nodes have a Domain or GO term enrichment SH3 domain interaction profiles reflects phylogeny Function prediction for transcription factor Discovery of an eroded Phosphatase domain Try it! Available for Cytoscape and as command line tool. GOOGLE FOR: Power Graph Analysis 24
25 Acknowledgments Matthias Reimann Bill Andreopoulos Christof Winter Michael Schroeder Participant travel costs to present the project described was supported by Award Number R13GM from the U.S National Institute of General Medical Sciences. The content is solely the responsibility of the author(s) and does not necessarily represent the official views of the National Institute of General Medical Sciences of the National Institutes of Health. M ichael S chroeder G roup B iotec D resden University of T echnology 25
26 GCB 2008 German Conference on Bioinformatics A Systems Approach to Disease Dresden September 9 12, Posters and highlight papers: 1 August Keynote speakers: Michael Ashburner Janusz M. Bujnicki David Gilbert Trey Ideker Jens Reich Marino Zerial Biotechnology Center Dresden 26
Protein Protein Interaction Networks
Functional Pattern Mining from Genome Scale Protein Protein Interaction Networks Young-Rae Cho, Ph.D. Assistant Professor Department of Computer Science Baylor University it My Definition of Bioinformatics
Network Analysis. BCH 5101: Analysis of -Omics Data 1/34
Network Analysis BCH 5101: Analysis of -Omics Data 1/34 Network Analysis Graphs as a representation of networks Examples of genome-scale graphs Statistical properties of genome-scale graphs The search
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
Introduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 [email protected]
Bioinformatics: Network Analysis
Bioinformatics: Network Analysis Graph-theoretic Properties of Biological Networks COMP 572 (BIOS 572 / BIOE 564) - Fall 2013 Luay Nakhleh, Rice University 1 Outline Architectural features Motifs, modules,
Interaktionen von RNAs und Proteinen
Sonja Prohaska Computational EvoDevo Universitaet Leipzig June 9, 2015 Studying RNA-protein interactions Given: target protein known to bind to RNA problem: find binding partners and binding sites experimental
Visualizing Networks: Cytoscape. Prat Thiru
Visualizing Networks: Cytoscape Prat Thiru Outline Introduction to Networks Network Basics Visualization Inferences Cytoscape Demo 2 Why (Biological) Networks? 3 Networks: An Integrative Approach Zvelebil,
BIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16
Course Director: Dr. Barry Grant (DCM&B, [email protected]) Description: This is a three module course covering (1) Foundations of Bioinformatics, (2) Statistics in Bioinformatics, and (3) Systems
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
Introduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
1. Introduction Gene regulation Genomics and genome analyses Hidden markov model (HMM)
1. Introduction Gene regulation Genomics and genome analyses Hidden markov model (HMM) 2. Gene regulation tools and methods Regulatory sequences and motif discovery TF binding sites, microrna target prediction
BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS
BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:
Graph theoretic approach to analyze amino acid network
Int. J. Adv. Appl. Math. and Mech. 2(3) (2015) 31-37 (ISSN: 2347-2529) Journal homepage: www.ijaamm.com International Journal of Advances in Applied Mathematics and Mechanics Graph theoretic approach to
Computational Systems Biology. Lecture 2: Enzymes
Computational Systems Biology Lecture 2: Enzymes 1 Images from: David L. Nelson, Lehninger Principles of Biochemistry, IV Edition, Freeman ed. or under creative commons license (search for images at http://search.creativecommons.org/)
Feed Forward Loops in Biological Systems
Feed Forward Loops in Biological Systems Dr. M. Vijayalakshmi School of Chemical and Biotechnology SASTRA University Joint Initiative of IITs and IISc Funded by MHRD Page 1 of 7 Table of Contents 1 INTRODUCTION...
