MicroRNA formation. 4th International Symposium on Non-Surgical Contraceptive Methods of Pet Population Control

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "MicroRNA formation. 4th International Symposium on Non-Surgical Contraceptive Methods of Pet Population Control"

Transcription

1 MicroRNA formation mirna s are processed from several precursor stages Mammalian genomes seem to have 100 s of mirna s Nucleotides in positions 2-8 of an mirna are considered the mirna seed 5 Methyl-G cap mrna target 3 UACGCGAGCCGACCCUACCUCC! 3 UGAUAUGUUGGAUGAUGGAGU 5 mirna Let-7a polya tail 3 Antagomir=backbone modified antisense complementary to mirnabinds and blocks function. X Functional inhibition of mirna loaded RISC. Alliance for Contraception in Cats & Dogs acc-d.org 1

2 Nat. Cell Biol sirna Binding of sirna in Piwi domain of Argonautes 5 A. fulgidus Piwi protein 3 5 Small interfering RNAs or sirnas bind to their targets by full complementarity and direct RISC to cleave target mrna at a precise position. Cleavage Takes Place at Center of sirna-target Duplex First demonstration of RNAi in Mammalian Cells NAAGCCUGUGCCUCUUCAGCUACC UUCGGACACGGAGAAGUCGAUGp5 Hutvagner G, Zamore PD. Science. 2002;297: Figure 4 Elbashir, SM et al 2001 Nature 411:494 Alliance for Contraception in Cats & Dogs acc-d.org 2

3 shrna = short hairpin RNA; sirna = short interfering RNA; RISC = RNAinduced silencing complex Scherer LJ, Rossi JJ. Nat Biotechnol. 2003;21: Alliance for Contraception in Cats & Dogs acc-d.org 3

4 Systemic delivery of sirnas Getting RNAs to target cells. Example of Ewings Sarcoma target transcript. mrna derives from fusion of two genes to create novel target Hu-Lieskovan, S, et al., Cancer Research, 65:2005 EWS-FLI1 gene fusion in Ewing s Sarcoma Cyclodextrin LD 50 i.v. rat β-cd ~0.5 g/kg Methylated β -CD: no toxicity at 1 g/kg each week for 4 doses i.v.hydroxypropyl- β -CD in monkeys of 10 g/kg is not lethal Alliance for Contraception in Cats & Dogs acc-d.org 4

5 Experimental Design Xenogen Camera Lentivirus Luciferase Construct 5x10 6 Cells per mouse TfR-positive TC71 Formulated sirna NOD/SCID 6-8wk GROUPS D5W --- solution Naked EFBP2 sirna in D5W Fully formulated sicon1 in D5W Targeted EFBP2 sirna in D5W -- transferrin ligand Non-targeted EFBP2 sirna in D5W -- no transferrin MOUSE IMAGES FOR ALL TREATMENT GROUPS mg/kg Twice Weekly Injections for Four Weeks 2.5 Alliance for Contraception in Cats & Dogs acc-d.org 5

6 Summary Fully formulated CD with transferrin ligand and anti-ews-fli1 sirna effectively block tumor formation in vivo in a murine system. Potential Carrier for other sirnas and other applications. Random RNA library SELEX Aptamers Library (DNA oligos) Fixed Random Fixed 1: PCR 2: In vitro transcription Anti HIV gp120 Envelope aptamers gp41 HIV virion gp120 New RNA library 2-n SELEX round Random RNA library (2 -F modified RNAs) Individual Aptamers 1: RT-PCR 2: In vitro transcription Binding with target protein A-1 B-68 After Cycles Clone and sequence SELEX: Systematic Evolution of Ligands by EXponential enrichment Preparation of Random RNA library Selection partitioning Amplification of functional RNA Isolation of Aptamer Target protein Removal of unbound RNAs Elution and Recovery of Bound RNAs Selection partitioning Bound RNAs Methods: Membrane filters, affinity columns, beads, cells K D (nm) ±7.02 nm K D (nm) ±18.77 nm Cell type-specific delivery system: Aptamer-stick-siRNA system Delivery application of anti-gp120 aptamer Amy Yan and Andrew Ellington, A Hitchhiker s Guide to HIV, vol. 16, (2008) Zhou,. Li,. Li, J. Zara, Rossi, Molecular Ther. (2008) Zhou,et al: Nuc. Acids Research 2009 Alliance for Contraception in Cats & Dogs acc-d.org 6

