Comparative genomic hybridization Because arrays are more than just a tool for expression analysis

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Comparative genomic hybridization Because arrays are more than just a tool for expression analysis"

Transcription

1 Microarray Data Analysis Workshop MedVetNet Workshop, DTU 2008 Comparative genomic hybridization Because arrays are more than just a tool for expression analysis Carsten Friis ( with several slides from H. Willenbrock) Media glna tnra GlnA TnrA C2 glnr C3 C5 C6 K GlnR C1 C4 C7

2 Outline Introduction to comparative genomic hybridization (CGH) and array CGH Data analysis approaches Breakpoint detection Loss and gain analysis Real data example: Comparative genomic profiling of bacterial strains

3 Outline Introduction to comparative genomic hybridization (CGH) and array CGH Data analysis approaches Breakpoint detection Loss and gain analysis Real data example: Comparative genomic profiling of bacterial strains

4 Comparative Genomic Hybridization Study types : Gain or loss of genetic material To find variations in the genetic material Purposes: Study of chromosomal aberrations often found in cancer and developmental abnormalities Study of variations in the baseline sequence in a microbial population (microbial comparative genomics) 4

5 Genetic Alterations and Disease A Variety of Genetic Alterations Underlie Developmental Abnormalities and Disease Inappropriate gene activation or inactivation can be caused by: Mutation Epigenetic gene silencing (e.g. addition of methyl groups) Reciprocal translocation (exchange of fragments between two nonhomologous chromosomes) Gain or loss of genetic material Any of the above may lead to an oncogene activation or to inactivation of a tumor suppressor

6 Detecting structural abnormalities Albertson and Pinkel, Human Molecular Genetics, 2003

7 Microarrays for copy number analysis BAC arrays Affymetrix SNP chip (500 K) Representational oligonucleotide microarray analysis (ROMA) Whole genome tiling arrays Own design (NimbleGen/NimbleExpress)

8 Array CGH Array CGH Maps DNA Copy Number Alterations to Positions in the Genome Test Genomic DNA Reference Genomic DNA Cot-1 DNA Gain of DNA copies in tumor Loss of DNA copies in tumor Ratio Position on Sequence

9 Structural abnormalities * *HSR: homogeneously staining region Albertson and Pinkel, Human Molecular Genetics, 2003

10 Advantages over Expression Arrays Hybridization of DNA to microarray (DNA is much more stable) Little normalization is necessary Use of spatial coherence in the analysis Only 1 sample is necessary to draw conclusions it is still necessary with biological replicates to be able to draw general conclusions regarding a certain biological subtype Results may be easier interpretable and correlated with sample phenotypes e.g. loss of oncogene repressor -> certain cancer subtype

11 Outline Introduction to comparative genomic hybridization (CGH) and array CGH Data analysis approaches Breakpoint detection Loss and gain analysis Real data example: Comparative genomic profiling of bacterial strains

12 Analysis of array CGH Goal: To partition the clones into sets with the same copy number and to characterize the genomic segments in terms of copy number. Biological model: genomic rearrangements lead to gains or losses Sizable contiguous parts of the genome, possibly spanning entire chromosomes Or, alternatively, to focal high-level amplifications

13 Copy Number Profiles of a Tumor

14 Varying genomic complexity Breakpoints

15 Observed clone value and spatial coherence Useful to make use of the physical dependence of the nearby clones, which translates into copy number dependence N(-.3,.08^2) N(.6,.1^2)??

16 Expected log 2 ratio A function of copy number change, normal cell contamination and ploidy Reference ploidy= % Reference ploidy=3 50% %

17 Simulation of Array CGH Data Real biological variation considered: Breast cancer data used as model data Segment length and copy number is taken from the empirical distribution observed in breast cancer data (DNAcopy segmentation). Mixture of cells (sample is not pure) Each sample was assigned a value, P t : proportion of tumor cells, between 0.3 and 0.7 from a uniform distribution. Experimental noise is Gaussian Standard deviations drawn from a uniform distribution between 0.1 and 0.2 to imitate real data where the noise may vary between experiments. Cancer subtypes are heterogeneous Certain aberrations characteristic for a cancer subtype may only exist in a percentage of the patients with that cancer subtype. Thus, in each sample, segments with copy number alterations (copy number not 2) was removed at random with probability 30%. Willenbrock and Fridlyand; Bioinformatics 2005

18 Comparison Scheme Use of simulated data, where the truth is known and the noise is controlled True breakpoint false predicted breakpoint

19 Methods for Segmentation HMM: Hidden Markov Model (acgh package) Fit HMMs in which any state is reachable from any other state (Fridlyand et al, JMVA, 2004). CBS: Circular binary segmentation (DNAcopy package) Tertiary splits of the chromosomes into contiguous regions of equal copy number and assesses significance of the proposed splits by using a permutation reference distribution (Olshen et al, Biostatistics, 2004). GLAD: Gain and Loss Analysis of DNA (GLAD package) Detects chromosomal breakpoints by estimating a piecewise constant function that is based on adaptive weights smoothing (Hupe et al, Bioinformatics, 2004). Willenbrock and Fridlyand; Bioinformatics 2005

