COMPARING DNA SEQUENCES TO DETERMINE EVOLUTIONARY RELATIONSHIPS AMONG MOLLUSKS
|
|
|
- Dwain Briggs
- 10 years ago
- Views:
Transcription
1 COMPARING DNA SEQUENCES TO DETERMINE EVOLUTIONARY RELATIONSHIPS AMONG MOLLUSKS OVERVIEW In the online activity Biodiversity and Evolutionary Trees: An Activity on Biological Classification, you generated a phylogenetic tree of mollusks using only shell morphology. In this exercise, you will revisit that classification and reconstruct the phylogenetic tree using ClustalX, software that aligns and compares DNA sequences. You will use a simple viewer program called NJplot to view the tree. SOFTWARE AND FILES Install ClustalX, which is available at (For Windows, download clustalx-2.1-win.msi; for Mac OS, download clustalx-2.1-macosx.dmg.) Next, install NJplot, which is available at Then download the zip file containing all the DNA sequence files used in this exercise, which is found under the Biodiversity and Evolutionary Trees section at FORMAT OF DNA SEQUENCE INFORMATION There are different formats for representing DNA sequences. Shown below is a partial sequence from the dog s cytochrome oxidase subunit I (COI) gene in FASTA format. FASTA format starts with a >, followed by information about the file to the end of the first line, followed by the DNA sequence. >gi gb JN Canis lupus familiaris isolate dog_3 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial TACTTTATACTTACTATTTGGAGCATGAGCCGGTATAGTAGGCACTGCCTTGAGCCTCCTCATCCGAGCC GAACTAGGTCAGCCCGGTACTTTACTAGGTGACGATCAAATTTATAATGTCATYGTAACCGCCCATGCTT A file containing FASTA format sequence information may contain multiple sequences one after another. For example: Published April Page 1 of 10
2 WHAT SEQUENCES DO WE CHOOSE TO COMPARE? In modern taxonomic practice, scientists routinely analyze the DNA from specimens they collect to obtain a DNA barcode, a short DNA sequence unique to a particular species, which is used to identify the species it belongs to. For animals and many other eukaryotes, the mitochondrial cytochrome oxidase subunit I (COI) gene, which encodes part of an enzyme that is important for cellular respiration, has been used to generate such barcodes. As a result, COI sequences are available from a wide range of species, making it possible to use this gene sequence to explore phylogenetic relationships. COI is a good choice for DNA barcoding, because, in general, there is little variation in COI sequences of organisms within the same species, while there is significant variation in COI sequences of organisms from different species. Therefore, a COI sequence provides a unique sequence signature for a particular species. For the same reasons, the COI gene is suitable for comparing phylogenetic relationships between species. Because the COI sequences are so similar within the same species, the COI gene is not a good choice for studying variations within the same species, or even among species that have recently speciated. COI sequences also have a low mutation rate among many species of plants and cannot be used for DNA barcoding or phylogenetic comparisons of those species. Page 2 of 10
3 EXERCISE 1: AN OVERVIEW OF CLUSTALX Let s use ClustalX to compare DNA sequences. For this exercise, use the test sequence file test.txt, which contains the three short DNA sequences (test1, test2, and test3) shown below: >test1 AAGGAAGGAAGGAAGGAAGGAAGG >test2 AAGGAAGGAATGGAAGGAAGGAAGG >test3 AAGGAACGGAATGGTAGGAAGGAAGG Load these sequences into ClustalX by choosing from the menu, File -> Load Sequences, and then selecting test.txt. ClustalX displays these sequences as shown in the illustration on the right (PC version shown). Before you can compare sequences, you have to align them, which means lining up the sequences and sliding them past one another until the best matching pattern is found. Alignment allows you to examine differences between related sequences; such differences reflect evolutionary relationships. From the menu, choose Alignment -> Do Complete Alignment. When prompted for output file names, use the default names given and click OK. The screen changes to looks like the second illustration on the right. Notice that it s a lot easier to see differences among DNA sequences after alignment. You can figure out what kinds of mutations have occurred in each sequence by how it compares to the others (as shown in the third illustration). The number of differences among sequences determines how closely or distantly related the corresponding organisms are. Deletion Based on this information alone, which two sequences do you think are more closely related? To see if your answer was accurate, we can use ClustalX to generate a phylogenetic tree. Insertion Substitution From the menu, choose Trees -> Draw Tree. This creates a phylogenetic tree file called test1.ph, which can be opened using NJplot.exe. Launch NJplot, then from its menu, choose File -> Open, and select test1.ph. Page 3 of 10
