Algal phylogeny - content Chapters 5 and 7
|
|
- Derick Cameron
- 7 years ago
- Views:
Transcription
1 Algal phylogeny - content Chapters 5 and 7 Some principles and expressions in phylogeny Molecular phylgeny - methods Algal phylogeny The origin of plastids
2 What is phylogeny? Phylogeny expresses relationships between organisms (or genes) Which species that share a common close ancestor (nær felles stamform) Phylogenies are hypotheses The tree of life, from Baldauf 2004.
3 Phylogenetic trees - expressions Trees with 4 taxa (e.g. species) internal nodes = ancestors root = common ancestors Terminal and internal branches = changes terminal taxa (monophyletic taxonomic groups) A diagram with branches showing which taxa that share a close common ancestor = sister groups Shows in which order they share a common ancestor with each other a=b and d=e
4 Fylogenetiske trær (in Norwegian) trær med 4 arter interne noder = stamformer rot = felles stamform terminale og interne greiner = forandringer terminale taksa (monofyletisk taksonomisk gruppe) Et diagram med forgreninger som viser hvilke taksa som deler en nær felles stamform= søstergrupper viser i hvilken rekkefølge de deler felles stamform med hverandre a=b og d=e
5 Phylogenetic reconstruction In a set of 4 species there are 15 possible trees. How can we determine which is the best? We cannot observe evolution directly or by experiments We try to reconstruct the evolution based (or inferred/avledet) from common characters by deduction (deduksjon) A. Phylogeny inferred from morphological characters in living organisms and the use of cladistic methods and parsimony B. Molecular phylogeny from molecular evidence (DNA or proteins) and statistical methods It is an advantage to use all available evidence (molecular and morphological) at phylogenetic reconstruction
6 Cladogram and phylogram Bakterie 1 Bakterie 2 Bakterie 3 Eukaryot 1 Eukaryot 2 Eukaryot 3 Eukaryot 4 Bakterie 1 Bakterie 2 Bakterie 3 Eukaryot 1 Cladograms show the order for divergence (branching order), branch length has no meaning Phylograms show the branching order, and branch length indicate the number of evolutionary events or genetic distance Eukaryot 2 Eukaryot 3 Eukaryot 4
7 Characters Only inheritable/arvelige (genetically based) characters can be used in phylogeny (are informative). Characters with different discrete states can be used, morphological and genetical. Characters should be independent Often will a set of characters point towards different phylogenies (incongruence) and then at least one character is misleading. How can we know which characters to trust?
8 Homology inherited similarity Homology: Similarity in two or more taxa in a character that was present in their common ancestor.
9 Homoplasy- not inherited similarity Homoplasy: Similarity that is not a result of inheritance from a common ancestor. The similarity has evolved independently in different lines. Ridley 2003 Homoplasies may appear by convergence or parallell evolution when the selection pressure is the same in different lines.
10 Primitiv or derived (avledet) homology A primitive homology was present in the ancestor of all species. A derived homology evolved later than a common ancestor for all species. Ridley 2003 A is primitiv or derived depending on the species composition
11 Derived homology Common derived homologies = synapomorphy (Felles avledet homologi = synapomorfi) Primitiv homologies = symplesiomorpy (Primitiv homologi = symplesiomorfi) Only derived homologies are reliable evidence for a common ancestry
12 Incongruence If we assume that only one tree is correct: When the characters support different phylogenies (incongruence) we know that at least one character is misleading (e.g. due to homoplasy or primitiv homology) Congruence = two or more characters suggest the same phylogeny
13 Only similarity in synapomorphies (shared derived homology) is evidence for a common ancestor but not symplesiomorphies (primitive homology)
14 Homoplasies (similar traits that independently have developed in different lines) are not evidence for common ancestry (opphav)
15 Molecular phylogeny and out group Based on protein or DNA sequences The unrooted tree is without an order for the branching. We root a tree with an outgroup (if the outgroup is most similar to A the root will be on the branch to A). Ridley 2003
16 Molecular phylogeny possible problems Which sequence to use? Does the region contain the information we look for (it can be to variable or too conserved)? Are there misleading characters?