20 Breakpoint Detection Accuracy

21 Conclusions so far Signal2noise: CBS consistently the best performance HMM has the highest FDR GLAD is least sensitive

22 Outline Introduction to comparative genomic hybridization (CGH) and array CGH Data analysis approaches Breakpoint detection Loss and gain analysis Application of segmentation to testing Real data example: Comparative genomic profiling of bacterial strains

23 Merging segments Note: that all procedures operate on individual chromosomes, therefore resulting in a large number of segments with mean values close to each other Additional Challenge: reduce number of segments by merging the ones that are likely to correspond to the same copy number This will facilitate inference of altered regions

24 Merging For estimating actual copy number levels from segmentations

25 Segmentation and Merging

26 ROC Curves Identification of copy number alterations for varying thresholds

27 Using segmentation for testing (phenotype association studies) Case: Find clones (or whole segments) that are significantly differing in copy number between two cancer subtypes. Task: Investigate whether incorporating spatial information (segmentation) into testing for differential copy number increases detection power. Data type: Samples with either of 2 different phenotypes (e.g. 2 different cancer subtypes) How: Comparison of sensitivity and specificity using: 1. Original test statistic (no use of spatial information) 2. Segmented T-statistic derived from original log 2 ratios 3. T-statistic computed from segmented log 2 ratios 27

28 Testing samples (original values) Red: True different clones 28

29 Correction for multiple testing? standard p-value cutoff for alpha=0.05 => Many false positives 29

30 The maxt Multiple Testing Correction By repeating random class assigningment and testing, e.g. 100 times, the following permutation reference distribution of maximum absolute test statistic is obtained (maxt distribution): We wish to control the family wise error rate (FWER) at alpha=0.05 (5% chance of 1 false positive). Therefore, the cut-off should be such that only in 5% of the random cases, we will get one false positive (95 percentile): cutoff = 5 standard significance threshold MaxT multiple testing corrected threshold 30

31 Testing samples (original values) maxt p- value cutoff for alpha = 0.05 standard p-value cutoff for alpha=

32 Testing: Segmenting test statistics Reference 32

33 Testing segmented samples Segmentation of individual samples... 33

34 Testing segmented samples Reference 2. T-statistic from segmented individual samples... 34

35 Detecting regions with differential copy number Willenbrock and Fridlyand. Bioinformatics 2005; 21(22):

36 Outline Introduction to comparative genomic hybridization (CGH) and array CGH Data analysis approaches Breakpoint detection Loss and gain analysis Real data example: Comparative genomic profiling of bacterial strains

37 Real Data Example: Comparative genomic profiling of several Escherichia coli strains The microarray design included probes for: 7 known E. coli strains 39 known E. coli bacteriophages 104 known E. coli virulence genes Experimentally: 2 sequenced control strains (W3110 and EDL933), 3 replicates 2 non-sequenced strains (D1 and 3538), 3 replicates Bacteriophage: φ3538 (Δstx2::cat), 2 replicates Willenbrock et al.; J. Bacteriology

38 Comparative Genomic Profiling: Challenges Ratio problems: some genes might be present on query strain but not on the known reference strain Single channel microarrays or dual channel microarrays? In this case, we used an Affymetrix single channel custommade array (NimbleExpress) Partly present genes versus similar but distinct genes 38

39 The 7 E. coli strains included on the microarray Very high similarity between the two K-12 strains and between the two O157:H7 strains. Percentage of homologues for E. coli genomes in columns found in E. coli genomes in rows. Willenbrock et al. Journal of Bacteriology Nov;188(22):

40 BLAST Atlas Willenbrock et al. Journal of Bacteriology Nov;188(22):

41 Hybridization Atlases Probe hybridizations for experiments (samples) result in a similar pattern as expected from the BLAST atlas Willenbrock et al. Journal of Bacteriology Nov;188(22):

42 Mapping the phage Φ3538 (Δstx2::cat) Willenbrock et al. Journal of Bacteriology Nov;188(22):

43 Zoom of phage Φ3538 (Δstx2::cat) The hybridization pattern is very similar for the phage, strain 3538 and strain D1 Willenbrock et al. Journal of Bacteriology Nov;188(22):

44 Hierarchical Cluster Analysis D1 is very similar to the K-12 type strains (W MG1655) K-12

45 E. coli virulence genes D1 is probably still a commensal strain An organism participating in a symbiotic relationship from which it benefits while the other is unaffected Willenbrock et al. Journal of Bacteriology Nov;188(22):

46 Summary Comparative genomic profiling of two E. coli strains 0175:H16 D1 0157:H Identification of virulence genes and phage elements Conclusions: D1 is similar to the K-12 type strains Characterization of D1 and 3538 genes: Identification of a number of genes involved in DNA transfer and recombination 46

47 Summary Numerous methods have been introduced for segmentation of DNA copy number data and breakpoint identification. Important to benchmark against existing methods (however, only feasible if the software is publicly available) Currently, CBS (DNAcopy package) has the best overall performance Merging of segmentation results improves copy number phenotype characterization Study types: Study of copy number in cancer samples Comparison of bacterial strains Etc.