4 The result shows that test1 and test2 are on the same branch of the tree, indicating that they are more closely related to each other than to test3. Page 4 of 10
5 EXERCISE 2: PHYLOGENY OF NEOGASTROPODS, TONNOIDS, AND COWRIES In the online seashell-sorting activity, Biodiversity and Evolutionary Trees: An Activity on Biological Classification, one of the questions you had to answer was which two groups of gastropods among neogastropods, tonnoids, and cowries are more closely related. Based on the information in that activity, the correct answer was tonnoids and cowries. Let s confirm that conclusion using molecular data. Load the file molluscs1.txt into ClustalX. (For this exercise, the DNA sequences used were obtained from representative species from each group as follows: neogastropods = Conus magus; tonnoids = Bursa granularis; and cowries = Cypraea tigris.) Align the sequences by choosing from the menu, Alignment -> Do Complete Alignment. Then choose from the menu, Trees -> Draw Tree. Page 5 of 10
6 The result is shown below; it confirms that the tonnoids and the cowries are more closely related to each other than to the neogastropods. Page 6 of 10
7 EXERCISE 3: PHYLOGENY OF MOLLUSKS The final phylogeny obtained from the online seashell-sorting activity is shown below Conus magus 2. Neritina communis 3. Bursa nobilis 4. Conus capitaneus 5. Cypraea annulus 6. Conus marmoreus Distorsio anus 9. Conus omaria 10. Cypraea isabella 11. Pecten pallium 12. Cypraea tigris 13. Conus ebraeus Conus chaldeus Imbricaria conularis 18. Conus circumcisus 19. Cypraea moneta 20. Turris babylonia (Blank numbers are due to multiple specimens from the same species in the online seashell-sorting activity.) We will compare the phylogenetic tree above, obtained using morphological information, with a tree obtained using DNA sequence data. The file molluscs2.txt contains COI DNA sequences from all of the shells in this tree*. Load that file into ClustalX. Page 7 of 10
8 Align the sequences and make a phylogenetic tree. Examine the resulting tree in NJplot and compare it to the one above. Confirm that the patterns of the various groupings are the same. Even though the order of species in the tree on the left is not the same as in the tree above, the two trees are the same topologically. That means if you imagine the tree on the left is like a mobile hanging from a ceiling, you could rotate each branch point in the tree to make it the same as the tree above. However, in the ClustalX tree, individual cone snails and cowries have their own branches. Cone Snails Tonnoids Cowries * Because COI gene sequences for five of the species used in the online seashell activity were not available, we used substitute sequences from closely related species. Substitutions were as follows: Neritina pulligera was substituted for Neritina communis; Distorsio reticularis for Distorsio anus; Bursa granularis for Bursa nobilis; Mitra lens for Imbricaria conularis; Pecten jacobaeus for Pecten pallium. Page 8 of 10
9 EXERCISE 4: INQUIRY-BASED ACTIVITY COMPARING SEQUENCES OF YOUR CHOICE In this exercise, you will find the DNA sequences from species you want to compare. To find DNA sequences, go to the National Center for Biotechnology Information s (NCBI s) nucleotide resource page at NCBI website images are current as of March Search Box In the search box at the top of the page, enter the species you are interested in and coi (for cytochrome oxidase I gene). Your search will be more effective if you use the scientific species name. For example, instead of dog, enter canis lupus familiaris. FASTA link Look for something about 700 bases long listed as cytochrome oxidase subunit I (COI) gene, and partial cds; mitochondrial. In the screenshot above, both search result 1 and 2 are DNA sequences from dog and would be good choices for this activity. But you have to be careful in selecting which file to use, as sequences from different species or sequences of different genes may be present. For example, the third result is for Dirofilaria, a common parasite of dogs. Page 9 of 10