7 Real-time live cells confocal microscopy Internalization in CHO-gp160 cells of Cy3-gp120 aptamer Humanized RAG-hu mouse test of anti-gp120 aptamer-sirna chimeras Movie (10 min to 6 h) Chimeras A-1 Rag2-/-gamma c-/- mouse HIV NL4-3 infection 3 weeks 4 infection th week Naked sirna injection injection 5 th week 6 th week 7 th week 8 th week 1 th week infection Untreated 10 min CHO-EE control + Cy3-labled Chimeras A-1 2 h 3 h 4 h 5 h The humanized Rag2-/-gc-/- mice (RAG-hu) engrafted with CD34 hematopoietic progenitor cells were infected with HIV-1 NL4.3 virus intraperitonially. One injection of 10 µg experimental RNA per week. 5 th week sample for sirna and Tat/rev detection 1-9 weeks samples for viral loading test monitored by real-time PCR. : Treatment start-stop Identify specific receptor on target cells/ tissue of interest Select aptamer using purified receptor or cell based selection. Use aptamer to deliver sirna(cocktail) to trigger apoptosis of target cells/tissues. Alliance for Contraception in Cats & Dogs acc-d.org 7

RNAi Shooting the Messenger!

RNAi Shooting the Messenger! RNAi Shooting the Messenger! Bronya Keats, Ph.D. Department of Genetics Louisiana State University Health Sciences Center New Orleans Email: bkeats@lsuhsc.edu RNA interference (RNAi) A mechanism by which

More information

Lezioni Dipartimento di Oncologia Farmacologia Molecolare. RNA interference. Giovanna Damia 29 maggio 2006

Lezioni Dipartimento di Oncologia Farmacologia Molecolare. RNA interference. Giovanna Damia 29 maggio 2006 Lezioni Dipartimento di Oncologia Farmacologia Molecolare RNA interference Giovanna Damia 29 maggio 2006 RNA INTERFERENCE Sequence-specific gene suppression by dsrnas Gene silencing by dsrna: C. elegans

More information

Dicer Substrate RNAi Design

Dicer Substrate RNAi Design INTEGRATED DNA TECHNOLOGIES, INC. Dicer Substrate RNAi Design How to design and order 27-mer Dicer-substrate Duplex RNAs for use as RNA interference reagents The following document provides a summary of

More information

Outline. interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work?

Outline. interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work? Outline Outline interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work? What is RNA interference? Recently discovered regulatory level. Genome immune system.

More information

Functional and Biomedical Aspects of Genome Research

Functional and Biomedical Aspects of Genome Research Functional and Biomedical Aspects of Genome Research 20 11 35 Vorlesung SS 04 Bartsch, Jockusch & Schmitt-John Mi. 9:15-10:00, in W7-135 13 Functional RNAs Thomas Schmitt-John micro RNAs small interfering

More information

The world of non-coding RNA. Espen Enerly

The world of non-coding RNA. Espen Enerly The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often

More information

岑 祥 股 份 有 限 公 司 技 術 專 員 費 軫 尹 20100803

岑 祥 股 份 有 限 公 司 技 術 專 員 費 軫 尹 20100803 技 術 專 員 費 軫 尹 20100803 Overview of presentation Basic Biology of RNA interference Application of sirna for gene function? How to study mirna? How to deliver sirna and mirna? New prospects on RNAi research

More information

Profiling of non-coding RNA classes Gunter Meister

Profiling of non-coding RNA classes Gunter Meister Profiling of non-coding RNA classes Gunter Meister RNA Biology Regensburg University Universitätsstrasse 31 93053 Regensburg Overview Classes of non-coding RNAs Profiling strategies Validation Protein-RNA

More information

TOOLS sirna and mirna. User guide

TOOLS sirna and mirna. User guide TOOLS sirna and mirna User guide Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas)

More information

RNAi: principle DNA RNA PROTEIN

RNAi: principle DNA RNA PROTEIN RNAi: principle RNAi DNA RNA PROTEIN Transcription (nucleus) Translation (cytoplasm) Many diseases develop from the undesirable production of specific proteins (oncogene products, mutant proteins, toxins,

More information

Interaktionen von Nukleinsäuren und Proteinen

Interaktionen von Nukleinsäuren und Proteinen Sonja Prohaska Computational EvoDevo Universitaet Leipzig June 9, 2015 DNA is never naked in a cell DNA is usually in association with proteins. In all domains of life there are small, basic chromosomal

More information

Final Review. Aptamers. Making Aptamers: SELEX 6/3/2011. sirna and mirna. Central Dogma. RNAi: A translation regulation mechanism.