Microarray Data Analysis Workshop. Custom arrays and Probe design Probe design in a pangenomic world. Carsten Friis. MedVetNet Workshop, DTU 2008

Microarray Data Analysis Workshop. Custom arrays and Probe design Probe design in a pangenomic world. Carsten Friis. MedVetNet Workshop, DTU 2008 Microarray Data Analysis Workshop MedVetNet Workshop, DTU 2008 Custom arrays and Probe design Probe design in a pangenomic world Carsten Friis Media glna tnra GlnA TnrA C2 glnr C3 C5 C6 K GlnR C1 C4 C7

More information

SAMPLE. ik Accession Number: ik09- GD0XXXXX

SAMPLE. ik Accession Number: ik09- GD0XXXXX Patient Name: XXXXXXXXX Gender: X Date of Birth: XX/XX/XXXX Specimen Type: 10 unstained slides Submitters Name: XXXXXXXX, MD Submitters Institution: XXXXXXXX ik Accession Number: ik09- GD0XXXXX Date specimen

More information

Name Class Date. KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. frameshift mutation

Name Class Date. KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. frameshift mutation Unit 7 Study Guide Section 8.7: Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. VOCABULARY mutation point mutation frameshift mutation mutagen MAIN IDEA: Some mutations

More information

Nature of Genetic Material. Nature of Genetic Material

Nature of Genetic Material. Nature of Genetic Material Core Category Nature of Genetic Material Nature of Genetic Material Core Concepts in Genetics (in bold)/example Learning Objectives How is DNA organized? Describe the types of DNA regions that do not encode

More information

GAIA: Genomic Analysis of Important Aberrations

GAIA: Genomic Analysis of Important Aberrations GAIA: Genomic Analysis of Important Aberrations Sandro Morganella Stefano Maria Pagnotta Michele Ceccarelli Contents 1 Overview 1 2 Installation 2 3 Package Dependencies 2 4 Vega Data Description 2 4.1

More information

Core Facility Genomics

Core Facility Genomics Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray

More information

The microarray block. Outline. Microarray experiments. Microarray Technologies. Outline

The microarray block. Outline. Microarray experiments. Microarray Technologies. Outline The microarray block Bioinformatics 13-17 March 006 Microarray data analysis John Gustafsson Mathematical statistics Chalmers Lectures DNA microarray technology overview (KS) of microarray data (JG) How

More information

How to Conquer a Chromosome Abnormality What is microarray analysis?

How to Conquer a Chromosome Abnormality What is microarray analysis? University of Texas Health Science Center at San Antonio, Department of Pediatrics The Chromosome 18 Clinical Research Center Special points of interest: Microarray Analysis Agilent Technologies Microarray

More information

Microarray Data Analysis Using Partek Genomic Suite. Xiaowen Wang Field Application Specialist Partek Inc.

Microarray Data Analysis Using Partek Genomic Suite. Xiaowen Wang Field Application Specialist Partek Inc. Microarray Data Analysis Using Partek Genomic Suite Xiaowen Wang Field Application Specialist Partek Inc. Who is Partek? Founded in 1993 Building tools for statistics & visualization Focused on genomics

More information

Examples of The Cancer Genome Atlas (TCGA) Analyses in GenePool

Examples of The Cancer Genome Atlas (TCGA) Analyses in GenePool Examples of The Cancer Genome Atlas (TCGA) Analyses in 1. RNA-Seq 2. mirna-seq 3. Protein Expression 4. Somatic Mutations 5. Copy Number 6. DNA Methylation RNA-Seq All primary tumor samples (1,097 of 1,218)

More information

Basics of microarrays. Petter Mostad 2003

Basics of microarrays. Petter Mostad 2003 Basics of microarrays Petter Mostad 2003 Why microarrays? Microarrays work by hybridizing strands of DNA in a sample against complementary DNA in spots on a chip. Expression analysis measure relative amounts

More information

The Database of Genomic Variants User Tutorial Updated, June 2013

The Database of Genomic Variants User Tutorial  Updated, June 2013 The Database of Genomic Variants User Tutorial http://dgv.tcag.ca/ Updated, June 2013 About the Database The objective of the Database of Genomic Variants is to provide a comprehensive summary of structural

More information

Multiple testing with gene expression array data

Multiple testing with gene expression array data Multiple testing with gene expression array data Anja von Heydebreck Max Planck Institute for Molecular Genetics, Dept. Computational Molecular Biology, Berlin, Germany heydebre@molgen.mpg.de Slides partly

More information

Statistical Methods and Software for the Analysis of Microarray Experiments

Statistical Methods and Software for the Analysis of Microarray Experiments Statistical Methods and Software for the Analysis of Microarray Experiments www.stat.berkeley.edu/~sandrine/docs/talks/mbi04/mbi.html Nicholas P. Jewell and Sandrine Dudoit Division of Biostatistics, UC