10 Once you know which sequence you want to use, click on the FASTA file link, then select all the text, copy it, and paste it into a new document as a plain text file. Remember that in FASTA format, the first line contains the information about the sequence and starts with > and ends at the end of the line. >gi gb JN Canis lupus familiaris isolate dog_3 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial ClustalX uses the letters after > until the first space as the label for the file. In this case, the label is gi gb JN The label will be used onscreen and in the tree diagram, so it would help if you edited it to something simpler for this exercise. For example, you could insert Dog after the > so that it reads: >Dog gi gb JN Canis lupus familiaris isolate dog_3 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial Once you have the DNA sequence information from all the organisms you want to compare, assemble them all into a single text file. Be sure to save your file as a plain text (.txt) file. If you want to see what that looks like, you can look at molluscs2.txt as a model. Once you have all the sequences loaded, the procedure for aligning them and drawing a tree and looking at it is the same as before. Be creative and explore obscure species that you only read about in books or websites! You may also want to repeat this exercise using different genes. For phylogenetic comparisons to work, the gene should be conserved among different species you are interested in, similar enough to be compared, yet different enough to give enough variability. You could try genes for actin, myosin, or ubiquitin. If you restrict the range of species, even the gene for hemoglobin may work. Page 10 of 10
Lab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS
Lab 2/Phylogenetics/September 16, 2002 1 Read: Tudge Chapter 2 PHYLOGENETICS Objective of the Lab: To understand how DNA and protein sequence information can be used to make comparisons and assess evolutionary
investigation 3 Comparing DNA Sequences to
Big Idea 1 Evolution investigation 3 Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST How can bioinformatics be used as a tool to determine evolutionary relationships and to
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6
Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6 In the last lab, you learned how to perform basic multiple sequence alignments. While useful in themselves for determining conserved residues
Analyzing A DNA Sequence Chromatogram
LESSON 9 HANDOUT Analyzing A DNA Sequence Chromatogram Student Researcher Background: DNA Analysis and FinchTV DNA sequence data can be used to answer many types of questions. Because DNA sequences differ
GenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
Biological Sequence Data Formats
Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA
Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011
Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear
MultiExperiment Viewer Quickstart Guide
MultiExperiment Viewer Quickstart Guide Table of Contents: I. Preface - 2 II. Installing MeV - 2 III. Opening a Data Set - 2 IV. Filtering - 6 V. Clustering a. HCL - 8 b. K-means - 11 VI. Modules a. T-test
Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.
Name: Class: Date: Chapter 17 Practice Multiple Choice Identify the choice that best completes the statement or answers the question. 1. The correct order for the levels of Linnaeus's classification system,
BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS
BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:
Robert G. Young & Sarah Adamowicz University of Guelph Cathryn Abbott & Tom Therriault Department of Fisheries and Oceans
Evaluating Canadian zooplankton biodiversity through DNA barcodes: assessing non-indigenous species presence to provide a framework for future monitoring Robert G. Young & Sarah Adamowicz University of
Name Class Date. binomial nomenclature. MAIN IDEA: Linnaeus developed the scientific naming system still used today.
Section 1: The Linnaean System of Classification 17.1 Reading Guide KEY CONCEPT Organisms can be classified based on physical similarities. VOCABULARY taxonomy taxon binomial nomenclature genus MAIN IDEA:
LESSON 9. Analyzing DNA Sequences and DNA Barcoding. Introduction. Learning Objectives
9 Analyzing DNA Sequences and DNA Barcoding Introduction DNA sequencing is performed by scientists in many different fields of biology. Many bioinformatics programs are used during the process of analyzing