Final Review. Aptamers. Making Aptamers: SELEX 6/3/2011. sirna and mirna. Central Dogma. RNAi: A translation regulation mechanism. Central Dogma Final Review Section Week 10 DNA RNA Protein DNA DNA replication DNA RNA transcription RNA Protein translation **RNA DNA reverse transcription http://bass.bio.uci.edu/~hudel/bs99a/lecture20/lecture1_1.html

More information

HOST DEFENSE AGAINST VIRUS INFECTION OF PLANTS Post transcriptional gene silencing (PTGS) or RNA interference (RNAi) represents a sequence specific

HOST DEFENSE AGAINST VIRUS INFECTION OF PLANTS Post transcriptional gene silencing (PTGS) or RNA interference (RNAi) represents a sequence specific HOST DEFENSE AGAINST VIRUS INFECTION OF PLANTS Post transcriptional gene silencing (PTGS) or RNA interference (RNAi) represents a sequence specific antiviral defense mechanism in plants. has parallels

More information

Five-year relative survival rates. Cancer. Age-adjusted cancer death rates. Proteomic Technologies for Cancer Biomarker Discovery 2010/3/22

Five-year relative survival rates. Cancer. Age-adjusted cancer death rates. Proteomic Technologies for Cancer Biomarker Discovery 2010/3/22 Cancer Five-year relative survival rates Basal lamina Underlyig tissue Normal tissue Carcinoma Invasive carcinoma 1 http://www.cancer.org/docroot/home/index.asp 2 Proteomic Technologies for Cancer Biomarker

More information

RNA-related Products

RNA-related Products RNA-related Products TranscriptME RNA kit: Ideal choice for obtaining high yields of full-length cdna for RT-qPCR assays Suitable for as low RNA amount as 10 pg p p Convenient, reliable and cost-effective

More information

RNA-related Products

RNA-related Products RNA-related Products TRANSCRIPTME RNA kit: Ideal choice for obtaining high yields of full-length cdna for RT-qPCR assays Suitable for as low RNA amount as 10 pg p p Convenient, reliable and cost-effective

More information

Micro RNAs: potentielle Biomarker für das. Blutspenderscreening

Micro RNAs: potentielle Biomarker für das. Blutspenderscreening Micro RNAs: potentielle Biomarker für das Blutspenderscreening micrornas - Background Types of RNA -Coding: messenger RNA (mrna) -Non-coding (examples): Ribosomal RNA (rrna) Transfer RNA (trna) Small nuclear

More information

RAPAd mirna Adenoviral Expression System Catalog #: VPK-253

RAPAd mirna Adenoviral Expression System Catalog #: VPK-253 DATENBLATT RAPAd mirna Adenoviral Expression System Catalog #: VPK-253 FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction MicroRNAs (mirnas) are 18 24 nucleotide RNA molecules that

More information

Comprehensive mirna Research Technologies

Comprehensive mirna Research Technologies Comprehensive mirna Research Technologies Sample & Assay Technologies QIAGEN solutions for advancing microrna research In the last few years, the identification of microrna (mirna) and the recognition

More information

sirna Duplexes & RNAi Explorer

sirna Duplexes & RNAi Explorer P r o d u c t S p e c i f i c a t i o n s Guaranteed RNAi Explorer kit with Fl/Dabcyl Molecular Beacon Catalog No.:27-6402-01 Guaranteed RNAi Explorer kit with Fluorescein/Tamra TaqMan Catalog No.:27-6402-01

More information

RNA Interference. - Localization - Labeling - Expression Profiling - In Vivo Delivery - Transfection

RNA Interference. - Localization - Labeling - Expression Profiling - In Vivo Delivery - Transfection RNA Interference - Localization - Labeling - Expression Profiling - In Vivo Delivery - Transfection Rna interference x RNAi Pathways RNA interference x Tools and Multiplexing RNAi Tools pri-mirna Application

More information

2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line

2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line i 1 INTRODUCTION 1.1 Human Hepatitis B virus (HBV) 1 1.1.1 Pathogenesis of Hepatitis B 1 1.1.2 Genome organization of HBV 3 1.1.3 Structure of HBV virion 5 1.1.4 HBV life cycle 5 1.1.5 Experimental models

More information

Recombinant DNA and Biotechnology

Recombinant DNA and Biotechnology Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study

More information

Gene Silencing Oligos (GSOs) Third Generation Antisense

Gene Silencing Oligos (GSOs) Third Generation Antisense Gene Silencing Oligos (GSOs) Third Generation Antisense Walter R. Strapps, Ph.D. Executive Director, RNA Therapeutics Idera Pharmaceuticals Cambridge, MA NASDAQ: IDRA www.iderapharma.com Idera is a leader

More information

PART 3.3: MicroRNA and Cancer

PART 3.3: MicroRNA and Cancer BIBM 2010 Tutorial: Epigenomics and Cancer PART 3.3: MicroRNA and Cancer Dec 18, 2010 Sun Kim at Indiana University Outline of Part 3.3 Background on microrna Role of microrna in cancer MicroRNA pathway