17 Mutations Molecular evolution is inferred from differneces in the DNA or protein sequences caused by mutations. 1. substitutions 2. deletions 3. insertions 4. inversions
18 DNA and mutations T and C are pyrimidines A and G are purines Transversion: from purin to pyrimidin and the opposite Transition: From purin to purin and pyrimidin to pyrimidin
19 Mutations a= original sequence b= transition from C to T c= transversion from G to C d= deletion e= insertion f= inversion
20 Substitutions Substitutions in protein coding genes can be: a. synonym b. missense: change to a different AA c. nonsense: change to a stopcodon
21 Multiple hits and saturation When two species develop over time DNA will be more and more different. More than one substitutions can be behind a change. Ridley 2003 It is possible to correct for multiple hits in I and II by evolutionary models III: phylogenetic inference impossible Divergence rate decreases when the substitutions start to take place in the same positions At 75% difference thet do not become more different saturation.
22 Molecular phylogeny in the lab. PCR
23 PCR- exponential amplification of DNA
24 Sequencing
25 PCR DNAsequencing
26 An alignment (flersekvenssammenstilling) is a hypothesis on homology of bases (homologi hos baser) Thermus ruber UCCGAUGC-UAAAGA-CCGAAG=CUCAA=CUUCGG=GGGU=GCGUUGGA Th. thermophilus UCCCAUGU-GAAAGA-CCACGG=CUCAA=CCGUGG=GGGA=GCGUGGGA E.coli UCAGAUGU-GAAAUC-CCCGGG=CUCAA=CCUGGG=AACU=GCAUCUGA Ancyst.nidulans UCUGUUGU-CAAAGC-GUGGGG=CUCAA=CCUCAU=ACAG=GCAAUGGA B.subtilis UCUGAUGU-GAAAGC-CCCCGG=CUCAA=CCGGGG=AGGG=UCAUUGGA Chl.aurantiacus UCGGCGCU-GAAAGC-GCCCCG=CUUAA=CGGGGC=GAGG=CGCGCCGA match ** *** * ** ** * ** 16S (SSU) rrna sekvenser fra ulike bakterier U= uracil
27 Ribosomale RNA gener rrna has been shown to be a valuable marker in phylogeny because it is present in all organisms (some differences in prokarytes and eukaryotes), and is present in both the nucleus, chloroplasts and mitochondria. The level of variation varies within the molecule (conserved and variable regions) and between the different organelles. The selection pressure is considered to be rather similar among different orgsnisms since the function of the molecule is the same. It has been used to produce a molecular clock (best when calibrated to fossils)
28 Ribosomal DNA operon in eukaryotes
29 Molecular phylogeny Distance methods group after base similarity Parsimony chose the tree with lowest number of evolutionary events (changes) Maximum likelihood chose the most probable tre when using a model for sequence evolution. Problems may be: an uncertain alignment, a large number of possible trees, large distance and multiple hits, different substitution rates, paraloge genes, horizontal gene transfer etc. Phylogenetic trees are hypotheses! It is advised to compare independent phylogenies from different datasets (use more than one gene)
30 Monophyletic, paraphyletic, and polyphyletic groups Monophyletic= has a common ancestor that no one else shares Paraphyletic=includes monophyletic taxa, but some members in this clade are placed in other systematic groups Polyfyletisk=includes species that are more closely related to other taxa outside the group than in the group.
31 Tree of eukaryotic life by Keeling et al supergroups
32 Phylogeny of plastids
33 Chloroplasts in 7 eukaryotic algal divisions
34 Chloroplasts in 7 eukaryotic algal divisions
35 Chromalveolate hypothesis Cavalier-Smith analysis of six nuclearencoded genes for cytoplasmic proteins strong support for heterokonts + alveolates weak support for haptophytes + cryptophytes chromalveolates paraphyletic..due to horisontal gene transfer (HGT)? or not one common secondary evolutionary event? Harper et al. 2005: J. Syst. Evol. Microbiol. 55:
36 Primary and secondary endosymbiosis
37 Tertiary symbiosis in dinoflagellates
38 Endosymbiotic origin of plastids
39
40 Summary Phylogeny is a hypothesis on the relationships between organisms based on similarities in derived homologous characters Molecular phylogeny uses nucleotide or amino acid sequences or gene organisation as characters Algae are not monophyletic, but are found in all but one of the supergroups. Protists is a polyphyletic group as well.
Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.
Name: Class: Date: Chapter 17 Practice Multiple Choice Identify the choice that best completes the statement or answers the question. 1. The correct order for the levels of Linnaeus's classification system,
More informationThe Central Dogma of Molecular Biology
Vierstraete Andy (version 1.01) 1/02/2000 -Page 1 - The Central Dogma of Molecular Biology Figure 1 : The Central Dogma of molecular biology. DNA contains the complete genetic information that defines
More informationName Class Date. binomial nomenclature. MAIN IDEA: Linnaeus developed the scientific naming system still used today.
Section 1: The Linnaean System of Classification 17.1 Reading Guide KEY CONCEPT Organisms can be classified based on physical similarities. VOCABULARY taxonomy taxon binomial nomenclature genus MAIN IDEA:
More informationIntroduction to Phylogenetic Analysis
Subjects of this lecture Introduction to Phylogenetic nalysis Irit Orr 1 Introducing some of the terminology of phylogenetics. 2 Introducing some of the most commonly used methods for phylogenetic analysis.
More informationProtein Sequence Analysis - Overview -
Protein Sequence Analysis - Overview - UDEL Workshop Raja Mazumder Research Associate Professor, Department of Biochemistry and Molecular Biology Georgetown University Medical Center Topics Why do protein
More informationName Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
More informationLab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS
Lab 2/Phylogenetics/September 16, 2002 1 Read: Tudge Chapter 2 PHYLOGENETICS Objective of the Lab: To understand how DNA and protein sequence information can be used to make comparisons and assess evolutionary
More informationGenetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
More informationIntroduction to Bioinformatics AS 250.265 Laboratory Assignment 6
Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6 In the last lab, you learned how to perform basic multiple sequence alignments. While useful in themselves for determining conserved residues
More informationData for phylogenetic analysis
Data for phylogenetic analysis The data that are used to estimate the phylogeny of a set of tips are the characteristics of those tips. Therefore the success of phylogenetic inference depends in large
More informationSequence Analysis 15: lecture 5. Substitution matrices Multiple sequence alignment
Sequence Analysis 15: lecture 5 Substitution matrices Multiple sequence alignment A teacher's dilemma To understand... Multiple sequence alignment Substitution matrices Phylogenetic trees You first need
More informationWorksheet - COMPARATIVE MAPPING 1
Worksheet - COMPARATIVE MAPPING 1 The arrangement of genes and other DNA markers is compared between species in Comparative genome mapping. As early as 1915, the geneticist J.B.S Haldane reported that
More informationTheory of Evolution. A. the beginning of life B. the evolution of eukaryotes C. the evolution of archaebacteria D. the beginning of terrestrial life
Theory of Evolution 1. In 1966, American biologist Lynn Margulis proposed the theory of endosymbiosis, or the idea that mitochondria are the descendents of symbiotic, aerobic eubacteria. What does the
More informationA Step-by-Step Tutorial: Divergence Time Estimation with Approximate Likelihood Calculation Using MCMCTREE in PAML
9 June 2011 A Step-by-Step Tutorial: Divergence Time Estimation with Approximate Likelihood Calculation Using MCMCTREE in PAML by Jun Inoue, Mario dos Reis, and Ziheng Yang In this tutorial we will analyze
More informationAlgorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
More information4. Why are common names not good to use when classifying organisms? Give an example.