Section 3 Comparative Genomics and Phylogenetics
Section 3 Section 3 Comparative enomics and Phylogenetics At the end of this section you should be able to: Describe what is meant by DNA sequencing. Explain what is meant by Bioinformatics and Comparative
Visualization of Phylogenetic Trees and Metadata
Visualization of Phylogenetic Trees and Metadata November 27, 2015 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com [email protected]
Biological Databases and Protein Sequence Analysis
Biological Databases and Protein Sequence Analysis Introduction M. Madan Babu, Center for Biotechnology, Anna University, Chennai 25, India Bioinformatics is the application of Information technology to
A Correlation of Miller & Levine Biology 2014
A Correlation of Miller & Levine Biology To Ohio s New Learning Standards for Science, 2011 Biology, High School Science Inquiry and Application Course Content A Correlation of, to Introduction This document
Supervised DNA barcodes species classification: analysis, comparisons and results. Tutorial. Citations
Supervised DNA barcodes species classification: analysis, comparisons and results Emanuel Weitschek, Giulia Fiscon, and Giovanni Felici Citations If you use this procedure please cite: Weitschek E, Fiscon
Understanding by Design. Title: BIOLOGY/LAB. Established Goal(s) / Content Standard(s): Essential Question(s) Understanding(s):
Understanding by Design Title: BIOLOGY/LAB Standard: EVOLUTION and BIODIVERSITY Grade(s):9/10/11/12 Established Goal(s) / Content Standard(s): 5. Evolution and Biodiversity Central Concepts: Evolution
How to configure your Acrobat Signature Appearance
How to configure your Acrobat Signature Appearance An Acrobat Signature Appearance for use within SpeediSign is created within Adobe Acrobat Professional. This signature appearance is then called within
Core Bioinformatics. Degree Type Year Semester. 4313473 Bioinformàtica/Bioinformatics OB 0 1
Core Bioinformatics 2014/2015 Code: 42397 ECTS Credits: 12 Degree Type Year Semester 4313473 Bioinformàtica/Bioinformatics OB 0 1 Contact Name: Sònia Casillas Viladerrams Email: [email protected]
Assign: Unit 1: Preparation Activity page 4-7. Chapter 1: Classifying Life s Diversity page 8
Assign: Unit 1: Preparation Activity page 4-7 Chapter 1: Classifying Life s Diversity page 8 1.1: Identifying, Naming, and Classifying Species page 10 Key Terms: species, morphology, phylogeny, taxonomy,
WJEC AS Biology Biodiversity & Classification (2.1 All Organisms are related through their Evolutionary History)
Name:.. Set:. Specification Points: WJEC AS Biology Biodiversity & Classification (2.1 All Organisms are related through their Evolutionary History) (a) Biodiversity is the number of different organisms
MAKING AN EVOLUTIONARY TREE
Student manual MAKING AN EVOLUTIONARY TREE THEORY The relationship between different species can be derived from different information sources. The connection between species may turn out by similarities
Guide for Bioinformatics Project Module 3
Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first
2.3 Identify rrna sequences in DNA
2.3 Identify rrna sequences in DNA For identifying rrna sequences in DNA we will use rnammer, a program that implements an algorithm designed to find rrna sequences in DNA [5]. The program was made by
AP Biology Essential Knowledge Student Diagnostic
AP Biology Essential Knowledge Student Diagnostic Background The Essential Knowledge statements provided in the AP Biology Curriculum Framework are scientific claims describing phenomenon occurring in
Bioinformatics Grid - Enabled Tools For Biologists.
Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis
MASTER OF SCIENCE IN BIOLOGY
MASTER OF SCIENCE IN BIOLOGY The Master of Science in Biology program is designed to provide a strong foundation in concepts and principles of the life sciences, to develop appropriate skills and to inculcate
NOTE: LakeMaster charts purchased from chartselect.humminbird.com do not need to be registered.
1 OVERVIEW Humminbird ChartSelect allows you to purchase Humminbird LakeMaster charts and save them to encrypted SD or microsd Cards to use on your Humminbird fishing system. Preparation: We recommend
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
Vector NTI Advance 11 Quick Start Guide
Vector NTI Advance 11 Quick Start Guide Catalog no. 12605050, 12605099, 12605103 Version 11.0 December 15, 2008 12605022 Published by: Invitrogen Corporation 5791 Van Allen Way Carlsbad, CA 92008 U.S.A.