More information

Dicer-Substrate sirna Technology

Dicer-Substrate sirna Technology As featured in BioRadiations 120 Dicer-Substrate sirna Technology Advances in sirna Designs Improve Gene-Specific Silencing Steve Kulisch, Teresa Esch, Christina Whitman-Guliaev, and Teresa Rubio, Bio-Rad

More information

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh

More information

V22: involvement of micrornas in GRNs

V22: involvement of micrornas in GRNs What are micrornas? V22: involvement of micrornas in GRNs How can one identify micrornas? What is the function of micrornas? Elisa Izaurralde, MPI Tübingen Huntzinger, Izaurralde, Nat. Rev. Genet. 12,

More information

Viral Infection: Receptors

Viral Infection: Receptors Viral Infection: Receptors Receptors: Identification of receptors has come from expressing the gene for the receptor in a cell to which a virus does not normally bind -OR- By blocking virus attachment

More information

EXPRESSION ARREST shrna mir GENOME- WIDE LIBRARIES

EXPRESSION ARREST shrna mir GENOME- WIDE LIBRARIES C GUGAAG EXPRESSION ARREST shrna mir GENOME- WIDE LIBRARIES MicroRNA-adapted shrna (shrna mir ) for increased, specific and consistent knockdown. MicroRNA PROCESSING PATHWAY UTILIZED FOR shrna mir Developed

More information

mirnaselect pep-mir Cloning and Expression Vector

mirnaselect pep-mir Cloning and Expression Vector Product Data Sheet mirnaselect pep-mir Cloning and Expression Vector CATALOG NUMBER: MIR-EXP-C STORAGE: -80ºC QUANTITY: 2 vectors; each contains 100 µl of bacterial glycerol stock Components 1. mirnaselect

More information

Mir-X mirna First-Strand Synthesis Kit User Manual

Mir-X mirna First-Strand Synthesis Kit User Manual User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.

More information

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites.

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites. 1. A recombinant DNA molecules is one that is a. produced through the process of crossing over that occurs in meiosis b. constructed from DNA from different sources c. constructed from novel combinations

More information

Viruses. Viral components: Capsid. Chapter 10: Viruses. Viral components: Nucleic Acid. Viral components: Envelope

Viruses. Viral components: Capsid. Chapter 10: Viruses. Viral components: Nucleic Acid. Viral components: Envelope Viruses Chapter 10: Viruses Lecture Exam #3 Wednesday, November 22 nd (This lecture WILL be on Exam #3) Dr. Amy Rogers Office Hours: MW 9-10 AM Too small to see with a light microscope Visible with electron

More information

Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.

Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells. Transfection Key words: Transient transfection, Stable transfection, transfection methods, vector, plasmid, origin of replication, reporter gene/ protein, cloning site, promoter and enhancer, signal peptide,

More information

RNAi History, Mechanism and Application

RNAi History, Mechanism and Application DRUG DISCOVERY AND DEVELOPMENT RNAi History, Mechanism and Application Shuo Gu The History of RNAi About the author: Dr. Shuo Gu is currently a Postdoctoral Scholar at Stanford University, School of Medicine.

More information

Control of Gene Expression

Control of Gene Expression Control of Gene Expression (Learning Objectives) Explain the role of gene expression is differentiation of function of cells which leads to the emergence of different tissues, organs, and organ systems

More information

Functional RNAs; RNA catalysts, mirna,

Functional RNAs; RNA catalysts, mirna, Functional RNAs; RNA catalysts, mirna, srna, RNAi... RNAs have many functions rrna (ribosomal RNA) trna (transfer RNA) mrna (Messenger RNA) snrna (including snorna) ) (Small nuclear RNA- splicing) Other

More information

Alison Stewart 11/12/06 Prokaryotic Cells, Eukaryotic cells and HIV: Structures, Transcription and Transport Section Handout Discussion Week #7

Alison Stewart 11/12/06 Prokaryotic Cells, Eukaryotic cells and HIV: Structures, Transcription and Transport Section Handout Discussion Week #7 Alison Stewart 11/12/06 Prokaryotic Cells, Eukaryotic cells and HIV: Structures, Transcription and Transport Section Handout Discussion Week #7 Compare and contrast the organization of eukaryotic, prokaryotic

More information

Viral Replication. I. Steps in Viral Replication. Scott M. Hammer

Viral Replication. I. Steps in Viral Replication. Scott M. Hammer Scott M. Hammer Viral Replication I. Steps in Viral Replication A. Attachment. This is the first step in viral replication. Surface proteins of the virus interact with specific receptors on the target