1. Define taxonomy. Classification of organisms 2. Who was first to classify organisms? Aristotle 3. Explain Aristotle s taxonomy of organisms. Patterns of nature: looked like 4. Why are common names not
More information1. Over the past century, several scientists around the world have made the following observations:
Evolution Keystone Review 1. Over the past century, several scientists around the world have made the following observations: New mitochondria and plastids can only be generated by old mitochondria and
More informationBio-Informatics Lectures. A Short Introduction
Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively
More informationProtein Phylogenies and Signature Sequences: A Reappraisal of Evolutionary Relationships among Archaebacteria, Eubacteria, and Eukaryotes
MICROBIOLOGY AND MOLECULAR BIOLOGY REVIEWS, Dec. 1998, p. 1435 1491 Vol. 62, No. 4 1092-2172/98/$04.00 0 Copyright 1998, American Society for Microbiology. All Rights Reserved. Protein Phylogenies and
More informationPhylogenetic Trees Made Easy
Phylogenetic Trees Made Easy A How-To Manual Fourth Edition Barry G. Hall University of Rochester, Emeritus and Bellingham Research Institute Sinauer Associates, Inc. Publishers Sunderland, Massachusetts
More informationFrom DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
More informationDNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
More informationMaximum-Likelihood Estimation of Phylogeny from DNA Sequences When Substitution Rates Differ over Sites1
Maximum-Likelihood Estimation of Phylogeny from DNA Sequences When Substitution Rates Differ over Sites1 Ziheng Yang Department of Animal Science, Beijing Agricultural University Felsenstein s maximum-likelihood
More information1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
More information17.1. The Tree of Life CHAPTER 17. Organisms can be classified based on physical similarities. Linnaean taxonomy. names.
SECTION 17.1 THE LINNAEAN SYSTEM OF CLASSIFICATION Study Guide KEY CONCEPT Organisms can be classified based on physical similarities. VOCABULARY taxonomy taxon binomial nomenclature genus MAIN IDEA: Linnaeus
More informationAP Biology Essential Knowledge Student Diagnostic
AP Biology Essential Knowledge Student Diagnostic Background The Essential Knowledge statements provided in the AP Biology Curriculum Framework are scientific claims describing phenomenon occurring in
More informationMolecular Genetics. RNA, Transcription, & Protein Synthesis
Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and
More informationMAKING AN EVOLUTIONARY TREE
Student manual MAKING AN EVOLUTIONARY TREE THEORY The relationship between different species can be derived from different information sources. The connection between species may turn out by similarities
More informationThe sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:
Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How
More informationThe Origin of Life. The Origin of Life. Reconstructing the history of life: What features define living systems?
The Origin of Life I. Introduction: What is life? II. The Primitive Earth III. Evidence of Life s Beginning on Earth A. Fossil Record: a point in time B. Requirements for Chemical and Cellular Evolution:
More informationThe Clompleat Cladist
Seminars on Science Sharks and Rays: Myth and Reality THE UNIVERSITY OF KANSAS SPECIAL PUBLICATION MUSEUM OF NATURAL HISTORY No. 19 The Clompleat Cladist A Primer of Phylogenetic Procedures E.O. WILEY
More information13.2 Ribosomes & Protein Synthesis
13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).
More informationMolecular Clocks and Tree Dating with r8s and BEAST
Integrative Biology 200B University of California, Berkeley Principals of Phylogenetics: Ecology and Evolution Spring 2011 Updated by Nick Matzke Molecular Clocks and Tree Dating with r8s and BEAST Today
More informationSystematics - BIO 615
Outline - and introduction to phylogenetic inference 1. Pre Lamarck, Pre Darwin Classification without phylogeny 2. Lamarck & Darwin to Hennig (et al.) Classification with phylogeny but without a reproducible
More informationThe Compleat Cladist. A Primer of Phylogenetic Procedures INTRODUCTION, TERMS, AND CONCEPTS
Seminars on Science: Diversity of Fishes THE UNIVERSITY OF KANSAS MUSEUM OF NATURAL HISTORY SPECIAL PUBLICATION No. 19 October 1991 The Compleat Cladist A Primer of Phylogenetic Procedures E. O. WILEY