Subgraph Patterns: Network Motifs and Graphlets. Pedro Ribeiro
Subgraph Patterns: Network Motifs and Graphlets Pedro Ribeiro Analyzing Complex Networks We have been talking about extracting information from networks Some possible tasks: General Patterns Ex: scale-free,
Data Integration. Lectures 16 & 17. ECS289A, WQ03, Filkov
Data Integration Lectures 16 & 17 Lectures Outline Goals for Data Integration Homogeneous data integration time series data (Filkov et al. 2002) Heterogeneous data integration microarray + sequence microarray
Vad är bioinformatik och varför behöver vi det i vården? a bioinformatician's perspectives
Vad är bioinformatik och varför behöver vi det i vården? a bioinformatician's perspectives [email protected] 2015-05-21 Functional Bioinformatics, Örebro University Vad är bioinformatik och varför
Healthcare Analytics. Aryya Gangopadhyay UMBC
Healthcare Analytics Aryya Gangopadhyay UMBC Two of many projects Integrated network approach to personalized medicine Multidimensional and multimodal Dynamic Analyze interactions HealthMask Need for sharing
Guide for Bioinformatics Project Module 3
Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first
Integrating DNA Motif Discovery and Genome-Wide Expression Analysis. Erin M. Conlon
Integrating DNA Motif Discovery and Genome-Wide Expression Analysis Department of Mathematics and Statistics University of Massachusetts Amherst Statistics in Functional Genomics Workshop Ascona, Switzerland
Probabilistic methods for post-genomic data integration
Probabilistic methods for post-genomic data integration Dirk Husmeier Biomathematics & Statistics Scotland (BioSS) JMB, The King s Buildings, Edinburgh EH9 3JZ United Kingdom http://wwwbiossacuk/ dirk
Bioinformatics Grid - Enabled Tools For Biologists.
Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
ProteinQuest user guide
ProteinQuest user guide 1. Introduction... 3 1.1 With ProteinQuest you can... 3 1.2 ProteinQuest basic version 4 1.3 ProteinQuest extended version... 5 2. ProteinQuest dictionaries... 6 3. Directions for
Linear Sequence Analysis. 3-D Structure Analysis
Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical properties Molecular weight (MW), isoelectric point (pi), amino acid content, hydropathy (hydrophilic
Next Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University [email protected] http://tandem.bu.edu/ The Human Genome Project took
Search and Data Mining: Techniques. Applications Anya Yarygina Boris Novikov
Search and Data Mining: Techniques Applications Anya Yarygina Boris Novikov Introduction Data mining applications Data mining system products and research prototypes Additional themes on data mining Social
NeXO Web: the NeXO ontology database and visualization platform
Nucleic Acids Research Advance Access published November 23, 2013 Nucleic Acids Research, 2013, 1 6 doi:10.1093/nar/gkt1192 NeXO Web: the NeXO ontology database and visualization platform Janusz Dutkowski*,
Bio-Informatics Lectures. A Short Introduction
Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively
Bioinformatics: course introduction
Bioinformatics: course introduction Filip Železný Czech Technical University in Prague Faculty of Electrical Engineering Department of Cybernetics Intelligent Data Analysis lab http://ida.felk.cvut.cz
Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics
Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics Christopher Benner, PhD Director, Integrative Genomics and Bioinformatics Core (IGC) idash Webinar,
T cell Epitope Prediction
Institute for Immunology and Informatics T cell Epitope Prediction EpiMatrix Eric Gustafson January 6, 2011 Overview Gathering raw data Popular sources Data Management Conservation Analysis Multiple Alignments
Efficient Parallel Execution of Sequence Similarity Analysis Via Dynamic Load Balancing
Efficient Parallel Execution of Sequence Similarity Analysis Via Dynamic Load Balancing James D. Jackson Philip J. Hatcher Department of Computer Science Kingsbury Hall University of New Hampshire Durham,
Algorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
Using Graph Theory to Analyze Gene Network Coherence
Using Graph Theory to Analyze Gene Network Coherence Francisco A. Gómez-Vela [email protected] Norberto Díaz-Díaz [email protected] José A. Lagares José A. Sánchez Jesús S. Aguilar 1 Outlines Introduction Proposed
REGULATIONS FOR THE DEGREE OF BACHELOR OF SCIENCE IN BIOINFORMATICS (BSc[BioInf])
820 REGULATIONS FOR THE DEGREE OF BACHELOR OF SCIENCE IN BIOINFORMATICS (BSc[BioInf]) (See also General Regulations) BMS1 Admission to the Degree To be eligible for admission to the degree of Bachelor
MAKING AN EVOLUTIONARY TREE
Student manual MAKING AN EVOLUTIONARY TREE THEORY The relationship between different species can be derived from different information sources. The connection between species may turn out by similarities
Visualization methods for patent data
Visualization methods for patent data Treparel 2013 Dr. Anton Heijs (CTO & Founder) Delft, The Netherlands Introduction Treparel can provide advanced visualizations for patent data. This document describes
AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE
ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS
Final Project Report
CPSC545 by Introduction to Data Mining Prof. Martin Schultz & Prof. Mark Gerstein Student Name: Yu Kor Hugo Lam Student ID : 904907866 Due Date : May 7, 2007 Introduction Final Project Report Pseudogenes
Pairwise Sequence Alignment
Pairwise Sequence Alignment [email protected] SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What
NETZCOPE - a tool to analyze and display complex R&D collaboration networks
The Task Concepts from Spectral Graph Theory EU R&D Network Analysis Netzcope Screenshots NETZCOPE - a tool to analyze and display complex R&D collaboration networks L. Streit & O. Strogan BiBoS, Univ.
InSyBio BioNets: Utmost efficiency in gene expression data and biological networks analysis
InSyBio BioNets: Utmost efficiency in gene expression data and biological networks analysis WHITE PAPER By InSyBio Ltd Konstantinos Theofilatos Bioinformatician, PhD InSyBio Technical Sales Manager August
Exponential time algorithms for graph coloring
Exponential time algorithms for graph coloring Uriel Feige Lecture notes, March 14, 2011 1 Introduction Let [n] denote the set {1,..., k}. A k-labeling of vertices of a graph G(V, E) is a function V [k].
Course on Functional Analysis. ::: Gene Set Enrichment Analysis - GSEA -
Course on Functional Analysis ::: Madrid, June 31st, 2007. Gonzalo Gómez, PhD. [email protected] Bioinformatics Unit CNIO ::: Contents. 1. Introduction. 2. GSEA Software 3. Data Formats 4. Using GSEA 5. GSEA
Distributed Computing over Communication Networks: Maximal Independent Set
Distributed Computing over Communication Networks: Maximal Independent Set What is a MIS? MIS An independent set (IS) of an undirected graph is a subset U of nodes such that no two nodes in U are adjacent.
Community Detection Proseminar - Elementary Data Mining Techniques by Simon Grätzer
Community Detection Proseminar - Elementary Data Mining Techniques by Simon Grätzer 1 Content What is Community Detection? Motivation Defining a community Methods to find communities Overlapping communities
Protein Protein Interactions (PPI) APID (Agile Protein Interaction DataAnalyzer)
APID (Agile Protein Interaction DataAnalyzer) 23 APID (Agile Protein Interaction DataAnalyzer) Integrates and unifies 7 DBs: BIND, DIP, HPRD, IntAct, MINT, BioGRID. Includes 51,873 proteins 241,204 interactions
SGI. High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems. January, 2012. Abstract. Haruna Cofer*, PhD
White Paper SGI High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems Haruna Cofer*, PhD January, 2012 Abstract The SGI High Throughput Computing (HTC) Wrapper
Graphical degree sequences and realizations
swap Graphical and realizations Péter L. Erdös Alfréd Rényi Institute of Mathematics Hungarian Academy of Sciences MAPCON 12 MPIPKS - Dresden, May 15, 2012 swap Graphical and realizations Péter L. Erdös