More information

2013 W. H. Freeman and Company. 26 RNA Metabolism

2013 W. H. Freeman and Company. 26 RNA Metabolism 2013 W. H. Freeman and Company 26 RNA Metabolism CHAPTER 26 RNA Metabolism Key topics: Transcription: DNA-dependent synthesis of RNA Capping and splicing: RNA processing Overview of RNA Function Ribonucleic

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. (A) MicroRNA 212 enhances IS from pancreatic β-cells. INS-1 832/3 β-cells were transfected with precursors for mirnas 212, 375, or negative control oligonucleotides. 48 hrs after

More information

PSMA Aptamer-siRNA Chimeras: A New Path Toward Prostate Cancer Radiation Sensitization

PSMA Aptamer-siRNA Chimeras: A New Path Toward Prostate Cancer Radiation Sensitization PSMA Aptamer-siRNA Chimeras: A New Path Toward Prostate Cancer Radiation Sensitization Theodore L. DeWeese, M.D. Sidney Kimmel Professor and Chair Department of Radiation Oncology and Molecular Radiation

More information

MicroRNA Mike needs help to degrade all the mrna transcripts! Aaron Arvey ISMB 2010

MicroRNA Mike needs help to degrade all the mrna transcripts! Aaron Arvey ISMB 2010 Target mrna abundance dilutes microrna and sirna activity MicroRNA Mike needs help to degrade all the mrna transcripts! Aaron Arvey ISMB 2010 Target mrna abundance dilutes microrna and sirna activity Erik

More information

Current Topics in RNAi

Current Topics in RNAi Current Topics in RNAi Essays on current, confusing, controversial, or otherwise interesting topics in the field of RNA interference Why Rational Pooling of sirnas is SMART Mike Straka, PhD, and Queta

More information

RNAi therapeutics: Principles, prospects and challenges

RNAi therapeutics: Principles, prospects and challenges Advanced Drug Delivery Reviews 59 (2007) 75 86 www.elsevier.com/locate/addr RNAi therapeutics: Principles, prospects and challenges Lars Aagaard, John J. Rossi Division of Molecular Biology, Beckman Research

More information

Viral Replication. Viral Replication: Basic Concepts

Viral Replication. Viral Replication: Basic Concepts Viral Replication Scott M. Hammer, M.D. Viral Replication: Basic Concepts Viruses are obligate intracellular parasites Viruses carry their genome (RNA or DNA) and sometimes functional proteins required

More information

srnas of Plants Small, Non-coding RNAs of Plants microrna ( mirnas small interfering RNA ( sirnas Plant mirnas MIR

srnas of Plants Small, Non-coding RNAs of Plants microrna ( mirnas small interfering RNA ( sirnas Plant mirnas MIR srnas of Plants Small, Non-coding RNAs of Plants Regulatory RNAs that act through gene silencing Two classes of small RNAs (srnas) o microrna (mirnas) Encoded by genes in the genome o small interfering

More information

Understanding the immune response to bacterial infections

Understanding the immune response to bacterial infections Understanding the immune response to bacterial infections A Ph.D. (SCIENCE) DISSERTATION SUBMITTED TO JADAVPUR UNIVERSITY SUSHIL KUMAR PATHAK DEPARTMENT OF CHEMISTRY BOSE INSTITUTE 2008 CONTENTS Page SUMMARY

More information

Post-transcriptional control of gene expression

Post-transcriptional control of gene expression Post-transcriptional control of gene expression Possible post-transcriptional controls on gene expression Only a few of these controls are likely to be important for any one gene Mecanismo de processamento

More information

HiPerFect Transfection Reagent Handbook

HiPerFect Transfection Reagent Handbook Fifth Edition October 2010 HiPerFect Transfection Reagent Handbook For transfection of eukaryotic cells with sirna and mirna Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the

More information

First Strand cdna Synthesis

First Strand cdna Synthesis 380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

AP Biology Review Packet 4: Viruses, Bacteria and Expression & DNA Technology

AP Biology Review Packet 4: Viruses, Bacteria and Expression & DNA Technology AP Biology Review Packet 4: Viruses, Bacteria and Expression & DNA Technology 3A1- DNA, and in some cases RNA, is the primary source of heritable information. 3B1- Gene Regulation results in differential

More information

CHAPTER 40 The Mechanism of Protein Synthesis

CHAPTER 40 The Mechanism of Protein Synthesis CHAPTER 40 The Mechanism of Protein Synthesis Problems: 2,3,6,7,9,13,14,15,18,19,20 Initiation: Locating the start codon. Elongation: Reading the codons (5 3 ) and synthesizing protein amino carboxyl.