More information

Molecular and cytogenetic analysis of cervical and vulvar cancer

Molecular and cytogenetic analysis of cervical and vulvar cancer Title Molecular and cytogenetic analysis of cervical and vulvar cancer Advisor(s) Ngan, HYS Author(s) Huang, Fung-yu.; 黃鳳如 Citation Huang, F. [ 黃鳳如 ]. (2002). Molecular and cytogenetic analysis of cervical

More information

Analysis of gene expression data. Ulf Leser and Philippe Thomas

Analysis of gene expression data. Ulf Leser and Philippe Thomas Analysis of gene expression data Ulf Leser and Philippe Thomas This Lecture Protein synthesis Microarray Idea Technologies Applications Problems Quality control Normalization Analysis next week! Ulf Leser:

More information

Systems Biology: A Personal View XV. Network Medicine. Sitabhra Sinha IMSc Chennai

Systems Biology: A Personal View XV. Network Medicine. Sitabhra Sinha IMSc Chennai Systems Biology: A Personal View XV. Network Medicine Sitabhra Sinha IMSc Chennai Diseases, Genes and Networks http://learn.genetics.utah.edu/ Now that we have the ability to sequence entire genomes, can

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

Molecular typing of VTEC: from PFGE to NGS-based phylogeny

Molecular typing of VTEC: from PFGE to NGS-based phylogeny Molecular typing of VTEC: from PFGE to NGS-based phylogeny Valeria Michelacci 10th Annual Workshop of the National Reference Laboratories for E. coli in the EU Rome, November 5 th 2015 Molecular typing

More information

Gene Expression Analysis

Gene Expression Analysis Gene Expression Analysis Jie Peng Department of Statistics University of California, Davis May 2012 RNA expression technologies High-throughput technologies to measure the expression levels of thousands

More information

PREDA S4-classes. Francesco Ferrari October 13, 2015

PREDA S4-classes. Francesco Ferrari October 13, 2015 PREDA S4-classes Francesco Ferrari October 13, 2015 Abstract This document provides a description of custom S4 classes used to manage data structures for PREDA: an R package for Position RElated Data Analysis.

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Biotechnology and reporter genes Here, a lentivirus is used to carry foreign DNA into chickens. A reporter gene (GFP)indicates that foreign DNA has been successfully transferred. Recombinant DNA continued

More information

Molecular Genetics: Challenges for Statistical Practice. J.K. Lindsey

Molecular Genetics: Challenges for Statistical Practice. J.K. Lindsey Molecular Genetics: Challenges for Statistical Practice J.K. Lindsey 1. What is a Microarray? 2. Design Questions 3. Modelling Questions 4. Longitudinal Data 5. Conclusions 1. What is a microarray? A microarray

More information

Chapter 12 - DNA Technology

Chapter 12 - DNA Technology Bio 100 DNA Technology 1 Chapter 12 - DNA Technology Among bacteria, there are 3 mechanisms for transferring genes from one cell to another cell: transformation, transduction, and conjugation 1. Transformation

More information

Abnormalities of Chromosome Structure

Abnormalities of Chromosome Structure Abnormalities of Chromosome Structure Structural rearrangements result from chromosome breakage, followed by reconstitution in an abnormal combination. Whereas rearrangements can take place in many ways,

More information

The following chapter is called "Preimplantation Genetic Diagnosis (PGD)".

The following chapter is called Preimplantation Genetic Diagnosis (PGD). Slide 1 Welcome to chapter 9. The following chapter is called "Preimplantation Genetic Diagnosis (PGD)". The author is Dr. Maria Lalioti. Slide 2 The learning objectives of this chapter are: To learn the

More information

Tools and Techniques. Chapter 10. Genetic Engineering. Restriction endonuclease. 1. Enzymes

Tools and Techniques. Chapter 10. Genetic Engineering. Restriction endonuclease. 1. Enzymes Chapter 10. Genetic Engineering Tools and Techniques 1. Enzymes 2. 3. Nucleic acid hybridization 4. Synthesizing DNA 5. Polymerase Chain Reaction 1 2 1. Enzymes Restriction endonuclease Ligase Reverse

More information

Biotechnology Test Test

Biotechnology Test Test Log In Sign Up Biotechnology Test Test 15 Matching Questions Regenerate Test 1. Plasmid 2. PCR Process 3. humulin 4. pluripotent 5. polymerase chain reaction (PCR) a b Is much smaller than the human genome,

More information

Testing: is my coin fair?