DNA Barcoding: A New Tool for Identifying Biological Specimens and Managing Species Diversity
DNA Barcoding: A New Tool for Identifying Biological Specimens and Managing Species Diversity DNA barcoding has inspired a global initiative dedicated to: Creating a library of new knowledge about species
MCAS Biology. Review Packet
MCAS Biology Review Packet 1 Name Class Date 1. Define organic. THE CHEMISTRY OF LIFE 2. All living things are made up of 6 essential elements: SPONCH. Name the six elements of life. S N P C O H 3. Elements
17 July 2014 WEB-SERVER MANUAL. Contact: Michael Hackenberg ([email protected])
WEB-SERVER MANUAL Contact: Michael Hackenberg ([email protected]) 1 1 Introduction srnabench is a free web-server tool and standalone application for processing small- RNA data obtained from next generation
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
Accessing the Online Meeting Room (Blackboard Collaborate)
Step 1: Check your System and Install Required Software NOTE: Make sure you are on the computer you will be using to access the online meeting room AND that you are using the internet browser (ie: firefox,
A Tutorial in Genetic Sequence Classification Tools and Techniques
A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University [email protected] www.jakemdrew.com Sequence Characters IUPAC nucleotide
Genomes and SNPs in Malaria and Sickle Cell Anemia
Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing
Phylogenetic Trees Made Easy
Phylogenetic Trees Made Easy A How-To Manual Fourth Edition Barry G. Hall University of Rochester, Emeritus and Bellingham Research Institute Sinauer Associates, Inc. Publishers Sunderland, Massachusetts
Genome Explorer For Comparative Genome Analysis
Genome Explorer For Comparative Genome Analysis Jenn Conn 1, Jo L. Dicks 1 and Ian N. Roberts 2 Abstract Genome Explorer brings together the tools required to build and compare phylogenies from both sequence
A data management framework for the Fungal Tree of Life
Web Accessible Sequence Analysis for Biological Inference A data management framework for the Fungal Tree of Life Kauff F, Cox CJ, Lutzoni F. 2007. WASABI: An automated sequence processing system for multi-gene
PAGE NUMBERING FOR THESIS/DISSERTATION
PAGE NUMBERING FOR THESIS/DISSERTATION PAGE NUMBERS A BRIEF OVERVIEW: Though normally we insert page numbers at the beginning of documents, the graduate school has special requirements regarding page numbers.
Tutorial How to upgrade firmware on Phison S8 controller MyDigitalSSD using a Windows PE environment
Tutorial How to upgrade firmware on Phison S8 controller MyDigitalSSD using a Windows PE environment Version 2.0 This tutorial will walk you through how to create a bootable USB drive to enter into a WINPE
Using the enclosed installation diagram, drill three holes in the wall with the lower hole 1150mm from the floor.
Terminal Installation When choosing the location of the terminal, care should be taken to select an area with consistent light levels throughout the day and avoid areas where the unit may be subjected
How To Encrypt A Traveltrax Report On Gpg On A Pc Or Mac Or Mac (For A Free Download) On A Thumbdrive Or Ipad Or Ipa (For Free) On Pc Or Ipo (For An Ipo)
EMAIL ENCRYPTION Guide June 3, 2013 TABLE OF CONTENTS Steps to Create Encryption Public Key... 3 Installing GPG... 3 Key Generation Process... 4 Update User Settings... 6 Decrypting an encrypted file...
Instructions for Registering for a Miradi Account & Installing Miradi Software
Instructions for Registering for a Miradi Account & Installing Miradi Software www.miradi.org/download Version: March 2015 Introduction The following slides guide users through the process for registering
DNA Sequence Alignment Analysis
Analysis of DNA sequence data p. 1 Analysis of DNA sequence data using MEGA and DNAsp. Analysis of two genes from the X and Y chromosomes of plant species from the genus Silene The first two computer classes
Tutorial: Assigning Prelogin Criteria to Policies
CHAPTER 4 This tutorial provides an overview of the CSD configuration sequence. The configuration chapters that follow provide detailed instructions on the attributes. The sections are as follows: Overview
UGENE Quick Start Guide
Quick Start Guide This document contains a quick introduction to UGENE. For more detailed information, you can find the UGENE User Manual and other special manuals in project website: http://ugene.unipro.ru.
HOW TO CREATE AN HTML5 JEOPARDY- STYLE GAME IN CAPTIVATE
HOW TO CREATE AN HTML5 JEOPARDY- STYLE GAME IN CAPTIVATE This document describes the steps required to create an HTML5 Jeopardy- style game using an Adobe Captivate 7 template. The document is split into
Mobile Broadband: E160 Software Upgrade User Guide
MBB_UpgradeGuide_v1 Mobile Broadband: E160 Software Upgrade User Guide The software on your Modem is divided into two parts: 1. Connection Manager (also known as dashboard or Modem Manager) 2. Firmware
Introduction to Phylogenetic Analysis
Subjects of this lecture Introduction to Phylogenetic nalysis Irit Orr 1 Introducing some of the terminology of phylogenetics. 2 Introducing some of the most commonly used methods for phylogenetic analysis.