More information

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...

More information

Inducing RNAi in Mammalian Cells

Inducing RNAi in Mammalian Cells Inducing RNAi in Mammalian Cells Ambion, Inc. www.ambion.com techserv@ambion.com sirna localized to the perinuclear space View at: www.ambion.com/techlib/presentations Important Applications of RNAi Ascertain

More information

AP BIOLOGY 2009 SCORING GUIDELINES

AP BIOLOGY 2009 SCORING GUIDELINES AP BIOLOGY 2009 SCORING GUIDELINES Question 4 The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following

More information

RNA Structure and folding

RNA Structure and folding RNA Structure and folding Overview: The main functional biomolecules in cells are polymers DNA, RNA and proteins For RNA and Proteins, the specific sequence of the polymer dictates its final structure

More information

OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation

OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation -Optimal strategies to a successful mirna research project Optimal strategies to a successful mirna research

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

The Small RNA World (TTPB5) Teaching Guide

The Small RNA World (TTPB5) Teaching Guide The Plant Cell, May 2013, www.plantcell.org 2013 American Society of Plant Biologists The Small RNA World (TTPB5) Teaching Guide Overview Small RNAs confer specificity to a set of pathways collectively

More information

Guidance. 2. Definitions. 1. Introduction

Guidance. 2. Definitions. 1. Introduction Work with naked DNA or RNA (including oligonucleotides, sirna, mirna, sequences that code for highly biologically active molecules and full length viral genomes) Guidance 1. Introduction The following

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information

BLOOD SAMPLE PREPARATION

BLOOD SAMPLE PREPARATION BLOOD SAMPLE PREPARATION The New Standard in RNA Purification, Best-in-Class, Pure & Simple Purification of inhibitor-free RNA, microrna and genomic DNA for any application An ISO 13485:2003, ISO 9001:2008

More information

IMMUNOLOGY OF HIV INFECTION AND AIDS. Interactions between HIV and the immune system

IMMUNOLOGY OF HIV INFECTION AND AIDS. Interactions between HIV and the immune system IMMUNOLOGY OF HIV INFECTION AND AIDS Interactions between HIV and the immune system Basic Statistics United States In the U.S. in 2010, 1.1 million people were living with HIV infection. About 50,000 people

More information

Relative Quantification of mirna Target mrnas by Real-Time qpcr. 1 Introduction. Gene Expression Application Note No. 4

Relative Quantification of mirna Target mrnas by Real-Time qpcr. 1 Introduction. Gene Expression Application Note No. 4 Gene Expression Application Note No. 4 Relative Quantification of mirna Target mrnas by Real-Time qpcr Ute Ernst, Jitao David Zhang, Anja Irsigler, Stefan Wiemann, Ulrich Tschulena Division: Molecular

More information

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot Recombinant technology Gene analysis Sequencing PCR RNA Northern-blot RT PCR Protein Western-blot Sequencing Southern-blot in situ hybridization in situ hybridization Function analysis Histochemical analysis

More information

KMS-Specialist & Customized Biosimilar Service

KMS-Specialist & Customized Biosimilar Service KMS-Specialist & Customized Biosimilar Service 1. Polyclonal Antibody Development Service KMS offering a variety of Polyclonal Antibody Services to fit your research and production needs. we develop polyclonal

More information

Essentials of Real Time PCR. About Sequence Detection Chemistries

Essentials of Real Time PCR. About Sequence Detection Chemistries Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected

More information

RNA Viruses. A Practical Approac h. Alan J. Cann

RNA Viruses. A Practical Approac h. Alan J. Cann RNA Viruses A Practical Approac h Alan J. Cann List of protocols page xiii Abbreviations xvii Investigation of RNA virus genome structure 1 A j. Easton, A.C. Marriott and C.R. Pringl e 1 Introduction-the

More information

Biosafety considerations of new dsrna molecules

Biosafety considerations of new dsrna molecules Biosafety considerations of new dsrna molecules GM-free Europe Conference 2015 May 6-8 Berlin, Germany Dr. Sarah Agapito Current GMOs Plant transformed to produce new protein A G C U G G C A A U G U C

More information

The New Standard for Specific Silencing

The New Standard for Specific Silencing sirna Specific Functional Up to 90% reduction of off-target effects with premium sirna Achieve guaranteed silencing with highly potent sirna The New Standard for Specific Silencing Efficient Save time

More information

mirnaselect pegp-mir Cloning and Expression Vector

mirnaselect pegp-mir Cloning and Expression Vector Product Data Sheet mirnaselect pegp-mir Cloning and Expression Vector CATALOG NUMBER: MIR-EXP-GP-C STORAGE: -80ºC QUANTITY: 100 µl of bacterial glycerol stock Components 1. mirnaselect pegp-mir Cloning