Testing: is my coin fair? Testing: is my coin fair? Formally: we want to make some inference about P(head) Try it: toss coin several times (say 7 times) Assume that it is fair ( P(head)= ), and see if this assumption is compatible

More information

CHROMOSOMES Dr. Fern Tsien, Dept. of Genetics, LSUHSC, NO, LA

CHROMOSOMES Dr. Fern Tsien, Dept. of Genetics, LSUHSC, NO, LA CHROMOSOMES Dr. Fern Tsien, Dept. of Genetics, LSUHSC, NO, LA Cytogenetics is the study of chromosomes and their structure, inheritance, and abnormalities. Chromosome abnormalities occur in approximately:

More information

An unsupervised fuzzy ensemble algorithmic scheme for gene expression data analysis

An unsupervised fuzzy ensemble algorithmic scheme for gene expression data analysis An unsupervised fuzzy ensemble algorithmic scheme for gene expression data analysis Roberto Avogadri 1, Giorgio Valentini 1 1 DSI, Dipartimento di Scienze dell Informazione, Università degli Studi di Milano,Via

More information

Chapter 10: Genetics of Viruses

Chapter 10: Genetics of Viruses Chapter 10: Genetics of Viruses Student Learning Objectives Upon completion of this chapter you should be able to: 1. Understand the structure and genomic composition of viruses. 2. Distinguish between

More information

Course on Microarray Gene Expression Analysis

Course on Microarray Gene Expression Analysis Course on Microarray Gene Expression Analysis ::: Differential Expression Analysis Daniel Rico drico@cnio.es Bioinformatics Unit CNIO Upregulation or No Change Downregulation Image analysis comparison

More information

Personalized Predictive Medicine and Genomic Clinical Trials

Personalized Predictive Medicine and Genomic Clinical Trials Personalized Predictive Medicine and Genomic Clinical Trials Richard Simon, D.Sc. Chief, Biometric Research Branch National Cancer Institute http://brb.nci.nih.gov brb.nci.nih.gov Powerpoint presentations

More information

Web-based Gene Expression Handling with the Genetic Data Warehouse

Web-based Gene Expression Handling with the Genetic Data Warehouse Web-based Gene Expression Handling with the Genetic Data Warehouse Jörg Lange, Toralf Kirsten Microarray-Workshop, June 2006 Outline Requirements for Gene Expression Analyses Intensity values MIAME Genetic

More information

AP Biology Review Packet 4: Viruses, Bacteria and Expression & DNA Technology

AP Biology Review Packet 4: Viruses, Bacteria and Expression & DNA Technology AP Biology Review Packet 4: Viruses, Bacteria and Expression & DNA Technology 3A1- DNA, and in some cases RNA, is the primary source of heritable information. 3B1- Gene Regulation results in differential

More information

Vectors cont.. Pattern of Infection. Lytic cycle. Pattern of Infection. Question. Dr. Dinithi Peiris Dept. of Zoology

Vectors cont.. Pattern of Infection. Lytic cycle. Pattern of Infection. Question. Dr. Dinithi Peiris Dept. of Zoology Vectors cont.. Dr. Dinithi Peiris Dept. of Zoology 1 2 Pattern of Infection Lytic cycle 3 Pattern of Infection 4 Question What is the unique feature in this life cycle Phages causes lysis & cell death

More information

restriction enzymes 350 Home R. Ward: Spring 2001

restriction enzymes 350 Home R. Ward: Spring 2001 restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually

More information

Chapter 10 Manipulating Genes

Chapter 10 Manipulating Genes How DNA Molecules Are Analyzed Chapter 10 Manipulating Genes Until the development of recombinant DNA techniques, crucial clues for understanding how cell works remained lock in the genome. Important advances

More information

Lecture 5. GENETICS OF PROKARYOTES

Lecture 5. GENETICS OF PROKARYOTES Lecture 5. GENETICS OF PROKARYOTES 1. Basic concepts 2. The prokaryotic genome 3. The pan-genome 4. Genetic interchange and recombination 4.1. Recombination 4.2. Transformation 4.3. Conjugation 4.4. Transduction

More information

Plasmid Isolation. Prepared by Latifa Aljebali Office: Building 5, 3 rd floor, 5T250

Plasmid Isolation. Prepared by Latifa Aljebali Office: Building 5, 3 rd floor, 5T250 Plasmid Isolation Prepared by Latifa Aljebali Office: Building 5, 3 rd floor, 5T250 Plasmid Plasmids are small, double strand, closed circular DNA molecules. Isolated from bacterial cells. Replicate independently

More information

LESSON 3.5 WORKBOOK. How do cancer cells evolve? Workbook Lesson 3.5

LESSON 3.5 WORKBOOK. How do cancer cells evolve? Workbook Lesson 3.5 LESSON 3.5 WORKBOOK How do cancer cells evolve? In this unit we have learned how normal cells can be transformed so that they stop behaving as part of a tissue community and become unresponsive to regulation.

More information

DNA Microarray Analysis

DNA Microarray Analysis DNA Microarray Analysis Course #27612 5-23 January 2009 DTU Center for Biological Sequence analysis (CBS) Teachers of the course [last year] Data pre-processing Statistics Dimension Reduction Programming

More information

Fact Sheet 14 EPIGENETICS

Fact Sheet 14 EPIGENETICS This fact sheet describes epigenetics which refers to factors that can influence the way our genes are expressed in the cells of our body. In summary Epigenetics is a phenomenon that affects the way cells

More information

0BComparativeMarkerSelection Documentation

0BComparativeMarkerSelection Documentation 0BComparativeMarkerSelection Documentation Description: Author: Computes significance values for features using several metrics, including FDR(BH), Q Value, FWER, Feature-Specific P-Value, and Bonferroni.