More informationBioBoot Camp Genetics
BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before
More information2.3 Identify rrna sequences in DNA
2.3 Identify rrna sequences in DNA For identifying rrna sequences in DNA we will use rnammer, a program that implements an algorithm designed to find rrna sequences in DNA [5]. The program was made by
More informationPrinciples of Evolution - Origin of Species
Theories of Organic Evolution X Multiple Centers of Creation (de Buffon) developed the concept of "centers of creation throughout the world organisms had arisen, which other species had evolved from X
More informationRegents Biology REGENTS REVIEW: PROTEIN SYNTHESIS
Period Date REGENTS REVIEW: PROTEIN SYNTHESIS 1. The diagram at the right represents a portion of a type of organic molecule present in the cells of organisms. What will most likely happen if there is
More informationA branch-and-bound algorithm for the inference of ancestral. amino-acid sequences when the replacement rate varies among
A branch-and-bound algorithm for the inference of ancestral amino-acid sequences when the replacement rate varies among sites Tal Pupko 1,*, Itsik Pe er 2, Masami Hasegawa 1, Dan Graur 3, and Nir Friedman
More informationScottish Qualifications Authority
National Unit specification: general information Unit code: FH2G 12 Superclass: RH Publication date: March 2011 Source: Scottish Qualifications Authority Version: 01 Summary This Unit is a mandatory Unit
More informationA data management framework for the Fungal Tree of Life
Web Accessible Sequence Analysis for Biological Inference A data management framework for the Fungal Tree of Life Kauff F, Cox CJ, Lutzoni F. 2007. WASABI: An automated sequence processing system for multi-gene
More informationHorizontal Gene Transfer and Its Part in the Reorganisation of Genetics during the LUCA Epoch
Life 2013, 3, 518-523; doi:10.3390/life3040518 Editorial OPEN ACCESS life ISSN 2075-1729 www.mdpi.com/journal/life Horizontal Gene Transfer and Its Part in the Reorganisation of Genetics during the LUCA
More informationName Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
More informationRETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
More informationProtein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary
Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page
More informationGenetics Test Biology I
Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.
More informationPairwise Sequence Alignment
Pairwise Sequence Alignment carolin.kosiol@vetmeduni.ac.at SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What
More informationPROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org
BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,
More informationDNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3
DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can
More informationBayesian Phylogeny and Measures of Branch Support
Bayesian Phylogeny and Measures of Branch Support Bayesian Statistics Imagine we have a bag containing 100 dice of which we know that 90 are fair and 10 are biased. The
More informationAmino Acids and Their Properties
Amino Acids and Their Properties Recap: ss-rrna and mutations Ribosomal RNA (rrna) evolves very slowly Much slower than proteins ss-rrna is typically used So by aligning ss-rrna of one organism with that
More informationPHYLOGENETIC ANALYSIS
Bioinformatics: A Practical Guide to the Analysis of Genes and Proteins, Second Edition Andreas D. Baxevanis, B.F. Francis Ouellette Copyright 2001 John Wiley & Sons, Inc. ISBNs: 0-471-38390-2 (Hardback);
More informationPHYLOGENY AND EVOLUTION OF NEWCASTLE DISEASE VIRUS GENOTYPES
Eötvös Lóránd University Biology Doctorate School Classical and molecular genetics program Project leader: Dr. László Orosz, corresponding member of HAS PHYLOGENY AND EVOLUTION OF NEWCASTLE DISEASE VIRUS
More informationForensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
More informationAnswer: 2. Uracil. Answer: 2. hydrogen bonds. Adenine, Cytosine and Guanine are found in both RNA and DNA.
Answer: 2. Uracil Adenine, Cytosine and Guanine are found in both RNA and DNA. Thymine is found only in DNA; Uracil takes its (Thymine) place in RNA molecules. Answer: 2. hydrogen bonds The complementary
More informationMs. Campbell Protein Synthesis Practice Questions Regents L.E.
Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide
More informationKEY CONCEPT Organisms can be classified based on physical similarities. binomial nomenclature
Section 17.1: The Linnaean System of Classification Unit 9 Study Guide KEY CONCEPT Organisms can be classified based on physical similarities. VOCABULARY taxonomy taxon binomial nomenclature genus MAIN
More informationGenetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
More informationCampbell Biology in Focus Correlation for AP Biology Curriculum Framework
Campbell Biology in Focus Correlation for AP Biology Curriculum Framework Chapters/ Graphical analysis of allele frequencies in a population 5 Application of the Hardy-Weinberg equilibrium equation 1,
More informationStructure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
More informationNucleotides and Nucleic Acids
Nucleotides and Nucleic Acids Brief History 1 1869 - Miescher Isolated nuclein from soiled bandages 1902 - Garrod Studied rare genetic disorder: Alkaptonuria; concluded that specific gene is associated
More informationPores and pumps: facilitated diffusion, active transport, cotransport
Cell Biology Learning Objectives Core objectives: 1. Students will understand the structures and purposes of basic components of prokaryotic and eukaryotic cells, especially macromolecules, membranes,
More informationCOMPARING DNA SEQUENCES TO DETERMINE EVOLUTIONARY RELATIONSHIPS AMONG MOLLUSKS
COMPARING DNA SEQUENCES TO DETERMINE EVOLUTIONARY RELATIONSHIPS AMONG MOLLUSKS OVERVIEW In the online activity Biodiversity and Evolutionary Trees: An Activity on Biological Classification, you generated
More informationA short guide to phylogeny reconstruction
A short guide to phylogeny reconstruction E. Michu Institute of Biophysics, Academy of Sciences of the Czech Republic, Brno, Czech Republic ABSTRACT This review is a short introduction to phylogenetic
More informationBob Jesberg. Boston, MA April 3, 2014
DNA, Replication and Transcription Bob Jesberg NSTA Conference Boston, MA April 3, 2014 1 Workshop Agenda Looking at DNA and Forensics The DNA, Replication i and Transcription i Set DNA Ladder The Double
More informationGene mutation and molecular medicine Chapter 15
Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to
More informationActivity IT S ALL RELATIVES The Role of DNA Evidence in Forensic Investigations
Activity IT S ALL RELATIVES The Role of DNA Evidence in Forensic Investigations SCENARIO You have responded, as a result of a call from the police to the Coroner s Office, to the scene of the death of
More informationTaxonomy and Classification
Taxonomy and Classification Taxonomy = the science of naming and describing species Wisdom begins with calling things by their right names -Chinese Proverb museums contain ~ 2 Billion specimens worldwide
More informationMultiple Choice Write the letter that best answers the question or completes the statement on the line provided.
Name lass Date hapter 12 DN and RN hapter Test Multiple hoice Write the letter that best answers the question or completes the statement on the line provided. Pearson Education, Inc. ll rights reserved.
More informationUmm AL Qura University MUTATIONS. Dr Neda M Bogari
Umm AL Qura University MUTATIONS Dr Neda M Bogari CONTACTS www.bogari.net http://web.me.com/bogari/bogari.net/ From DNA to Mutations MUTATION Definition: Permanent change in nucleotide sequence. It can
More informationPRACTICE TEST QUESTIONS
PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.
More informationQuick Hit Activity Using UIL Science Contests For Formative and Summative Assessments of Pre-AP and AP Biology Students
Quick Hit Activity Using UIL Science Contests For Formative and Summative Assessments of Pre-AP and AP Biology Students Activity Title: Quick Hit Goal of Activity: To perform formative and summative assessments
More informationGiven these characteristics of life, which of the following objects is considered a living organism? W. X. Y. Z.
Cell Structure and Organization 1. All living things must possess certain characteristics. They are all composed of one or more cells. They can grow, reproduce, and pass their genes on to their offspring.
More informationBIO 1: Review: Evolution
Name: Class: Date: ID: A BIO 1: Review: Evolution True/False Indicate whether the statement is true or false. 1. Radiometric dating measures the age of an object by measuring the proportions of radioactive
More informationThe Steps. 1. Transcription. 2. Transferal. 3. Translation
Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order
More information2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
More informationThe world of non-coding RNA. Espen Enerly
The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often
More information12.1 The Role of DNA in Heredity
12.1 The Role of DNA in Heredity Only in the last 50 years have scientists understood the role of DNA in heredity. That understanding began with the discovery of DNA s structure. In 1952, Rosalind Franklin
More informationProtein Synthesis How Genes Become Constituent Molecules
Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein
More informationDnaSP, DNA polymorphism analyses by the coalescent and other methods.
DnaSP, DNA polymorphism analyses by the coalescent and other methods. Author affiliation: Julio Rozas 1, *, Juan C. Sánchez-DelBarrio 2,3, Xavier Messeguer 2 and Ricardo Rozas 1 1 Departament de Genètica,
More informationModeling DNA Replication and Protein Synthesis
Skills Practice Lab Modeling DNA Replication and Protein Synthesis OBJECTIVES Construct and analyze a model of DNA. Use a model to simulate the process of replication. Use a model to simulate the process
More informationKleptoplasty in Dinophysis spp. Ecological role and evolutionary implications
Kleptoplasty in Dinophysis spp Ecological role and evolutionary implications Linnaeus University Dissertations No 19/2010 KLEPTOPLASTY IN DINOPHYSIS SPP Ecological role and evolutionary implications SUSANNA
More informationEvolutionary Trees I
TreeofLife:BranchingBiology&HistoryThroughArt Evolutionary Trees I AN INTRODUCTION An overwhelming body of evidence supports the conclusion that every organism alive today and all those who have ever lived
More informationA new and diverse plastid-bearing microbial eukaryote. and its position on the eukaryotic tree of life.