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Chapter 9 Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Q&A Interferons are species specific, so that interferons to be used in humans must be produced in human cells. Can you think

More information

bitter is de pil Linos Vandekerckhove, MD, PhD

bitter is de pil Linos Vandekerckhove, MD, PhD 4//24 Current HIV care HIV copies/ ml plasma Viral load Welcome to the Digital droplet PCR age! bitter is de pil Linos Vandekerckhove, MD, PhD Latent HIV reservoir Time at Ghent University Hospital 2 HIV

More information

Plant RNAi mechanisms: lessons from silent transgenes. Institut Jean-Pierre Bourgin, INRA Versailles

Plant RNAi mechanisms: lessons from silent transgenes. Institut Jean-Pierre Bourgin, INRA Versailles Plant RNAi mechanisms: lessons from silent transgenes Institut Jean-Pierre Bourgin, INRA Versailles Plants encode two types of small RNAs: mirna and sirna MIR genes endoir NAT pairs TAS and PolIV loci

More information

Thermo Scientific Dharmacon sirna Libraries

Thermo Scientific Dharmacon sirna Libraries Thermo Scientific Dharmacon sirna Libraries Scientific innovation in sirna potency, specificity and delivery Superior sirna in comprehensive collections for reliable screens Market leading products for

More information

RNAi. Martin Latterich

RNAi. Martin Latterich RNAi Martin Latterich Contributors Abbreviations Preface i x ( xi xiii 1 Methods in RNA interference 1 Martin Latterich and Dalia Halawan i References 2 2 RNAi reagent design 3 Bernd Jagla and Nathalie

More information

All in One First Strand cdna Synthesis Kit For reliable first strand cdna synthesis from all RNA sources

All in One First Strand cdna Synthesis Kit For reliable first strand cdna synthesis from all RNA sources All in One First Strand cdna Synthesis Kit For reliable first strand cdna synthesis from all RNA sources Cat. No. AORT 0020 Cat. No. AORT 0050 (20 synthesis reactions) (50 synthesis reactions) User Manual

More information

All-in-One First-Strand cdna Synthesis Kit

All-in-One First-Strand cdna Synthesis Kit All-in-One First-Strand cdna Synthesis Kit For reliable first-strand cdna synthesis from all RNA sources Cat. No. AORT-0020 (20 synthesis reactions) Cat. No. AORT-0050 (50 synthesis reactions) User Manual

More information

Question 4 /29 points. Total /100 points

Question 4 /29 points. Total /100 points MIT Department of Biology 7.28, Spring 2005 - Molecular Biology 7.28 Spring 2005 Exam Three Question 1 Question 2 Question 3 /30 points /20 points /21 points Question 4 /29 points Total /100 points 1 Question

More information

Expression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu

Expression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu Expression and Purification of Recombinant Protein in bacteria and Yeast Presented By: Puspa pandey, Mohit sachdeva & Ming yu DNA Vectors Molecular carriers which carry fragments of DNA into host cell.

More information

Outline. MicroRNA Bioinformatics. microrna biogenesis. short non-coding RNAs not considered in this lecture. ! Introduction

Outline. MicroRNA Bioinformatics. microrna biogenesis. short non-coding RNAs not considered in this lecture. ! Introduction Outline MicroRNA Bioinformatics Rickard Sandberg Dept. of Cell and Molecular Biology (CMB) Karolinska Institutet! Introduction! microrna target site prediction! Useful resources 2 short non-coding RNAs

More information

Protein Expression. A Practical Approach J. HIGGIN S

Protein Expression. A Practical Approach J. HIGGIN S Protein Expression A Practical Approach S. J. HIGGIN S B. D. HAMES List of contributors Abbreviations xv Xvi i 1. Protein expression in mammalian cell s Marlies Otter-Nilsson and Tommy Nilsso n 1. Introduction

More information

In Silico Evidence of the Relationship Between mirnas and sirnas

In Silico Evidence of the Relationship Between mirnas and sirnas The Open Applied Informatics Journal, 2008, 2, 9-13 9 In Silico Evidence of the Relationship Between mirnas and sirnas L. Montanucci 1, P. Fariselli *,1, P.L. Martelli 1, I. Rossi 1,2 and R. Casadio 1

More information

CONTRACTING ORGANIZATION: University of Alabama at Birmingham Birmingham, AL 35294