Mining Social-Network Graphs
342 Chapter 10 Mining Social-Network Graphs There is much information to be gained by analyzing the large-scale data that is derived from social networks. The best-known example of a social network is
Tutorial 8. NP-Complete Problems
Tutorial 8 NP-Complete Problems Decision Problem Statement of a decision problem Part 1: instance description defining the input Part 2: question stating the actual yesor-no question A decision problem
When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want
1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very
Pipeline Pilot Enterprise Server. Flexible Integration of Disparate Data and Applications. Capture and Deployment of Best Practices
overview Pipeline Pilot Enterprise Server Pipeline Pilot Enterprise Server (PPES) is a powerful client-server platform that streamlines the integration and analysis of the vast quantities of data flooding
Integrating Bioinformatics, Medical Sciences and Drug Discovery
Integrating Bioinformatics, Medical Sciences and Drug Discovery M. Madan Babu Centre for Biotechnology, Anna University, Chennai - 600025 phone: 44-4332179 :: email: [email protected] Bioinformatics
Human-Mouse Synteny in Functional Genomics Experiment
Human-Mouse Synteny in Functional Genomics Experiment Ksenia Krasheninnikova University of the Russian Academy of Sciences, JetBrains [email protected] September 18, 2012 Ksenia Krasheninnikova
Current Motif Discovery Tools and their Limitations
Current Motif Discovery Tools and their Limitations Philipp Bucher SIB / CIG Workshop 3 October 2006 Trendy Concepts and Hypotheses Transcription regulatory elements act in a context-dependent manner.
Biological Sequence Data Formats
Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA
Processing Genome Data using Scalable Database Technology. My Background
Johann Christoph Freytag, Ph.D. [email protected] http://www.dbis.informatik.hu-berlin.de Stanford University, February 2004 PhD @ Harvard Univ. Visiting Scientist, Microsoft Res. (2002)
10/4/2012. Analysis and Visualization of Biological Networks with Cytoscape. Outline of the Day. Introductions
Analysis and Visualization of Biological Networks with Cytoscape John Scooter Morris, Ph.D., UCSF October 4, 2012 1 Outline of the Day Introductions and setup (15 minutes) Biological Networks (60 minutes)
Open Source Software Developer and Project Networks
Open Source Software Developer and Project Networks Matthew Van Antwerp and Greg Madey University of Notre Dame {mvanantw,gmadey}@cse.nd.edu Abstract. This paper outlines complex network concepts and how
Activity 7.21 Transcription factors
Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation
Pathway Analysis : An Introduction
Pathway Analysis : An Introduction Experiments Literature and other KB Data Knowledge Structure in Data through statistics Structure in Knowledge through GO and other Ontologies Gain insight into Data
A Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
Genome Explorer For Comparative Genome Analysis
Genome Explorer For Comparative Genome Analysis Jenn Conn 1, Jo L. Dicks 1 and Ian N. Roberts 2 Abstract Genome Explorer brings together the tools required to build and compare phylogenies from both sequence
Annex 6: Nucleotide Sequence Information System BEETLE. Biological and Ecological Evaluation towards Long-Term Effects
Annex 6: Nucleotide Sequence Information System BEETLE Biological and Ecological Evaluation towards Long-Term Effects Long-term effects of genetically modified (GM) crops on health, biodiversity and the
BBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS
BBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS 1. The Technology Strategy sets out six areas where technological developments are required to push the frontiers of knowledge
Who takes the lead? Social network analysis as a pioneering tool to investigate shared leadership within sports teams. Fransen et al.