More information

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur

More information

Recombinant DNA and Biotechnology

Recombinant DNA and Biotechnology Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study

More information

Segmentation of 2D Gel Electrophoresis Spots Using a Markov Random Field

Segmentation of 2D Gel Electrophoresis Spots Using a Markov Random Field Segmentation of 2D Gel Electrophoresis Spots Using a Markov Random Field Christopher S. Hoeflich and Jason J. Corso csh7@cse.buffalo.edu, jcorso@cse.buffalo.edu Computer Science and Engineering University

More information

Hierarchical Bayesian Modeling of the HIV Response to Therapy

Hierarchical Bayesian Modeling of the HIV Response to Therapy Hierarchical Bayesian Modeling of the HIV Response to Therapy Shane T. Jensen Department of Statistics, The Wharton School, University of Pennsylvania March 23, 2010 Joint Work with Alex Braunstein and

More information

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1 CAP 5510-8 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Genomic Mapping & Mapping Databases High resolution, genome-wide maps of DNA markers. Integrated maps, genome catalogs and comprehensive

More information

RT 2 Profiler PCR Array: Web-Based Data Analysis Tutorial

RT 2 Profiler PCR Array: Web-Based Data Analysis Tutorial RT 2 Profiler PCR Array: Web-Based Data Analysis Tutorial Samuel J. Rulli, Jr., Ph.D. qpcr-applications Scientist Samuel.Rulli@QIAGEN.com Pathway Focused Research from Sample Prep to Data Analysis! -2-

More information

Simplifying Data Interpretation with Nexus Copy Number

Simplifying Data Interpretation with Nexus Copy Number Simplifying Data Interpretation with Nexus Copy Number A WHITE PAPER FROM BIODISCOVERY, INC. Rapid technological advancements, such as high-density acgh and SNP arrays as well as next-generation sequencing

More information

Experimental Design Part I

Experimental Design Part I Experimental Design Part I Yi-Ju Li, Ph.D. Department of Biostatistics & Bioinformatics Duke University Medical Center July 13, 2015 Outline Definition of DOE 7/13 (Monday) Part I Definition of Design

More information

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS

More information

Arabidopsis. A Practical Approach. Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham

Arabidopsis. A Practical Approach. Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham Arabidopsis A Practical Approach Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham OXPORD UNIVERSITY PRESS List of Contributors Abbreviations xv xvu

More information

micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved

micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved microrna 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions of target mrnas Act as negative

More information

Microarray Technology

Microarray Technology Microarrays And Functional Genomics CPSC265 Matt Hudson Microarray Technology Relatively young technology Usually used like a Northern blot can determine the amount of mrna for a particular gene Except

More information

Analysis of Illumina Gene Expression Microarray Data

Analysis of Illumina Gene Expression Microarray Data Analysis of Illumina Gene Expression Microarray Data Asta Laiho, Msc. Tech. Bioinformatics research engineer The Finnish DNA Microarray Centre Turku Centre for Biotechnology, Finland The Finnish DNA Microarray

More information

Vaxign Reverse Vaccinology Software Demo Introduction Zhuoshuang Allen Xiang, Yongqun Oliver He

Vaxign Reverse Vaccinology Software Demo Introduction Zhuoshuang Allen Xiang, Yongqun Oliver He Vaxign Reverse Vaccinology Software Demo Introduction Zhuoshuang Allen Xiang, Yongqun Oliver He Unit for Laboratory Animal Medicine Department of Microbiology and Immunology Center for Computational Medicine

More information

Dr Philippe Guardiola Plateforme SNP, Transcriptome & Epigénomique Service des Maladies du Sang Centre Hospitalier Universitaire

Dr Philippe Guardiola Plateforme SNP, Transcriptome & Epigénomique Service des Maladies du Sang Centre Hospitalier Universitaire Dr Philippe Guardiola (Phguardiol@aol.com) Plateforme SNP, Transcriptome & Epigénomique Service des Maladies du Sang Centre Hospitalier Universitaire Angers France Granulocytes Or Neutrophils Cell Differentiation

More information

Cloning vectors. E. coli Yeast Plants Insects

Cloning vectors. E. coli Yeast Plants Insects Cloning vectors E. coli Yeast Plants Insects Cloning vectors for E. coli The simplest cloning vectors are based on small bacterial plasmids Desirable properties: -Easy purification -High transformation

More information

A very brief introduction to genetic algorithms

A very brief introduction to genetic algorithms A very brief introduction to genetic algorithms Radoslav Harman Design of experiments seminar FACULTY OF MATHEMATICS, PHYSICS AND INFORMATICS COMENIUS UNIVERSITY IN BRATISLAVA 25.2.2013 Optimization problems:

More information

Cancer Biostatistics Workshop Science of Doing Science - Biostatistics

Cancer Biostatistics Workshop Science of Doing Science - Biostatistics Cancer Biostatistics Workshop Science of Doing Science - Biostatistics Yu Shyr, PhD Jan. 18, 2008 Cancer Biostatistics Center Vanderbilt-Ingram Cancer Center Yu.Shyr@vanderbilt.edu Aims Cancer Biostatistics

More information

The Human Genome Project

The Human Genome Project The Human Genome Project Brief History of the Human Genome Project Physical Chromosome Maps Genetic (or Linkage) Maps DNA Markers Sequencing and Annotating Genomic DNA What Have We learned from the HGP?

More information

Package empiricalfdr.deseq2

Package empiricalfdr.deseq2 Type Package Package empiricalfdr.deseq2 May 27, 2015 Title Simulation-Based False Discovery Rate in RNA-Seq Version 1.0.3 Date 2015-05-26 Author Mikhail V. Matz Maintainer Mikhail V. Matz

More information

Gene Enrichment Analysis

Gene Enrichment Analysis a Analysis of DNA Chips and Gene Networks Spring Semester, 2009 Lecture 14a: January 21, 2010 Lecturer: Ron Shamir Scribe: Roye Rozov Gene Enrichment Analysis 14.1 Introduction This lecture introduces

More information

Microarray Data Analysis. Statistical methods to detect differentially expressed genes

Microarray Data Analysis. Statistical methods to detect differentially expressed genes Microarray Data Analysis Statistical methods to detect differentially expressed genes Outline The class comparison problem Statistical tests Calculation of p-values Permutations tests The volcano plot

More information

Exploratory data analysis for microarray data

Exploratory data analysis for microarray data Eploratory data analysis for microarray data Anja von Heydebreck Ma Planck Institute for Molecular Genetics, Dept. Computational Molecular Biology, Berlin, Germany heydebre@molgen.mpg.de Visualization

More information

Array Comparative Genomic Hybridisation (CGH)

Array Comparative Genomic Hybridisation (CGH) Array Comparative Genomic Hybridisation (CGH) Exceptional healthcare, personally delivered What is array CGH? Array CGH is a new test that is now offered to all patients referred with learning disability

More information

NATIONAL GENETICS REFERENCE LABORATORY (Manchester)

NATIONAL GENETICS REFERENCE LABORATORY (Manchester) NATIONAL GENETICS REFERENCE LABORATORY (Manchester) MLPA analysis spreadsheets User Guide (updated October 2006) INTRODUCTION These spreadsheets are designed to assist with MLPA analysis using the kits

More information

DEPARTMENT OF MICROBIOLOGY AND IMMUNOLOGY

DEPARTMENT OF MICROBIOLOGY AND IMMUNOLOGY DEPARTMENT OF MICROBIOLOGY AND IMMUNOLOGY Seminar The purpose of this course is to train students the skills of oral presentation about how to deliver seminar in an efficient way. For each talk, a professor

More information

How to Conquer a Chromosome Abnormality How is the chromosome analysis that diagnosed my child different from the research study molecular analysis?

How to Conquer a Chromosome Abnormality How is the chromosome analysis that diagnosed my child different from the research study molecular analysis? How is the chromosome analysis that diagnosed my child different from the research study University of Texas Health Science Center at San Antonio, School of Medicine The Chromosome 18 Clinical Research

More information

BIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16

BIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16 Course Director: Dr. Barry Grant (DCM&B, bjgrant@med.umich.edu) Description: This is a three module course covering (1) Foundations of Bioinformatics, (2) Statistics in Bioinformatics, and (3) Systems

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter

More information

Human Genome Organization: An Update. Genome Organization: An Update

Human Genome Organization: An Update. Genome Organization: An Update Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion

More information

Gene expression analysis. Ulf Leser and Karin Zimmermann

Gene expression analysis. Ulf Leser and Karin Zimmermann Gene expression analysis Ulf Leser and Karin Zimmermann Ulf Leser: Bioinformatics, Wintersemester 2010/2011 1 Last lecture What are microarrays? - Biomolecular devices measuring the transcriptome of a

More information

Biotechnology and Recombinant DNA

Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Recombinant DNA procedures - an overview Biotechnology: The use of microorganisms, cells, or cell components to make a product. Foods, antibiotics, vitamins, enzymes Recombinant

More information

Overview of Genetic Testing and Screening

Overview of Genetic Testing and Screening Integrating Genetics into Your Practice Webinar Series Overview of Genetic Testing and Screening Genetic testing is an important tool in the screening and diagnosis of many conditions. New technology is

More information

Tutorial for proteome data analysis using the Perseus software platform

Tutorial for proteome data analysis using the Perseus software platform Tutorial for proteome data analysis using the Perseus software platform Laboratory of Mass Spectrometry, LNBio, CNPEM Tutorial version 1.0, January 2014. Note: This tutorial was written based on the information

More information

BOR-Papers in Press. Published as DOI: /biolreprod

BOR-Papers in Press. Published as DOI: /biolreprod Supplemental Data Legends Supplemental Table S1. Entrez gene symbol, Affymetrix probe ID, gene description, P value and fold change differences for differentially expressed genes (DEGs) in the endometrium

More information

NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document.

NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document. Chapter 8 Study Guide What is the study of genetics, and what topics does it focus on? What is a genome? NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document. Describe

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

Chapter 21 Active Reading Guide The Evolution of Populations

Chapter 21 Active Reading Guide The Evolution of Populations Name: Roksana Korbi AP Biology Chapter 21 Active Reading Guide The Evolution of Populations This chapter begins with the idea that we focused on as we closed Chapter 19: Individuals do not evolve! Populations

More information

The genetic screening of preimplantation embryos by comparative genomic hybridisation

The genetic screening of preimplantation embryos by comparative genomic hybridisation Vol. 11, Suppl. 3 51 The genetic screening of preimplantation embryos by comparative genomic hybridisation Maria V Traversa 1, James Marshall, Steven McArthur, Don Leigh Genea, Sydney, Australia Received:

More information

TECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298

TECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298 DIAGNOSTICS BUSINESS ANALYSIS SERIES: TECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298 By ADAMS BUSINESS ASSOCIATES MAY 2014. May 2014 ABA 298 1 Technologies, Products & Services

More information

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes.

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology has had-and will havemany important

More information

European Medicines Agency

European Medicines Agency European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein

More information

Current Motif Discovery Tools and their Limitations

Current Motif Discovery Tools and their Limitations Current Motif Discovery Tools and their Limitations Philipp Bucher SIB / CIG Workshop 3 October 2006 Trendy Concepts and Hypotheses Transcription regulatory elements act in a context-dependent manner.

More information

Next Generation Sequencing: Technology, Mapping, and Analysis

Next Generation Sequencing: Technology, Mapping, and Analysis Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took

More information

Genomic instability in cancers and cancer predispositions. Popova Tatiana Inserm U830 Institut Curie

Genomic instability in cancers and cancer predispositions. Popova Tatiana Inserm U830 Institut Curie Genomic instability in cancers and cancer predispositions Popova Tatiana Inserm U830 Institut Curie Time-scale in a tumor genome discovery Bovery HYP Cancer genome Knudson 2 hit HYP Tumor DNA has transforming

More information

Written test: Analysis of data from high-throughput molecular biology experiments BB2490 (BIO) or DD2399 (CSC)

Written test: Analysis of data from high-throughput molecular biology experiments BB2490 (BIO) or DD2399 (CSC) Written test: Analysis of data from high-throughput molecular biology experiments BB2490 (BIO) or DD2399 (CSC) Name: Pnr: Wednesday the 18th of February, 13.00-15.00, Albanova FB52 Instructions: The test

More information

Department of Biology Sample

Department of Biology Sample Syllabus BIOTECHNOLOGY Spring 2013 Instructor: Atanu Duttaroy, Professor Tel: 202-806-5362 Email: aduttaroy@howard.edu Office: Room 336, Just Hall Teaching Assistant: Mr. Subhas Mukherjee Lecture: Room

More information

1 Chapter 11 - Chromosome Mutations

1 Chapter 11 - Chromosome Mutations 1 Chapter 11 - Chromosome Mutations Questions to be considered: 1) how are changes in chromosome number (different from haploid or diploid) defined? 2) how do changes in chromosome number occur? 3) what

More information

Microarray Data Analysis. A step by step analysis using BRB-Array Tools

Microarray Data Analysis. A step by step analysis using BRB-Array Tools Microarray Data Analysis A step by step analysis using BRB-Array Tools 1 EXAMINATION OF DIFFERENTIAL GENE EXPRESSION (1) Objective: to find genes whose expression is changed before and after chemotherapy.

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

1º Test. Maximum duration: 2h

1º Test. Maximum duration: 2h 1 Name: Nº 1º Test Maximum duration: 2h Atrazine is an herbicide widely used in agriculture, being able to persist for a long time in soils. Due to soil leaching, atrazine and its toxic derivatives are

More information

DNA Insertions and Deletions in the Human Genome. Philipp W. Messer

DNA Insertions and Deletions in the Human Genome. Philipp W. Messer DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.

More information

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold

More information

DNA METHYLATION AND THE CONCEPT OF EPIGENETICS

DNA METHYLATION AND THE CONCEPT OF EPIGENETICS DNA METHYLATION AND THE CONCEPT OF EPIGENETICS The term Epigenetics describes heritable genetic modifications that are not attributable to changes in the primary DNA sequence. Epigenetic modifications

More information

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot Recombinant technology Gene analysis Sequencing PCR RNA Northern-blot RT PCR Protein Western-blot Sequencing Southern-blot in situ hybridization in situ hybridization Function analysis Histochemical analysis

More information