CONTRACTING ORGANIZATION: University of Alabama at Birmingham Birmingham, AL 35294 AD Award Number: W81XWH-08-1-0030 TITLE: Regulation of Prostate Cancer Bone Metastasis by DKK1 PRINCIPAL INVESTIGATOR: Gregory A. Clines, M.D., Ph.D. CONTRACTING ORGANIZATION: University of Alabama at

More information

IKDT Laboratory. IKDT as Service Lab (CRO) for Molecular Diagnostics

IKDT Laboratory. IKDT as Service Lab (CRO) for Molecular Diagnostics IKDT Laboratory IKDT as Service Lab (CRO) for Molecular Diagnostics IKDT lab offer is complete diagnostic service to all external customers. We could perform as well single procedures or complex examinations

More information

Targets & Tools for anti-hiv Gene Therapy. Paula Cannon, PhD University of Southern California

Targets & Tools for anti-hiv Gene Therapy. Paula Cannon, PhD University of Southern California Targets & Tools for anti-hiv Gene Therapy Paula Cannon, PhD University of Southern California Why is HIV a good candidate for gene therapy It s an incurable, serious, life-long infection It s expensive

More information

mrna EDITING Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005

mrna EDITING Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005 mrna EDITING mrna EDITING http://dbb.urmc.rochester.edu/labs/smith/research_2.htm The number of A to I sites in the human transcriptome >15;000 the vast majority of these sites occurring in Alu repeats

More information

PreciseTM Whitepaper

PreciseTM Whitepaper Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis

More information

Chapter 6 - Virology. Structure. Size and morphology Capsid Envelope Complex Nucleic acid

Chapter 6 - Virology. Structure. Size and morphology Capsid Envelope Complex Nucleic acid Chapter 6 - Virology Topics Structure Classification Multiplication Cultivation and replication Nonviral infectious agent Teratogenic/Oncogenic - Viruses have a host range. That is, viruses infect specific

More information

micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved

micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved microrna 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions of target mrnas Act as negative

More information

Genetics Faculty of Agriculture and Veterinary Medicine

Genetics Faculty of Agriculture and Veterinary Medicine Genetics 10201232 Faculty of Agriculture and Veterinary Medicine Instructor: Dr. Jihad Abdallah Topic 15:Recombinant DNA Technology 1 Recombinant DNA Technology Recombinant DNA Technology is the use of

More information

Thermo Scientific Dharmacon ON-TARGETplus sirna The Standard for sirna Specificity

Thermo Scientific Dharmacon ON-TARGETplus sirna The Standard for sirna Specificity Thermo Scientific Dharmacon sirna The Standard for sirna Specificity Reduce off-targets up to 90% with the market-leading sirna Combine higher target specificity with guaranteed silencing Increase confidence

More information

BAY 1187982, a novel ADC with potent anti-tumor activity, targeting all isoforms of FGFR2

BAY 1187982, a novel ADC with potent anti-tumor activity, targeting all isoforms of FGFR2 BAY 1187982, a novel ADC with potent anti-tumor activity, targeting all isoforms of FGFR2 6 th World ADC, San Diego, October 20, 2015 Anette Sommer Disclosure Information I have the following financial

More information

DP419 RNAsimple Total RNA Kit. RNAprep pure Series. DP501 mircute mirna Isolation Kit. DP438 MagGene Viral DNA / RNA Kit. DP405 TRNzol Reagent

DP419 RNAsimple Total RNA Kit. RNAprep pure Series. DP501 mircute mirna Isolation Kit. DP438 MagGene Viral DNA / RNA Kit. DP405 TRNzol Reagent Overview of TIANGEN Products DP419 RNAsimple Total RNA Kit DP430 RNAprep pure Kit(For Cell/Bacteria) DP315/DP315-R TIANamp Virus DNA/RNA Kit DP431 RNAprep pure Kit (For Tissue) Silica-membrane Technology

More information

Description Wako Catalog No. Page # microrna Purification Kits based on Immunoprecipitation method using antibody against Argonaute protein

Description Wako Catalog No. Page # microrna Purification Kits based on Immunoprecipitation method using antibody against Argonaute protein Wako microrna Products Wako Pure Chemical Industries, Ltd. microrna Cloning Ago IP microrna Purification Target mrna Screening micrornas (mirnas) are endogenous RNAs, approximately 22 nucleotides in length,

More information

INSTRUCTION MANUAL riboxx FECT

INSTRUCTION MANUAL riboxx FECT INSTRUCTION MANUAL sirna, mirna, and RNA Transfection Reagent Version 1.0 CONTENTS A. DESCRIPTION 1 B. SPECIFICATIONS 1 C. PROTOCOL 2 C.1 TRANSFECTION PROTOCOL FOR ADHERENT CELLS 2 C.2 TRANSFECTION PROTOCOL

More information