Who takes the lead? Social network analysis as a pioneering tool to investigate shared leadership within sports teams Fransen et al. (2015) PAPER PRESENTATION CSI 660 RYAN K. DUBOWSKY 1 Background Overview
WORKSHOP ON TOPOLOGY AND ABSTRACT ALGEBRA FOR BIOMEDICINE
WORKSHOP ON TOPOLOGY AND ABSTRACT ALGEBRA FOR BIOMEDICINE ERIC K. NEUMANN Foundation Medicine, Cambridge, MA 02139, USA Email: [email protected] SVETLANA LOCKWOOD School of Electrical Engineering
QUANTITATIVE APPROACHES IN CELL BIOLOGY BIOPHYSICS, BIOENGINEERING & SYSTEMS BIOLOGY
QUANTITATIVE APPROACHES IN CELL BIOLOGY BIOPHYSICS, BIOENGINEERING & SYSTEMS BIOLOGY SignGene Symposium 2014 August 31 - September 2, 2014 Max Delbrück Center for Molecular Medicine Berlin, Germany www.mdc-berlin.de/signgenesymposium2014
8/20/2012 H C OH H R. Proteins
Proteins Rubisco monomer = amino acids 20 different amino acids polymer = polypeptide protein can be one or more polypeptide chains folded & bonded together large & complex 3-D shape hemoglobin Amino acids
The Big Data Paradigm Shift. Insight Through Automation
The Big Data Paradigm Shift Insight Through Automation Agenda The Problem Emcien s Solution: Algorithms solve data related business problems How Does the Technology Work? Case Studies 2013 Emcien, Inc.
The Visualization Pipeline
The Visualization Pipeline Conceptual perspective Implementation considerations Algorithms used in the visualization Structure of the visualization applications Contents The focus is on presenting the
Qualitative modeling of biological systems
Qualitative modeling of biological systems The functional form of regulatory relationships and kinetic parameters are often unknown Increasing evidence for robustness to changes in kinetic parameters.
An Introduction to the Use of Bayesian Network to Analyze Gene Expression Data
n Introduction to the Use of ayesian Network to nalyze Gene Expression Data Cristina Manfredotti Dipartimento di Informatica, Sistemistica e Comunicazione (D.I.S.Co. Università degli Studi Milano-icocca
Protein Sequence Analysis - Overview -
Protein Sequence Analysis - Overview - UDEL Workshop Raja Mazumder Research Associate Professor, Department of Biochemistry and Molecular Biology Georgetown University Medical Center Topics Why do protein
USING SPECTRAL RADIUS RATIO FOR NODE DEGREE TO ANALYZE THE EVOLUTION OF SCALE- FREE NETWORKS AND SMALL-WORLD NETWORKS
USING SPECTRAL RADIUS RATIO FOR NODE DEGREE TO ANALYZE THE EVOLUTION OF SCALE- FREE NETWORKS AND SMALL-WORLD NETWORKS Natarajan Meghanathan Jackson State University, 1400 Lynch St, Jackson, MS, USA [email protected]
Understanding the dynamics and function of cellular networks
Understanding the dynamics and function of cellular networks Cells are complex systems functionally diverse elements diverse interactions that form networks signal transduction-, gene regulatory-, metabolic-
MASCOT Search Results Interpretation
The Mascot protein identification program (Matrix Science, Ltd.) uses statistical methods to assess the validity of a match. MS/MS data is not ideal. That is, there are unassignable peaks (noise) and usually
CD-HIT User s Guide. Last updated: April 5, 2010. http://cd-hit.org http://bioinformatics.org/cd-hit/
CD-HIT User s Guide Last updated: April 5, 2010 http://cd-hit.org http://bioinformatics.org/cd-hit/ Program developed by Weizhong Li s lab at UCSD http://weizhong-lab.ucsd.edu [email protected] 1. Introduction
Analysis of the colorectal tumor microenvironment using integrative bioinformatic tools
MLECNIK Bernhard & BINDEA Gabriela Analysis of the colorectal tumor microenvironment using integrative bioinformatic tools INSERM U872, Jérôme Galon Team15: Integrative Cancer Immunology Cordeliers Research
BIOINFORMATICS TUTORIAL
Bio 242 BIOINFORMATICS TUTORIAL Bio 242 α Amylase Lab Sequence Sequence Searches: BLAST Sequence Alignment: Clustal Omega 3d Structure & 3d Alignments DO NOT REMOVE FROM LAB. DO NOT WRITE IN THIS DOCUMENT.