A new and diverse plastid-bearing microbial eukaryote and its position on the eukaryotic tree of life. Submitted by James William Harrison to the University of Exeter as a thesis for the degree of Masters
More informationChapter 2: Cell Structure and Function pg. 70-107
UNIT 1: Biochemistry Chapter 2: Cell Structure and Function pg. 70-107 Organelles are internal structures that carry out specialized functions, interacting and complementing each other. Animal and plant
More information7.2 Cell Structure. Lesson Objectives. Lesson Summary. Cell Organization Eukaryotic cells contain a nucleus and many specialized structures.
7.2 Cell Structure Lesson Objectives Describe the structure and function of the cell nucleus. Describe the role of vacuoles, lysosomes, and the cytoskeleton. Identify the role of ribosomes, endoplasmic
More informationA Correlation of Pearson Miller & Levine Biology 2014 To the Utah Core State Standards for Biology Grades 9-12
A Correlation of Pearson To the Utah Core State Standards Resource Title: Publisher: Pearson Education publishing as Prentice Hall ISBN (10 or 13 digit unique identifier is required): SE: 9780133242003
More informationAP BIOLOGY 2010 SCORING GUIDELINES (Form B)
AP BIOLOGY 2010 SCORING GUIDELINES (Form B) Question 2 Certain human genetic conditions, such as sickle cell anemia, result from single base-pair mutations in DNA. (a) Explain how a single base-pair mutation
More informationDNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
More informationGuide for Bioinformatics Project Module 3
Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first
More informationA disaccharide is formed when a dehydration reaction joins two monosaccharides. This covalent bond is called a glycosidic linkage.
CH 5 Structure & Function of Large Molecules: Macromolecules Molecules of Life All living things are made up of four classes of large biological molecules: carbohydrates, lipids, proteins, and nucleic
More information11, Olomouc, 783 71, Czech Republic. Version of record first published: 24 Sep 2012.
This article was downloaded by: [Knihovna Univerzity Palackeho], [Vladan Ondrej] On: 24 September 2012, At: 05:24 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954
More informationMechanisms of Evolution
page 2 page 3 Teacher's Notes Mechanisms of Evolution Grades: 11-12 Duration: 28 mins Summary of Program Evolution is the gradual change that can be seen in a population s genetic composition, from one
More informationArbres formels et Arbre(s) de la Vie
Arbres formels et Arbre(s) de la Vie A bit of history and biology Definitions Numbers Topological distances Consensus Random models Algorithms to build trees Basic principles DATA sequence alignment distance
More informationAP Biology 2013 Scoring Guidelines
AP Biology 2013 Scoring Guidelines The College Board The College Board is a mission-driven not-for-profit organization that connects students to college success and opportunity. Founded in 1900, the College
More informationVisualization of Phylogenetic Trees and Metadata
Visualization of Phylogenetic Trees and Metadata November 27, 2015 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com support-clcbio@qiagen.com
More informationHonors Biology Course Summary Department: Science
Honors Biology Course Summary Department: Science Semester 1 Learning Objective #1 - Ecology Students will understand how organisms interact with each other and the environment. Target(s) to Meet Learning
More informationBio 102 Practice Problems Genetic Code and Mutation
Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine
More informationCore Bioinformatics. Degree Type Year Semester. 4313473 Bioinformàtica/Bioinformatics OB 0 1
Core Bioinformatics 2014/2015 Code: 42397 ECTS Credits: 12 Degree Type Year Semester 4313473 Bioinformàtica/Bioinformatics OB 0 1 Contact Name: Sònia Casillas Viladerrams Email: Sonia.Casillas@uab.cat
More information