A Step-by-Step Tutorial: Divergence Time Estimation with Approximate Likelihood Calculation Using MCMCTREE in PAML
9 June 2011 A Step-by-Step Tutorial: Divergence Time Estimation with Approximate Likelihood Calculation Using MCMCTREE in PAML by Jun Inoue, Mario dos Reis, and Ziheng Yang In this tutorial we will analyze
BIOINFORMATICS TUTORIAL
Bio 242 BIOINFORMATICS TUTORIAL Bio 242 α Amylase Lab Sequence Sequence Searches: BLAST Sequence Alignment: Clustal Omega 3d Structure & 3d Alignments DO NOT REMOVE FROM LAB. DO NOT WRITE IN THIS DOCUMENT.
Diablo Valley College Catalog 2014-2015
Biological science BIOSC Diablo Valley College is approved by the California Board of Registered Nurses for continuing education credits. Biological Science courses which can be used are BIOSC-119, 120,
National Site Tracking System
RESOURCE AND PATIENT MANAGEMENT SYSTEM National Site Tracking System (BNP) Version 1.0 Office of Information Technology (OIT) Division of Information Resource Management Albuquerque, New Mexico Table of
Version 5.0 Release Notes
Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com
Sample Table. Columns. Column 1 Column 2 Column 3 Row 1 Cell 1 Cell 2 Cell 3 Row 2 Cell 4 Cell 5 Cell 6 Row 3 Cell 7 Cell 8 Cell 9.
Working with Tables in Microsoft Word The purpose of this document is to lead you through the steps of creating, editing and deleting tables and parts of tables. This document follows a tutorial format
USB 2.0 3.5 External Hard Disk Drive
USB 2.0 3.5 External Hard Disk Drive System Requirements Notebook or Desktop PC with USB2.0 or USB1.1 port. Windows 98SE/Me/2000, or Windows XP (Make sure the device driver for USB Host controller has
Getting to Know Your Mobile Internet Key
Thank you for choosing the Huawei E3276 4G LTE Mobile Internet Key. With your Mobile Internet Key, you can enjoy a full high speed Internet experience on the go. This guide shows you how to set-up and
Protein Sequence Analysis - Overview -
Protein Sequence Analysis - Overview - UDEL Workshop Raja Mazumder Research Associate Professor, Department of Biochemistry and Molecular Biology Georgetown University Medical Center Topics Why do protein
Molecular Clocks and Tree Dating with r8s and BEAST
Integrative Biology 200B University of California, Berkeley Principals of Phylogenetics: Ecology and Evolution Spring 2011 Updated by Nick Matzke Molecular Clocks and Tree Dating with r8s and BEAST Today
New challenges for research in biodiversity and ecology of micro- and macro-algae
Summer School in New challenges for research in biodiversity and ecology of micro- and macro-algae Dates: 27/11 to 06/12/2015 Place: Estación Costera de Investigaciones Marinas (ECIM), Las Cruces, Chile
Step by step guide how to password protect your USB flash drive
Step by step guide how to password protect your USB flash drive 1 Content 1. How to create encrypted partition on USB flash drive 2. How to work with encrypted partition on the USB flash drive - Rohos
Bulk Downloader. Call Recording: Bulk Downloader
Call Recording: Bulk Downloader Contents Introduction... 3 Getting Started... 3 Configuration... 4 Create New Job... 6 Running Jobs... 7 Job Log... 7 Scheduled Jobs... 8 Recent Runs... 9 Storage Device
DnaSP, DNA polymorphism analyses by the coalescent and other methods.
DnaSP, DNA polymorphism analyses by the coalescent and other methods. Author affiliation: Julio Rozas 1, *, Juan C. Sánchez-DelBarrio 2,3, Xavier Messeguer 2 and Ricardo Rozas 1 1 Departament de Genètica,
Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment
Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249
Introduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 [email protected]
Summer School: New challenges for research in biodiversity and ecology of micro- and macro-algae. Date: from 27/11 to 06/12/2015,
Summer School: New challenges for research in biodiversity and ecology of micro- and macro-algae Date: from 27/11 to 06/12/2015, Place: PROGRAM Algal biodiversity Introduction to algal diversity (definition
BARCODING LIFE, ILLUSTRATED
BARCODING LIFE, ILLUSTRATED Goals, Rationale, Results Barcoding is a standardized approach to identifying animals and plants by minimal sequences of DNA. 1. Why barcode animal and plant species? By harnessing
Lab 1 Introduction to Microsoft Project
Lab 1 Introduction to Microsoft Project Statement Purpose This lab provides students with the knowledge and skills to use Microsoft Project. This course takes students step-by-step through the features
Practice Questions 1: Evolution
Practice Questions 1: Evolution 1. Which concept is best illustrated in the flowchart below? A. natural selection B. genetic manipulation C. dynamic equilibrium D. material cycles 2. The diagram below
Dual-boot Windows 10 alongside Windows 8
Most of the people are very much interested to install the newly launched Operating System Windows 10 on their devices. But, it is not recommended to directly use Windows 10 as the primary OS because it
EZ RMC Remote HMI App Application Guide for ios
EZ RMC Remote HMI App Application Guide for ios The EZ RMC Remote HMI App is an application designed for your ios devices to enable the monitoring and control of your EZTouch HMIs from EZAutomation.net.
MAS 90 Demo Guide: Accounts Payable
MAS 90 Demo Guide: Accounts Payable Vendors, invoice tracking, and check creation is a necessity of business. In this guide we will look at how vendors are set up, invoices are recorded, and checks are
FileMaker Pro and Microsoft Office Integration
FileMaker Pro and Microsoft Office Integration page Table of Contents Executive Summary...3 Introduction...3 Top Reasons to Read This Guide...3 Before You Get Started...4 Downloading the FileMaker Trial
Belkin USB Flash Drive
Belkin USB Flash Drive Model F5U025 User Guide Belkin USB Flash Drive Overview Storing and moving data has never been easier. Introducing the Belkin USB Flash Drive. Simply plug the Flash Drive into the
Tutorial for proteome data analysis using the Perseus software platform
Tutorial for proteome data analysis using the Perseus software platform Laboratory of Mass Spectrometry, LNBio, CNPEM Tutorial version 1.0, January 2014. Note: This tutorial was written based on the information
Lab 1: Create a Personal Homepage
Objectives: Lab 1: Create a Personal Homepage Understand the basics of HTML Create a personal website, if you do not have one Learn how to submit your assignments Preparation 1. Create a folder with the
Ubiquity getting started
Introduction This document describes the most important steps to quickly get started with Ubiquity Installation Domain creation Device registration and activation Version Description Date 1 First emission
ML310 Creating a VxWorks BSP and System Image for the Base XPS Design
ML310 Creating a VxWorks BSP and System Image for the Base XPS Design Note: Screen shots in this acrobat file appear best when Acrobat Magnification is set to 133.3% Outline Software Requirements Software
You can access it anywhere - on your desktop, online, or on your ipad. Benefits include:-
EndNote online Contents Introduction... 2 Creating an EndNote online account... 2 Option 1: via EndNote desktop (X7)... 2 Option 2: via EndNote online... 4 Online search (Collect)... 5-6 Manual entry (Collect)...
Biology Major and Minor (from the 2007-2008 College Catalog)
Biology Major and Minor (from the 2007-2008 College Catalog) Biology (BI) Science and Mathematics Bachelor of Science R. Scot Duncan, Andrew Gannon, Megan Gibbons, Pamela Hanson, Leo Pezzementi, Gretchen
Secure Data Transfer
Secure Data Transfer INSTRUCTIONS 3 Options to SECURELY TRANSMIT DATA 1. FTP 2. WinZip 3. Password Protection Version 2.0 Page 1 Table of Contents Acronyms & Abbreviations...1 Option 1: File Transfer Protocol
DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
ECView Pro Network Management System. Installation Guide. www.edge-core.com
ECView Pro Network Management System Installation Guide www.edge-core.com INSTALLATION GUIDE ECVIEW PRO NETWORK MANAGEMENT SYSTEM SNMP-Based Network Management Software for Windows SW6102 E102010-CS-R01
Exporting emails from Outlook Version 1.00
Exporting emails from Outlook Version 1.00 The rapid growth in volume of emails means that there is a growing need to archive old emails to media such as external hard disks and DVD s. The document will
